Abstracts of the Scientific Posters, 2013 AACC Annual Meeting ...

Abstracts of the Scientific Posters, 2013 AACC Annual Meeting 

Clinical 

Chemistry 

www.clinchem.org Volume 59 Number S10 Pages A1-A295 OCTOBER 2013 

Supplement to Clinical Chemistry

SCIENTIFIC POSTER SESSION SCHEDULE 

Posters of the accepted abstracts can be viewed in the Exhibit Hall of the George R. Brown Convention Center, 

on Tuesday, July 30 and Wednesday, July 31. All posters will be posted for two and one half hours. The 

presenting author will be in attendance during the f nal hour. Please refer to the onsite Program Guide for a 

complete listing of the posters. Poster presenters are underlined in abstract listing. 

Below are the topics and their scheduled times. 

TUESDAY, JULY 30, POSTER SESSIONS 

9:30am – 5:00pm 

Cancer/Tumor Markers . . . . . . . . . . . . . . . . . A02 – A74 . . . . . . . . . . . . . . . . . . . . . . . . A2 

Automation/Computer Applications . . . . . . . A75 – A92 . . . . . . . . . . . . . . . . . . . . . . . A20 

Molecular Pathology/Probes . . . . . . . . . . . . . A93 – A131 . . . . . . . . . . . . . . . . . . . . . . A27 

Nutrition/Trace Metals/Vitamins . . . . . . . . . . A132 – A154 . . . . . . . . . . . . . . . . . . . . . A37 

Mass Spectrometry Applications . . . . . . . . . . A155 – A222 . . . . . . . . . . . . . . . . . . . . . A44 

Immunology . . . . . . . . . . . . . . . . . . . . . . . . . A223 – A278 . . . . . . . . . . . . . . . . . . . . . A67 

Endocrinology/Hormones . . . . . . . . . . . . . . . A279 – A363 . . . . . . . . . . . . . . . . . . . . . A84 

Clinical Studies/Outcomes . . . . . . . . . . . . . . A364 – A424 . . . . . . . . . . . . . . . . . . . . A112 

TDM/Toxicology/DAU . . . . . . . . . . . . . . . . . A425 – A476 . . . . . . . . . . . . . . . . . . . . A127 

Hematology/Coagulation . . . . . . . . . . . . . . . A477 – A525 . . . . . . . . . . . . . . . . . . . . A144 

Factors Affecting Test Results . . . . . . . . . . . . A527 – A561 . . . . . . . . . . . . . . . . . . . . A158 

WEDNESDAY, JULY 31, POSTER SESSIONS 

9:30am – 5:00pm 

Animal Clinical Chemistry . . . . . . . . . . . . . . B01 – B09 . . . . . . . . . . . . . . . . . . . . . . A170 

Management . . . . . . . . . . . . . . . . . . . . . . . . . B10 – B41 . . . . . . . . . . . . . . . . . . . . . . A173 

Point-of-Care Testing . . . . . . . . . . . . . . . . . . B42 – B88 . . . . . . . . . . . . . . . . . . . . . . A181 

Infectious Disease . . . . . . . . . . . . . . . . . . . . . B89 – B150 . . . . . . . . . . . . . . . . . . . . . A197 

Proteins/Enzymes . . . . . . . . . . . . . . . . . . . . . B151 – B174 . . . . . . . . . . . . . . . . . . . . A215 

Cardiac Markers . . . . . . . . . . . . . . . . . . . . . . B175 – B239 . . . . . . . . . . . . . . . . . . . . A223 

Technology/Design Development . . . . . . . . . B240 – B267 . . . . . . . . . . . . . . . . . . . . A242 

Electrolytes/Blood Gas/Metabolites . . . . . . . B268 – B283 . . . . . . . . . . . . . . . . . . . . A252 

Pediatric/Fetal Clinical Chemistry . . . . . . . . B284 – B313 . . . . . . . . . . . . . . . . . . . . A257 

Lipids/Lipoproteins . . . . . . . . . . . . . . . . . . . . B316 – B345 . . . . . . . . . . . . . . . . . . . . A266 

Author Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A276 

Keyword Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A288 

Ed. Note: These abstracts have been reproduced without editorial alteration from the materials supplied by the authors. Infelicities of 

preparation, grammar, spelling, style, syntax and usage are the authors’. The abstracts of those posters that were presented at the meeting 

can be found in the October issue of Clinical Chemistry.

Tuesday, July 30, 9:30 am – 5:00 pm 

Cancer/Tumor Markers 

A-02 

Tuesday, July 30, 2013 

Poster Session: 9:30 AM - 5:00 PM 


Smoking History Impacts Gene Expression Levels of Human Breast 

Carcinoma 

J. L. Wittliff, S. A. Andres, M. A. Alatoum, T. S. Kalbfleisch. University of 

Louisville, Louisville, KY 

In contrast to studies of other investigators that focused on cigarette smoking and 

risk of breast cancer occurrence, our emphasis is to explore the influence of tobacco 

smoking on breast cancer risk of recurrence and progression. Our goal is to combine 

knowledge of lifestyle behavior (smoking history) and molecular phenotypes of the 

breast lesion to improve assessment of risk of recurrence. We utilized microarray data 

obtained from laser capture microdissected carcinoma cells from 247 de-identified 

patient tissue biopsies to select candidate genes to analyze the effects of tobacco 

smoking on gene expression in breast cancer. The study population consisted of 66 

cigarette smokers and 99 non-smokers. Each of these groups was stratified further 

into patients that remained disease-free vs. those that had a recurrence. Using 

non-parametric methods (e.g., t-test) the distribution of each of the ~22,000 genes 

represented in the microarray were analyzed by three comparisons: 1) all smokers 

vs. all non-smokers; 2) smokers with a recurrence vs. those that remained diseasefree; 

and 3) non-smokers with a recurrence vs. those that remained disease-free. 

These analyses identified 15 genes (APOC1, ARID1B, CTNNBL1, MSX1, UBE2F, 

IRF2, NCOA1, LECT2, THAP4, RIPK1, AGPAT1, C7orf23, CENPN, CETN1 and 

YTHDC2) for further investigation. Using the entire patient population, a correlation 

of increased disease-free survival (DFS) and overall survival (OS) was observed 

with increased gene expression of IRF2, NCOA1, THAP4, RIPK1, C7orf23 and 

YTHDC2 (p



determined using a Student’s t test and analysis was determined using GraphPad prism 

software. In conclusion, this is the first study to show the elevation of serum BCMA in 

patients with MM and levels correlated with the change in tumor volume in response 

to treatment with cyclophosphamide and bortezomib. We propose that BCMA may be 

a new serum biomarker for patients with MM, and is useful to determine prognosis 

and monitor the course of their disease. 

A-05 

PSA Enzymatic Activity: A New Biomarker for Assessing Prostate 

Cancer Aggressiveness 

D. Georganopoulou 1 , M. Ahrens 1 , P. Bertin 1 , E. Vonesh 2 , T. J. Meade 3 , 

W. J. Catalona 3 . 1 Ohmx Corporation, Evanston, IL, 2 Vonesh Statistical 

Consulting, Libertyville, IL, 3 Northwestern University, Chicago, IL 

Background and objectives: The recent increase in prostate-specific antigen (psa) 

screening rates coupled with improved detection methods have caused a controversial 

upsurge in the number of men undergoing prostate biopsy and subsequent treatment. 

However, current diagnostic techniques generally suffer from limited ability to 

identify which seemingly indolent prostate cancers (pca) are biologically aggressive. 

We set out to determine if pca aggressiveness is associated with psa enzymatic activity 

in ex vivo prostatic fluid. 

Methods: We collected prostatic fluid from 778 post-radical prostatectomy specimens 

and randomly selected samples from both the clinically confirmed aggressive (n = 50) 

and non-aggressive (n =50) prostate cancer populations for our initial pilot study. In a 

blind study, we measured the level of proteolytic enzyme activity of psa (apsa) in each 

sample using a fluorogenic peptide probe and used receiver operating characteristic 

(roc) analysis to correlate apsa levels with prostate cancer aggressiveness. 

Results: We observed that the clinically non-aggressive population had a significantly 

higher apsa value (mean = 865μg/ml; median = 654μg/ml) than the clinically 

aggressive population (mean = 518μg/ml; median = 449μg/ml), meaning there is a 

negative association of apsa with cancer aggressiveness. We performed a roc analysis 

appropriate for an unmatched case control study to assess the highest diagnostic effect 

for predicting aggressive pca. Among factors considered, apsa and the normalized 

ratio of apsa/serum tpsa (rpsa) had the highest discriminatory power for predicting 

the presence of aggressive pca. We calculated an area under the curve (auc) of 0.7008 

[95% ci: (0.5986, 0.8030)] for apsa and 0.7784 [95% ci: (0.6880, 0.8688)] for rpsa 

with the latter being significantly higher (p-value = 0.0300 based on a chi-square test). 

Conclusions: Our results show a significant correlation between pca progression and 

apsa in prostatic fluid. We found the range of measured apsa for aggressive cases was 

94 - 1220 μg/ml while non-aggressive cases ranged from 207 - 2626 μg/ml within 

our pilot study. Within the non-aggressive group, there were 11 samples whose apsa 

values (1238 - 2626 μg/ml) were greater than the highest apsa value measured within 

the aggressive cohort (1220 μg/ml). Using apsa as an aggressiveness biomarker could 

result in many (22% in our study population) of the patients diagnosed with nonaggressive 

pca being able to avoid or delay radical prostatectomy. 

Source of funding: national institutes of health (grant #1r43ca156786-01). 

A-06 

A Highly Sensitive and Specific Method for Characterization of 

Circulating Tumor Cell Subtypes in Breast Cancer Patients 

L. Millner, K. Goudy, T. Kampfrath, M. Linder, R. Valdes. University of 

Louisville, Louisville, KY, 

Introduction: Circulating tumor cells (CTCs) are cells that detach from the primary 

tumor, intravasate into the bloodstream, invade distant tissues and produce metastatic 

lesions. In breast cancer patients, enumeration of CTCs in blood is used as an adjunct 

to assist in predicting overall survival and in clinical management. However, CTCs are 

phenotypically heterogeneous and the methods now available for counting these cells 

are based on detection of the epithelial marker, Epithelial Cell Adhesion Molecule 

(EpCAM). Present methods do not distinguish subtypes and only detect epithelialtype 

CTCs. This is significant because CTCs are known to experience epithelial to 

mesenchymal transition (EMT), a process that results in increased motility and is 

associated with diease progression. Following EMT, a CTC may no longer express 

epithelial markers such as EpCAM and evade detection by current methods. 

Objective: To establish a model using heterogeneous breast cancer cell lines and a 

method for capturing and characterizing distinct CTC subsets. This method should 

have high separation efficiency of subtypes, high recovery in spiked blood samples, 

and be capable of distinguishing heterogeneous subtypes independent of EMT status. 

Materials: We have established a breast cancer cell line panel including all 4 of the 

breast cancer molecular subtypes including luminal, HER2, basal-like, and claudinlow. 

This model of 4 breast cancer cell lines was used to represent the heterogeneity 

in CTCs from a breast cancer patient and the plasticity in the EMT process. We have 

chosen to include 1 breast cancer cell line that does not express EpCAM (MDA- 

MB-231). The cell lines and their molecular subtypes include MCF-7 (luminal A), 

SK-Br-3 (HER2), MDA-MB-231 (claudin-low) and HCC1954 (basal-like) and 

each represents an identifiable subtype. 25,000 or 2,500 cells of each cell line were 

combined and then identified using a combination of antibodies including HER2, 

EpCAM, and CD44. Experiments to determine separation efficiency and percent 

recovery were performed on the BD Accuri C6 flow cytometer. Results: The 

specificity (separation efficiency) for each subtype was determined to be 67.3% ± 7.1 

(±SE) (HCC1954), 91.7% ± 9.7 (MCF-7), 57.3% ± 8.7 (MDA-MB-231), and 100% 

± 19.0 (MCF-7). The overall separation efficiency was determined to be 79.4 ± 5.9% 

(± SE). Spiking experiments of a single mesenchymal cell line that does not express 

EpCAM were conducted in whole human blood, and a sensitivity (percent recovery) 

of 84.9 ± 14.6% (±SE) was achieved. 

Conclusion: High percent recovery of a spiked mesenchymal breast cancer cell 

line into whole blood was achieved. This method isn’t limited to cells that express 

EpCAM so CTCs that have undergone EMT are able to be detected. The combination 

of antibodies has high separation efficiency with 2 of the 4 cell lines. Enrichment 

processes and antibody selection are being optimized to improve specificity of all 4 

subtypes. This data indicates that phenotypically diverse CTCs are capable of being 

subtyped and characterized. Subtype characterization will allow therapies to be 

individually tailored to address each patient’s own CTCs. 

Support: P30ES014443 and T32ES011564 

A-09 

SAP155-mediated c-myc suppressor FBP-interacting repressor splicing 

variants as colon cancer screening biomarkers 

K. Matsushita, S. Itoga, F. Nomura. Chiba University Graduate School of 

Medicine, Chiba, Japan 

Background: The c-myc transcriptional suppressor, FUSE-binding protein (FBP)- 

interacting repressor (FIR), is alternatively spliced in colorectal cancer tissue. 

Recently, the knockdown of SAP155 pre-mRNA-splicing factor, a subunit of SF3b, 

was reported to disturb FIR pre-mRNA splicing and yielded FIRΔexon2, an exon2- 

spliced variant of FIR, which lacks c-myc repression activity. 

Methods: The expression levels of FIR variant mRNAs were examined in the 

peripheral blood of colorectal cancer patients and healthy volunteers to assess its 

potency for tumor detection. As expected, circulating FIR variant mRNAs in the 

PB of cancer patients were significantly overexpressed compared to that in healthy 

volunteers. 

Results: In this study, novel splicing variants of FIRs, Δ3 and Δ4, were also 

generated by SAP155 siRNA and those variants were also found to be activated in 

human colorectal cancer tissue. In particular, the area under the receiving operating 

characteristic curve of FIRs FIRΔexon2 or FIRΔexon2/FIR was greater than those of 

conventional carcinoembryonic antigen (CEA) or carbohydrate antigen 19-9 (CA19- 

9). In addition, FIRΔexon2 or FIR mRNA expression in the peripheral blood was 

significantly reduced after operative removal of colorectal tumors. 

Conclusion: Circulating FIR and FIRΔexon2 mRNAs are potential novel screening 

markers for colorectal cancer testing with conventional CEA and CA19-9. Our results 

indicate that overexpression of FIR and its splicing variants in colorectal cancer 

directs feed-forward or addicted circuit c-myc transcriptional activation. Clinical 

implications for colorectal cancers of novel FIR splicing variants are also discussed. 

CLINICAL CHEMISTRY, Vol. 59, No. 10, Supplement, 2013 

A3



A-10 

CA19.9 profile in samples predating pancreatic cancer diagnosis - 

nested case control study in the UK Collaborative Trial of Ovarian 

Cancer Screening (UKCTOCS). 

W. Alderton 1 , S. Apostolidou 2 , M. Fisher 1 , A. Flynn 3 , A. Gentry- Maharaj 2 , 

C. Hodkinson 1 , I. Jacobs 4 , U. Menon 2 , A. Ryan 2 , N. Sandanayake 2 , J. 

Timms 2 , J. Barnes 1 . 1 Abcodia Ltd, London, United Kingdom, 2 University 

College London, London, United Kingdom, 3 Exploristics Ltd, London, 

United Kingdom, 4 University of Manchester, Manchester, United Kingdom 

Background: Pancreatic cancer is the fifth most common cause of cancer death 

and has a 5-year survival rate of only 3%. It often has a very poor prognosis since 

it is commonly not diagnosed until it is at an advanced stage and the cancer has 

metastasized. CA19.9 is the most widely used biomarker as an aid to the clinical 

diagnosis of pancreatic cancer. There are currently no screening methods for the 

early detection of pancreatic cancer. We explore CA19.9 levels prior to diagnosis 

of pancreatic ductal adenocarcinoma in a nested case control study set within 

UKCTOCS (1). The trial cohort of >202,000 apparently healthy postmenopausal 

women donated a single serum at recruitment. 50,000 women continued to donate 

serum samples annually. Samples were stored at -180oC. Cancer registry and postal 

follow up ensured that all women diagnosed with cancer following trial recruitment 

were identified. 

Methods: UKCTOCS volunteers provided detailed lifestyle and health data on entry 

and mid-way through the trial and further data on their cancer diagnosis was obtained 

from their treating clinician. Cancer registration data was provided by the UK NHS 

Information Centre. Serum CA19.9 concentrations were determined in duplicate 

by electrochemiluminescence immunoassay on a Roche Elecsys 2010 system. A 

Student’s t-test was used to assess the significance of assay results comparing cases 

and controls (p



as identified by MARS. The importance of glycerol and ethanolamine in the HCC 

MARS metabolite panel points to a potential cancer-related variation in fatty acid 

metabolism. 

released using the on-membrane deglycosylation method and labeled and analyzed by 

fluorophore-assisted carbohydrate electrophoresis using a capillary electrophoresisbased 

ABI3130 sequencer. 

A-13 

Complete mitochondrial genome sequencing reveals association with 

acute myeloid leukemia 

J. Zhou, W. Wang, Y. Ye, X. Lu, B. Ying, L. Wang. West China Hospital, 

Sichuan University, Chengdu, China 

Background: To explore mitochondrial DNA variations in acute myeloid leukemia 

(AML) patients. 

Methods: Blood or bone marrow samples of 47 AML patients (20 M1 and 27 M2) 

who met with WHO diagnostic criteria and 40 age- and sex-matched healthy controls 

were collected. The whole mitochondrial genome was directly sequenced in 24 

overlapping fragments, then spliced by DNAstar software, and eventually compared 

with Cambridge reference sequence (CRS) using CodonCode Aligner software. 

Results: A total of 639 variations were found, twenty eight of which have not been 

reported at www.mitomap.org and mtDB (www.genpat.uu.se/mtDB/). 224 variations 

were found only in patients, two of which were statistical significant, they were 

T14200C (6/47, P=0.029) in ND6 region and C14929A (14/47, P=0.000) in CYTB 

region. We then compared the frequencies of the rest variations between case and 

control groups, C6455T in COI region and T16297C in D-loop region were found 

to be associated with the risk of AML. People carrying C6455T mutation had a 5.8- 

fold risk of developing AML (95%CI: 1.203-28.0, P=0.016), and people carrying 

T16297C mutation had a 4.5-fold risk (95%CI: 0.911-22.21, P=0.048). Furthermore, 

we analyzed the relationship between the above four variations and clinical features, 

and found that C6455T, T16297C and C14929A occurred more frequently in M1 

patients than in M2 patients, and patients with these variations had higher percentage 

of myeloblasts in the bone marrow and higher percentage of abnormal cells in blood, 

While T14200C showed the opposite results. 

Conclusion: C6455T, T16297C, C14929A and T14200C might be used as potential 

biomarkers for M1/M2 patients. Further studies are needed to verify these findings in 

another large population, and the roles of the variations play in the pathogenesis of 

AML remains to be explored. 

Table 1 Characteristics of the four positive-association variations from screening the 

whole mitochondrial genome 

Position Base Case Control P- 

change N % N % 

OR(95%CI) Region Codon Amino Change 

value 

6455 C-T 11(4) # 23.40% 2 5.00% 0.016 5.806(1.203-28.0) COI 184 Phe-> Phe 

14200 T-C 6(5) # 12.77% 0 0.00% 0.029 / ND6 158 Trp -> Trp 

14929 C-A 14(14) # 29.79% 0 0.00% 0.000 / CYTB 61 Thr -> Thr 

16297 T-C 9(2) # 19.15% 2 5.00% 0.048 4.5(0.911-22.21) D-loop 

# 

The number inside the parentheses presented the frequencies of heterozygote 

A-14 

Prostate proteins glycosylation profile and its potential as a diagnostic 

biomarker for prostate cancer 

T. Vermassen 1 , N. Lumen 2 , C. Van Praet 2 , D. Vanderschaeghe 3 , N. 

Callewaert 3 , P. Hoebeke 2 , S. Van Belle 1 , S. Rottey 1 , J. R. Delanghe 4 . 

1 

Department of Medical Oncology, University Hospital Ghent, Ghent, 

Belgium, 2 Department of Urology, University Hospital Ghent, Ghent, 

Belgium, 3 VIB Department of Molecular Biomedical Research - Ghent 

University, Ghent, Belgium, 4 Department of Clinical Chemistry, University 

Hospital Ghent, Ghent, Belgium 

Introduction: Serum Prostate Specific Antigen (sPSA) is widely used for screening 

and early diagnosis of prostate cancer (PCa). This analysis is associated with 

considerable sensitivity and specificity problems especially in the diagnostic gray 

zone (sPSA between 4 and 10ng/ml). In urine, PSA is only detected in its free form 

with concentrations largely exceeding the values observed in serum or plasma. 

Because of aberrant glycosylation changes in tumorogenesis, we explored the use of 

prostate proteins and its glycosylation profile as a new biomarker for PCa. 

Materials and Methods: We determined standard biochemical markers (total 

urinary protein, albumin in urine, gamma-GT in urine, urinary total PSA, urinary 

free PSA and sPSA) in healthy volunteers (HV; n = 16), patients with BPH (n = 

39), PCa patients (n = 29) and prostatitis (n = 14). Urinary protein N-glycans were 

Results: None of these markers was able to discriminate BPH from prostate 

cancer, except for sPSA. N-glycan profile analyses have pointed out differences in 

the N-glycosylation patterns between BPH and PCa. The changes were associated 

with a decreased fucosylation of bi- and triantennary structures. This isolated test 

was not statistically better than sPSA measurement (AUC after ROC curve analysis: 

0.805 ± 0.056 and 0.737 ± 0.063 for sPSA screening and the glycosylation marker 

respectively). Logistic regression showed that the glycosylation marker gives an 

added value to sPSA screening: combining these assays resulted in an AUC of 0.854 

± 0.049 for all patients. 

Conclusion: We have found a statistical significant difference in the urinary 

glycosylation patterns of patients with BPH versus PCa patients. These changes in 

N-glycosylation could lead to the discovery of a new biomarker for PCa, particularly 

in the diagnostic gray zone. 

A-15 

Fast Method for Classification Based on Coherent High Resolution 

XUV Scatter Images of Biologic Specimen 

M. Zürch 1 , S. Foertsch 2 , M. Matzas 2 , K. Pachmann 3 , R. Kuth 2 , C. 

Spielmann 1 . 1 Friedrich-Schiller-University Jena, Jena, Germany, 2 Siemens 

AG, Healthcare Sector, Erlangen, Germany, 3 University Hospital Jena, 

Jena, Germany 

Background: In cancer research and diagnostics the cell classification is currently 

done by classical PCR analysis. This procedure is time consuming and results will 

be often available only within a few days. For several reasons the need for faster 

and probably cheaper methods is obvious. Current research for realizing a faster 

discrimination concentrates on spectroscopic methods, e.g. Raman spectroscopy. In 

this contribution we will present a method relying on high resolution imaging based 

on coherent diffraction imaging of biological samples such as a single cell illuminated 

with coherent short wavelength light. 

Methods: Our experimental apparatus is based on a commercial ultra-short infrared 

laser system. With nonlinear methods we convert the visible light into laser-like 

light extreme ultraviolet (XUV) radiation in the range from 20 to 70 nanometers, 

whilst preserving the high spatial and temporal coherence. This XUV light source is 

used to illuminate different biologic specimen. In our recent experiments we choose 

four different single cells from the MCF7 and SKBR3 breast-cancer-cell-line cells, 

pipetted on a gold-coated fused silica slide. The cells were prepared in a PBS puffer, 

which remained on the sample holder after drying. It is worth to mention that no 

additional markers or staining is required. The recorded images of scattered XUV 

light from the samples contain the full spatial information (“2D fingerprint”) down to 

a feature size of roughly half of the XUV wavelength. From these recorded diffraction 

patterns it is possible to reconstruct the real space image of the sample with the help of 

well-established coherent diffraction imaging algorithms. However, these algorithms 

are slow, limiting the throughput of the system. Since only classification is of interest 


A5



and not the actual image of the object, we studied and compared the scattering images 

of the mentioned cells directly and developed mathematical methods to identify the 

specimen. As a powerful and rather fast method, we opted for calculating the 2D 

cross-correlation of the scattering images. 

Results: As not entirely expected, the calculated peak values of the 2D crosscorrelations 

of the four recorded scatter images already allow the identification of the 

different cell types. This is even more surprising, because the method is insensitive 

to the actual orientation of the cells on the substrate. 2D cross-correlation is only able 

to distinguish between shifts of the same image and not for rotation. Nevertheless we 

will work on the implementation of more sophisticated image comparison techniques, 

known from fingerprint or face detection, allowing a more reliable identification of 

different cells. 

Conclusion: We have demonstrated a fast method for comparing scatter images from 

biologic specimens. We have been able to identify the cell types without extensive 

preparation methods such as staining. For further exploration of this method, we will 

implement more sophisticated image comparison techniques for classifying a wider 

variety of cells. It is also worth to mention the method is not limited to cells, but could 

also be applied to e.g. bacteria or viruses. 

A-16 

Correlation between circulating tumor cells (CTC) counts and serum 

breast cancer tumor markers CA 27.29 and CEA levels and their value 

in time to progression (TTP) prediction in the metastatic breast cancer 

(MBC) patients under therapy. 

D. M. Iancu, J. Becker, A. Hutson, C. Stone, B. Lynch, J. Citron, N. 

Watroba. Roswell Park Cancer Institute, Buffalo, NY 

Metastatic breast cancer (MBC) is the main cause of death from breast cancer. 

Treatment is palliative, but newer therapies have improved survival. Current 

evaluation methods remain inadequate for assessment of prognosis. 

CTC detection in blood by CellSearch® technology (Veridex, Raritan NJ, USA) is 

reported to be a prognostic and predictive marker in MBC. The presence of ≥ 5 CTCs 

in 7.5mL of blood in women with MBC is associated with shorter progression free 

survival (PFS). Serum tumor markers CA 27.29 and CEA are used for monitoring 

therapy in MBC. Few studies have looked at the correlation of CTC and tumor 

markers in MBC. This study is an IRB approved existing data review evaluating 

the correlation between CTC, CA 27.29 and CEA and how they predict time to 

progression when used separately or together. Additionally, it was asked whether 

values higher than 5 CTC would increase risk of progression of MBC. Data from 

Jan.2011 to Nov 31, 2012 was collected for patients with MBC when CTC, CA 27.29 

and CEA were performed. 84 CTC events were identified (N=17 range 1-13, median 

5). The estimated median time to progression was 84 days. Time to progression was 

assessed based on imaging progression indicated in clinical notes. Serum levels of CA 

27.29 and CEA are measures using automated chemiluminescent immunoassays on 

the Advia Centaur instrument (Bayer Diagnostics, East Walpole, MA). The Spearman 

rank correlation between baseline CTC and CA 27.29 was r = 0.30 (low). The rank 

correlation between baseline CTC and CEA was 0.23 (weak) and the rank correlation 

between baseline CA 27.29 and CEA was 0.53 (moderate). 

The association between CTC, CA 27.29, CEA values and change in the risk of disease 

progression was evaluated over time via a Cox regression model allowing for timevarying 

covariates in both univariate and multivariate models. For CTC the cut-off of 

5 (



were analysed by Freelite assay (The Binding Site Group Ltd, UK; FLC ratio normal 

range 0.26-1.65) and N Latex assay (Siemens, Germany; FLC ratio normal range 

0.31-1.56). The sensitivity and specificity of both assays were compared. 

Results: Freelite and N Latex provided concordant information in 344/390 (88%) 

patients. 308/344 (89%) patients had normal FLC ratios by both assays (Freelite: 

median 0.7, range 0.26-1.57; N Latex: median 0.58, range 0.33-1.49). The remaining 

36/344 (10%) patients had abnormal FLC ratios by both assays (Freelite: κFLC 

median 8.23, range 1.7-1531; λFLC median 0.01, range 0.0001-0.24; N Latex: κFLC 

median 3.88, range 1.84-191; λFLC median 0.01, range 0.0002-0.20). The clinical 

diagnoses of the 36 patients with abnormal FLC ratio by both assays were: 6 MM, 5 

LCMM, 1 cryoglobulinemia, 4 lymphoma, 1 plasmacytoma and 19 MGUS patients. 

Freelite was abnormal and N Latex was normal in 19 patients with haematological 

disorders (Freelite: κFLC median ratio 2.31, range 1.66-4.82; λFLC median 0.17, 

range 0.03-0.25; N Latex: median 1.09, range 0.35-1.55). 14/19 of these patients were 

positive by SPEP (3 MM, 1 WM, 2 lymphoma, and 8 MGUS) and the remaining 5/19 

patients were negative by both SPEP and N Latex (1 patient subsequently diagnosed 

with WM, 4 MGUS). In contrast, N Latex identified 4 MGUS patients with positive 

SPEP and normal Freelite ratio (Freelite: median 0.75, range 0.65-0.95; N Latex: 

κFLC 1.88, λFLC median 0.15, range 0.12-0.28). Freelite was more sensitive and 

specific in identifying patients with hematological disorders and had a better positive 

(PPV) and negative (NPV) predictive value compared to N Latex (sensitivity 54% 

(95% CI 44-64%) v. 39% (CI 30-49%), specificity 98% (CI 95-99%) v. 94% (CI 91- 

96%), PPV 89% (CI 78-95%) v. 70% (CI 56-81%), NPV 86% (CI 81-89%) v 81% (CI 

77-85%); respectively). 

Discussion: In this study the Freelite assays had a greater sensitivity and specificity 

to identify patients with hematological disorders. Furthermore, this data continues to 

support the requirement for further clinical evaluation of the N Latex test before it is 

used in routine practice and current guidelines for serum FLC measurement using N 

latex are not applicable at this time. 

A-20 

Development of automatic antigen excess detection parameters for 

immunoglobulin free light chain (Freelite®) assays on the Roche 

cobas® c501 

M. D. Coley, H. D. Carr-Smith, D. J. Matters, S. J. Harding, P. J. Showell. 

The Binding Site Ltd, Birmingham, United Kingdom 

International guidelines, based upon the Freelite® serum free light chain (FLC) 

assay recommends its use to aid in the diagnosis of patients with B cell disorders 

and to monitor patients with AL amyloidosis, non-secretory and light chain multiple 

myeloma. Immunoglobulin light chains are highly variable with over 480 different 

genetic combinations for lambda possible prior to antigen exposure. This inherent 

variability means there is possibility of antigen excess even in multi-epitope 

recognising polyclonal antibody based assays. Here we describe the development of 

automatic antigen excess protection for the Freelite assay (The Binding Site group 

Ltd) on the Roche cobas® c501. Reaction kinetics of monoclonal patient sera prone to 

antigen excess (5 kappa, mean c501 result 5,345.12mg/L, range 502.62-12,672.00mg/ 

L, and 4 lambda, mean c501 result 4,046.5mg/L, range 1,590.00-6,213.00mg/L) and 

4 normal blood donor sera (mean kappa 10.51mg/L, range 9.14-13.18mg/L; mean 

lambda 11.41mg/L, range 10.90-12.14; mean ratio 0.93, range 0.79-1.21) were 

analysed to set threshold limits. Samples in antigen excess were typified by a high 

initial rate of reaction, which rapidly slowed as the detecting antibody became saturated 

(early delta OD 125.5, late delta OD 14.0). This is compared to non-antigen excess 

samples which showed a slower, more sustained rate of reaction throughout the assay 

time (early delta OD 28.0, late delta OD 38.7). Antigen excess capacity was validated 

using 67 normal blood donor serum, 68 kappa monoclonal and 33 lambda monoclonal 

patient sera which had been collected over a number of years and had previously been 

reported as having antigen excess on other analysers or assays. All samples tested 

(68/68 kappa, median 265.03mg/L, range 20.06-40,930.00mg/L, and 33/33 lambda, 

median 762.00mg/L, range 7.68-56,949.00mg/L) were correctly measured using these 

parameters. We conclude that implementation of these parameters will improve assay 

throughput and will prevent monoclonal patient samples from being mis-reported. 

A-21 

Validation of an automated immunoassay for the quantitative 

measurement of hemoglobin in stool 

J. Lu 1 , S. Clinton 2 , D. G. Grenache 2 . 1 ARUP Laboratories, Salt Lake City, 

UT, 2 University of Utah, Salt Lake City, UT 

Background: Fecal occult blood (FOB) has clinical utility as a colorectal cancer 

(CRC) screening test and has been shown to significantly reduce CRC mortality. 

Immunochemical detection of FOB (iFOB) is considered to be superior to guaiac 

tests, the latter of which are prone to false-positive results. iFOB requires no patient 

preparation or dietary restrictions before collection and is specific for human 

hemoglobin A (HbA). 

Objective: To validate the OC-Auto Micro 80 (Polymedco Inc. Cortlandt Manor, NY) 

immunoassay for the detection and measurement of HbA in stool. 

Methods: In accordance with manufacturer instructions, residual patient stool samples 

were extracted with a stabilizing buffer and the sample added to latex particles coated 

with anti-human HbA antibodies. Any HbA present in the sample binds to the beads 

resulting in an agglutination reaction and the change in optical density is directly 

proportional the HbA concentration. Analytical characteristics including linearity, 

precision, analytical sensitivity, analyte stability, and accuracy were determined. 

Results: Linearity was determined by adding diluted, lysed whole blood (HbA 16- 

909 ng/mL) to a set of five HbA-negative stool samples and testing each sample in 3 

replicates. Linear regression analysis produced a slope of 0.911 and a y-intercept of 

-3.84. Precision was assessed by adding diluted, lysed whole blood to HbA-negative 

stool samples to prepare a set of 3 samples with different HbA concentrations. Each 

sample was tested in 3 replicates once per day for 10 days. Within-laboratory CVs 

were 14.1, 13.5 and 25.4% at HbA concentrations of 549.1, 93.9 and 33.6 ng/mL, 

respectively. The limit of blank was determined to be 1.0 ng/mL by measuring sample 

buffer in 10 replicates. Stability of stool samples in stabilizing buffer was evaluated 

by determining HbA in two sample pools with mean HbA concentrations of 559 and 

98 ng/ml at time 0, stored at ambient temperature and at 4 °C for 14 and 29 days, 

respectively, and then tested in two replicates. In both pools, the change in HbA 

concentration was within 15% compared to time 0. 20 samples were tested for iFOB 

and by guaiac testing. 90% (9/10) of guaiac-negative samples had no detectable HbA 

by iFOB and 10% (1/10) had an HbA concentration of 517 ng/mL. 100% (10/10) 

of guaiac-positive samples had HbA detected by iFOB (range, 420-2,078 ng/mL). 

Recovery was evaluated by adding diluted, lysed whole blood to HbA-negative stool 

samples and the recoveries were 93 and 94% at the mean HbA concentrations of 465 

(n=4) and 94 (n=4) ng/mL. 

Conclusion: We have validated an automated immunoassay for the measurement of 

fecal occult blood that provides high accuracy and specificity for HbA and does not 

require special dietary restrictions prior to sample collection. 

A-22 

Comparison of the analytical performance of polyclonal and 

monoclonal antibody based FLC assays in refractory multiple 

myeloma patients 

S. J. Harding 1 , R. Popat 2 , O. Berlanga 1 , H. Sharrod 1 , J. Cavenagh 2 , H. 

Oakervee 2 . 1 The Binding Site Ltd, Birmingham, United Kingdom, 2 St 

Bartholomew’s Hospital, London, United Kingdom 

Background: Current international guidelines for the identification of B cell disorders 

recommend a screening algorithm of serum protein electrophoresis and serum free 

light chain (FLC) testing based upon the polyclonal, multi-epitope Freelite® assay. 

A new monoclonal antibody (single epitope) based assay, N Latex FLC (Siemens, 

Germany) has been developed for measuring serum FLC levels. Here, we compare the 

analytical performance of the two assays in a population of MM patients. 

Methods: Baseline sera from 91 refractory MM patients (26 IgGκ, 14 IgGλ, 5 IgAκ, 4 

IgAλ, 3 biclonal, 2 LC only; 13 IFE negative; 24 IFE not available; 52 males; median 

age 62 years (30-85)) were analysed for FLC levels by Freelite and N Latex FLC on 

the BN TM II nephelometer (Siemens, Germany). Reported values were compared using 

Passing-Bablok (PB) and linear regression (R 2 ) using Analyze-It software; an R 2 ≥0.95 

was considered to be identical analyte measurement in keeping with CLSI guidelines. 

FLC ratio normal range by Freelite: 0.26-1.65; by N Latex FLC: 0.31-1.56. 

Results: In 21 patients with normal kappa/lambda FLC ratios by both assays showed 

moderate correlation for kappa FLC (PB: 3.18+0.65x; R 2 =0.92), with poor correlation 

for lambda FLC (PB: 0.20+1.04x; R 2 =0.47). Similarly, in 47 patients with an abnormal 


A7



kappa ratio by at least one assay showed moderate correlation (PB: -5.09+0.38x; 

R 2 =0.79), and in 23 patients with an abnormal lambda ratio by at least one assay 

there was poor correlation (PB: 30.23+0.16x; R 2 =0.20). There were discordant FLC 

ratio results in 8(9%) patients. In 7/8 patients (4 FLC kappa patients identified by 

Freelite and 3 lambda patients identified by N Latex FLC) with discordant results the 

kappa/lambda ratios were borderline, with slight monoclonal production and therefore 

of little concern. However, 1 IFE positive patient had 578mg/L kappa FLC and an 

abnormal kappa / lambda ratio (38.8) by Freelite and only 18mg/L with a normal 

kappa / lambda ratio (1.39) by N Latex FLC. Antigen excess (AgXS) was observed in 

3(3%) kappa samples by Freelite and 7(4 kappa, 3 lambda; 8%) samples by N Latex 

FLC. The median FLC values of the 3 samples in AgXS by Freelite at standard and 

1/2000 dilutions were 36.9(25.7-73.7) and 412.5(191-761.1) mg/L, respectively. The 

median FLC values of the 4 kappa samples in AgXS by N Latex FLC at standard and 

1/2000 dilutions were 19.1(12.2-40.5) and 143.2(83.6-184.4) mg/L, respectively. The 

median FLC values of the 3 lambda samples in AgXS by N Latex FLC at standard and 

1/2000 dilutions were 108.6(58.4-113.3) and 541.1(538.1-841.1) mg/L, respectively. 

Conclusion: Freelite and N Latex FLC assays do not report similar quantitative 

results and did not meet CLSI guidelines for the same analyte recognition. In addition, 

the N Latex FLC assay did not identify an IgGκ patient who was detected by the 

Freelite assay. Both assays exhibit non-linearity and antigen excess, highlighting the 

need for multiple dilutions when analysing a new patient. 

A-26 

OVA1 ® Specificity in Assessing Risk for Ovarian Malignancy Improved 

with IL-6 

K. Sisco, P. P. Chou. Quest Diagnostics Nichols Institute, Chantilly, VA 

Background: OAV1 (a trademark of Vermillion) is an FDA cleared IVDMIA used 

in the preoperative assessment for potential malignancy of patients presenting with 

an ovarian mass. It consists of five different analytes (beta-2 microglobulin, CA-125 

II, apolipoprotein A1, transthyretin and transferrin) which are combined to provide a 

score. This score has high sensitivity but low specificity for predicting the presence 

of malignancy. Adding Interleukin-6 (IL-6) to this score is shown to preserve the high 

sensitivity and increase the specificity. 

Methods: Thirteen patients who had undergone OVA1 assessment were also 

evaluated for IL6. Retrospective follow-up inquiries were made several months later 

to ascertain the final diagnoses. Furthermore, five pooled specimens from 126 patients 

with benign disease or malignancy were analyzed using OVA1 and IL6. 

Results: In this combined population, the sensitivity of OVA1 alone was 100%, with 

a specificity of 93%. IL6 alone had a sensitivity of 97% and a specificity of 99%. We 

propose an algorithm whereby an OVA1 score of 8.1 or more is assigned a “high risk 

of malignancy” without further testing. OVA1 scores above the respective cutoffs for 

premenopausal (5.0) and postmenopausal women (4.4) will reflex to IL6; those with 

elevated IL6 levels are then regarded as having a “high risk of malignancy.” Applied 

to this study, this new algorithm yields a sensitivity of 100% and a specificity of 98%. 

Conclusion: Combining OVA1 with IL6 improves specificity without compromising 

sensitivity. A high risk assessment would then result in the patient being referred to a 

gynecologic oncologist for further evaluation. 

Table 1. OVA1 and IL6 Results for Pooled Specimens and Individual Patients 

Patients Age OVA1 IL6 Diagnosis 

Pooled #1 2.3 2.7 Benign (19 patients) 




Pooled #5 5.3↑ 9.9↑ Malignant (30 patients) 

PatientA 46 9.7↑ 1,042.0↑ Malignant (Ovarian Malignancy, positive nodes) 

PatientB 26 8.0↑ a 1.8 Benign (Endometrioma of the ovary) 

PatientC 58 6.9↑ 40.7↑ Malignant (Ovarian cancer and renal cancer) 

PatientD 57 6.3↑ a 5.0 Benign (Hydrosalpinx) 

PatientE 90 8.2↑ 3.4 a Malignant (Metastatic esophageal adenocarcinoma) 

PatientF 75 8.2↑ a 5.0 Benign (Cystadenoma of the ovary) 

PatientG 46 3.5 2.0 Benign (Benign hemorrhagic ovarian cyst) 

PatientH 82 7.4↑ 8.7↑ Malignant (Anaplastic carcinoma) 

PatientI 67 9.1↑ 31.4↑ Malignant (Carcinomatosis) 

PatientJ 76 6.6↑ a 2.8 

Benign (No adnexal mass; benign endometrial 

biopsy) 

PatientK 46 5.1↑ a 0.9 Benign (Benign ovarian cyst) 

PatientL 56 7.9↑ 7.9↑ Benign (No ovarian mass; adenomyosis) 

PatientM 56 6.3↑ a 2.3 Benign (Clinically benign; lost to followup) 

Sensitivity 100% 97% 

Specificity 93% 99% 

OVA1 scores ≥5.0 (premenopausal) and ≥4.4 (postmenopausal) are associated with an 

increased risk of malignancy. The IL6 reference range is 0.31-5.00 pg/mL. Abnormally 

high results are indicated by an arrow. 

a 

Indicates discordance between OVA1 and/or IL6 results and the fi nal diagnosis. 

A-27 

A New Biomarker Panel To Predict Hepatocellular Carcinoma In 

Chronic Hepatitis C infected (HCV) Patients 

G. M. Mustafa 1 , j. R. petersen 1 , H. Ju 1 , L. Cicalese 1 , N. Synder 2 , S. J. 

Haidacher 1 , L. Denner 1 , C. Elferink 1 . 1 University of Texas Medical Branch 

,Galveston, Galveston, TX, 2 Kelsey Seybold clinic, Houston, TX 

Background: hepatocellular carcinoma (HCC) is the most common primary liver 

cancer, ranking 6 th among cancers as a cause of death. The projected rise in HCC 

cases in the US is mainly due to HCV infections with onset of HCC coming several 

decades after initial infection. The poor prognosis is due late stage diagnosis making 

successful intervention difficult. Although AFP is used for screening, it is often normal 

or indeterminate in early cancer cases. The goal of clinical proteomics has been to 

find an indicator (biomarker) to allow detection at an early stage when therapeutic 

intervention may be possible. Thus, our aim is to identify serum based biomarkers 

suitable for early HCC detection that will provide a sensitive yet specific screen. 

Methods: Serum was obtained from individuals positive for HCV who were clinically 

diagnosed with liver disease (pre-HCC) or HCC. All patients were free of co-infection 

with HIV/HBV and had a history of low alcohol consumption negating potential 

confounding risk factors. For serum fractionation we used aptamer based technology 

(Bio-Rad) which reduces the dynamic range while retaining the complexity of the 

serum peptidome without losing any important information. The fractionated serum 

was resolved using 2D-DIGE (12 HCV and 12 HCC) and the fluorescent signatures 

captured using GE Typhoon Trio Imager. HCV and HCC profiles were compared 

using DeCyder and statistically significant signature peptides selected for further 

analysis. O 18 /O 16 labeling was used to verify the identity of proteins co-migrating on 

2D-DIGE and to help in development of Selected Reaction Monitoring assays (SRM). 

50 human serum samples (24HCV and 26 HCC) were used to quantify the candidate 

biomarker using labeled internal standards (AQUA peptides). 

Results: HCV and HCC samples labeled with cy3 and cy5 were combined with a 

cy2 labeled internal standard and separated on 2D-gels revealing 24 differentially 

expressed protein spots that were statistically different (p30%. This was further verified and validated on 

24 HCV and 26 HCC samples by western blotting. 

Conclusion: Using SRM assays we are in the process of verifying the other biomarkers 

in our list. Once verified we plan to perform a larger validation study using samples 

archived with NCI early detection research network (EDRN) specifically designed for 

such validation studies. 

A-28 

High-Risk Human Papillomavirus 18 in Two Nasopharyngeal 

Carcinoma Cell Lines 

S. B. Zhang 1 , T. Hollen 1 , W. Lv 2 , J. Hong 2 , K. Raisch 1 , Y. Li 1 , A. Zhang 3 , M. 

Zhang 1 , L. Huang 1 , A. Zhang 1 , S. Yang 1 , Z. Zhang 1 , L. Zhang 1 , P. Okunieff 1 . 

1 

University of Florida, Gainesville, FL, 2 Fujian Medical University, 

Fuzhou, China, 3 DiaCarta, Inc., Hayward, CA 

Background: Nasopharyngeal carcinoma (NPC), a head and neck cancer that is most 

prevalent in Southeast Asia, the Middle East, and North Africa, is associated with 

Epstein-Barr viral infections (Xia, 2009). However, human papillomavirus (HPV), 

which is a major cause of oropharyngeal carcinoma, has also been implicated as an 

NPC etiologic agent. Two Epstein-Barr virus-negative NPC cell lines (CNE-1 and 

A8 CLINICAL CHEMISTRY, Vol. 59, No. 10, Supplement, 2013



CNE-2) have been widely studied over the past decade due to their different levels 

of radiosensitivity. CNE-1 cells have high differentiation with a radiosensitive 

phenotype, whereas CNE-2 cells have low differentiation with a radioresistant 

phenotype. 

Methods/Results: We found that CNE-1 and CNE-2 cells were infected with highrisk 

HPV 18. To our knowledge, no other report links CNE-1 and CNE-2 to HPV 

infection. Our studies showed that relative copy number in CNE-1 is lower than in 

CNE-2 (0.448 vs. 0.831, respectively). Their copy numbers were higher than those 

found in cervical cancer C-4 II cells infected with HPV 18 (0.199). Our studies 

detected 2 HPV oncogenes, E6 and E7 mRNA, in the CNE-1 and CNE-2 cell lines. 

Independent of cell lines, the E6 mRNA level was significantly higher than the E7 

mRNA level. The relative E6/E7 mRNA in CNE-1 was significantly higher than in 

CNE-2. Although no significant differences between E6 and E7 mRNA levels in CNE- 

1 and C-4 II were found, the E6 and E7 mRNA levels in CNE-2 were significantly 

lower than in C-4 II. Mitochondrial DNA plays a key role in intrinsic sensitivity to 

radiation. We found that the relative mtDNA copy number (mtDNA/nDNA ratio) in 

CNE-1 was significantly lower than in CNE-2 (1 vs. 2.92, respectively). A similar 

trend in mtDNA mutation (4,977-bp common deletion) was also found; the relative 

mitochondrial common deletion in CNE-1 was significantly lower than in CNE-2 (1 

vs. 4.25, respectively). These results were confirmed by real-time polymerase chain 

reaction (RT-PCR) and branched DNA methods (QuantiVirus® HPV Detection Kit, 

DiaCarta, Hayward, CA). 

Conclusion: HPV may be the etiologic factor in some Epstein-Barr virus-negative 

NPC cases. Further studies are warranted. Moreover, our studies also showed that 

mitochondrial DNA may be responsible for the difference in radiosensitivity between 

CNE-1 and CNE-2. 

A-29 

Molecular characterization of FLT3 mutations in Acute Myeloid 

Leukemia from Pakistan with different FAB subtypes 

M. Faiz, M. Ishfaq, T. Bashir, A. Shahid. Institute of Nuclear Medicine and 

Oncology, Lahore, Pakistan 

Introduction: FLT3 mutations are common genetic changes reported to have 

prognostic significance in acute myeloid leukemia (AML). Methods: Peripheral 

blood samples of 94 AML Pakistani patients were collected to determine FLT3 

internal tandem duplication (ITD) incidence by PCR in exons 14 and 15 of FLT3 

gene and D835 activating mutation in the tyrosine kinase domain (TKD) on isolated 

DNA stored at -20oC. Results: Among 94 AML patients, 60 were males and 34 

were females with male to female ratio 2:1. The age ranged between 15 to 78 years 

with a median age of 32 years. Among 81 patients whose FAB subtype was known, 

AML-M2 was the predominant subtype (37%) followed by M4 (23.5%), M3(15%), 

M1 (11%), M5 (11%), M6 (2.5%) . The incidence of FLT3/ITD and TKD was 22% 

and 6.3% respectively. Majority of the FLT3/ITD mutation was most common in 

AML-M4 (63%) patients while D835 mutation was found in FAB M1, M2. Presence 

of mutation was not related to gender or age. However, presence of FLT3/ITD was 

clearly associated with hyperleukocytosis. No significant relationship was found 

between clinical features and FLT3/ITD positivity. Conclusion: FLT3/ITD mutation 

was common genetic abnormality found in Pakistani AML patients and unfavorable 

prognostic marker that should be included in molecular diagnostic testing of AML. 

Moreover, effective therapy with FLT3 targeting agents may be considered to improve 

the prognosis in patients. 

A-30 

Restoration of miR-638 induces SPC-A1 cells apoptosis via down 

regulation of HGF 

S. Pan, Y. Cao, J. Xu, B. Zhang, J. Ma, E. Xie, D. Chen, L. Gao, Y. Zhang. 

The fi rst clinical medical college, Nanjing, China 

Background: Aberrant expression of miRNAs has been correlated with various 

human diseases including cancers, and this small non-coding RNA has been identified 

which have oncogenic or tumor suppressor properties Emerging evidence showed that 

miRNAs are important regulators in cancer cell proliferation, apoptosis, metastasis, 

chemosensitivity and so on. In the previous study, we produced a monoclonal 

antibody designed NJ001, which exhibited its anti-tumor activity both in vitro and in 

vivo by inducing apoptosis. This study was aimed to investigate the role of miRNAs 

in SPC-A1 cells undergoing apoptosis following treatment with NJ001 and find the 

pro-apoptosis miRNA in tumor cells for further study on cancer therapy. 

Methods: Affymetrix GeneChip® miRNA 2.0 Array was performed to acquire 

dynamic miRNA expression profile of SPC-A1 after treatment with NJ001. 

Quantitative real-time-PCR was carried out to validate the results of microarray 

approach. After that, we used Cluster Analysis of up-regulated expression in SPC-A1 

incubated with NJ001 to focus interesting miRNA. In the gain of function study, 

Images of CY-3 labeled miRNA mimics and qRT-PCR was used to confirm augmented 

expression. After successfully over-expression of miRNA, double staining with FITC- 

Annexin V and PI was carried out to evaluate the apoptosis rate. Members in apoptosis 

pathway were detected by western blot. We used five programs_miRanda, miRDB, 

miRWalk, RNA22 and Targetscan_to predicte targets of miR-638. The wild-type and 

mutation-type 3’-UTRs of these potential targets were cloned into the PGL4 plasmid 

and dual-luciferase assays was carried out after co-transfection miRNAs and reporter 

plasmids into SPC-A1 cells to evaluate the changes of luciferase activity. Changes 

of mRNA levels and protein levels of target genes were confirmed by qRT-PCR and 

western blot respectively. 

Results: After treatment with NJ001, The high percentage of Annexin V + cells in 

NJ001 groups was observed at 24 h, 48 h and 72h compared to cells in the control 

groups (44.3%, 74.0% and 81.4% vs. control respectively, P < 0.05 for all time points). 

The expression of miR-638 was the first to show a significant change and found to 

be dynamically increased accompanied with the climbing apoptosis rate according 

to the result of Cluster Analysis of microarray approach. In addition, we observed 

that miR-638 is significantly suppressed in SPC-A1 when compared with human 

embryonic lung fibroblast (HFL-1) and functional studies indicated over-expression 

of miR-638 positively regulated the apoptosis of SPC-A1 through both extrinsic and 

intrinsic pathway via activating caspase 8, caspase 9, caspase 3 and shifting the bax/ 

bcl-2 ratio. By transcriptomic analysis and computational algorithms, we identified 

the anti-apoptotic protein hepatocyte growth factor (HGF) as a target gene of miR- 

638. Dual-luciferase reporter assay confirmed that miR-638 negatively regulated HGF 

by interaction between miR-638 and complementary sequences in the 3’ UTR of HGF. 

MiR-638 repressed HGF at post-transcriptional levels as revealed by quantitative RT- 

PCR and Western blot analysis. 

Conclusion: In summary, our findings demonstrate that miR-638 has a critical role in 

regulating apoptosis of SPC-A1 cells, implying the function of miR-638 as a putative 

tumor suppressors miRNA and provide a basic rationale for the use of miR-638 in the 

treatment of NSCLC. 

A-31 

NJ001 antibody specific antigen is the key molecule for outcome 

evaluation of lung adenocarcinoma patients 

P. Huang, Y. Han, F. Wang, R. Yang, L. Zhang, T. Xu, Q. Li, H. Wang, S. 

Pan. The fi rst clinical medical college, Nanjing, China 

Objective: To evaluate the relationship between NJ001 specific antigen and 

clinicopathological features, so as to further explore its role in the prognosis of lung 

adenocarcinoma. 

Methods: The expression of NJ001 specific antigen was examined by means of the 

envision system immunohistochemical staining with monoclonal antibody NJ001 in 

110 lung adenocarcinoma and 46 benign lung disease, as well as a tissue microarray 

(TMA) containing 75 lung adenocarcinoma and the adjacent normal tissue. 

Immunohistochemistry results were reckoned by multiplication of the percentage and 

staining intensity of positive tumor cells. Then we evaluated the associations of the 

antigen expression with several clinicopathologic parameters. Overall survival rates 

were determined by using the Kaplan-Meier method with log-rank test for comparison 

among groups with different expression of the specific antigen. 

Results: We observed that NJ001 specific antigen was predominantly located on the 

cell membrane and in the cytoplasm of tumor cells. The positive rate was respectively 

84.70% in lung adenocarcinoma, 8.22% in the adjacent normal tissue and 8.70% in 

benign lung disease. The specific antigen expression in lung adenocarcinoma was 

significantly associated with the poor and moderate differentiation grade of the tumor 

(P= 0.017) and lymph node metastasis (P



A-33 

Significance of Angiopoietin-2 as a Serum Marker for Hepatocellular 

Carcinoma 

F. M. El Shanawani, M. M. Hasan. Theodor Bilharz Research Institute, 

Cairo, Egypt 

Background: and study aims: Hepatocellular carcinoma (HCC) is one of the most 

common malignancies worldwide and one of the major causes of death. The aim of 

this study was to investigate the potential role of Angiopoietin-2 as a non-invasive 

marker for HCC. Patients and Methods: This study was conducted on 30 patients 

with documented HCC and 30 cirrhotic patients with no evidence of HCC; as well 

as 30 healthy subjects who served as control group. The levels of alfa fetoprotein 

(AFP) and angiopoietin-2 (Ang-2) were measured for all cases together with full 

clinical assessment, liver biochemical profile, viral markers, ultrasound, abdominal 

triphasic computerized tomography (CT) scan and guided liver biopsy for HCC 

cases with atypical triphasic CT pattern. Results: There was a statistically highly 

significant elevation (p< 0.001) in the mean serum AFP in HCC group (155.5 ± 271.5 

ng/ml) when compared with the control group (6.3 ± 2.4 ng/ml) and also a highly 

significant elevation (p



A-36 

Comparison of polyclonal antibody assay for the quantification of 

serum free light chain (Freelite) with a new monoclonal antibody 

based test (N Latex FLC) 

J. García de Veas Silva, C. Bermudo Guitarte, M. Perna Rodríguez, C. 

González Rodríguez. Department of Clinical Biochemistry, Hospital 

Universitario Virgen Macarena, Sevilla, Spain 

Background: quantification of serum free light chains (FLCs) is used in the diagnosis, 

monitoring and prognosis in patients with monoclonal gammopathies. Freelite TM has 

become an essential assay in the diagnosis and monitoring of patients with monoclonal 

gammopathies and this assay has been accepted in international guidelines. Recently, 

immunoassays using monoclonal antibodies against FLCs have become commercially 

available. These new serum assays for automated measurements are commercially 

available but the technical performances of these assays are in discussion. 

Methods: the new N Latex FLC nephelometric assay (Siemens Healthcare 

Diagnostics) based on monoclonal antibodies was compared with the Freelite TM 

turbidimetric assay (The Binding Site) based on polyclonal antibodies in 94 patients 

with monoclonal gammopathies (34 intact immunoglobulin multiple myeloma, 6 

light chain multiple myeloma and 54 monoclonal gammopathies of undetermined 

significance). Spearman´s coefficient of correlation was used to study the correlation 

between the methods. The evaluation and concordance between the methods was 

studied using the Bland-Altman regression and the Passing & Bablok plot. A p value 



of the Cables 1 promoter. To evaluate the Cables 1 promoter regulation more closely 

we made firefly luciferase Cables 1 promoter reporter constructs and evaluated Cables 

1 promoter activity in several ovarian carcinomas derived cell lines and in a cell line 

derived from an ovarian metastasis of colorectal cancer. 

Methods: Different length fragments of the 5’flanking region of Cables 1 gene 

through the translation initiation ATG codon were PCR-amplified from human 

genomic DNA. These Cables 1 promoter regions were cloned into a luciferase reporter 

vector. Ovarian carcinoma derived cell lines JHOS-2 and OVK18, and HSKTC, a 

cell line derived from ovarian metastasis of colorectal cancer, were obtained from 

the Riken BRC cell bank with MTA. Cells were co-transfected with firefly luciferase 

reporter and renilla luciferase control reporter vector, then stimulated by Estradiol 

(E2), Progesterone (P4), Phorbol12-Myristate13-acetate (PMA), cyclic AMP (cAMP) 

or Forskolin for 48hours. Luciferase assays were performed using the dual-luciferase 

reporter assay system. 

Results: Cables 1 promoter activity was detected in all cell lines using a construct 

that included 2000 bp upstream of ATG codon. There was no significant promoter 

activity stimulation by E2, P4 and PMA in any of three cell lines. JHOS-2 and OVK18 

cell lines were also not affected by cAMP and Forskolin. However in HSKTC, 

cAMP stimulated Cables 1 promoter activity about two fold higher than control and 

Forskolin stimulated Cables 1 promoter activity about five fold higher than control. 

Forskolin is known to stimulate intracellular accumulation of cAMP and this in turn 

may be the cause of stimulation of Cables 1 promoter activity in response to Forskolin 

in the HSKTC. 

Conclusion: These experiments suggest that Cables 1 promoter regulation mechanism 

depends on the cell type and may be dictated by differences in underlying epigenetic 

modulation of the Cables 1 promoter. The mechanism of cAMP regulation of Cables 

promoter is not clear because there is no canonical CRE in this region of the promoter. 

Ovarian carcinoma is difficult to detect by clinical laboratory test and often develops 

chemoresistance. Future experiments will continue to define the regulation of Cables 

1 promoter, which may help predict better treatment or early diagnostics of ovarian 

carcinoma. 

Acknowledgement: These studies were supported in part by Grant-in-Aid for 

Scientific Research C, JSPS KAKENHI Grant Number 23590695 (HS). 

A-43 

Validation of a new highly sensitive thyroglobulin immunoassay (hTg 

sensitive) on the Thermo Scientific B·R·A·H·M·S KRYPTOR platform 

E. Thomas 1 , A. Algeciras-Schimnich 2 , C. M. Preissner 2 . 1 Research and 

Development, Thermofi sher Scientifi c, Nîmes, France, 2 Department of 

Laboratory Medicine and Pathology, MAYO Clinic, Rochester, MN 

Differentiated thyroid cancer (DTC), the most common endocrine malignancy, is a 

highly curable disease with 5-year survival rates in excess of 95%. Treatment for 

DTC typically involves thyroidectomy followed by, in certain cases, radioactive 

iodine ablation, as well as thyroid-stimulating hormone (TSH) suppression. Serum 

thyroglobulin (Tg) measurement is a cornerstone of post-operative monitoring and 

long-term surveillance of DTC patients. However, serum thyroglobulin measurement 

remains technically challenging due to various degrees of assay sensitivity, betweenmethod 

variability, and Tg autoantibody (TgAb) interference, among others. Thermo 

Scientific B·R·A·H·M·S hTg sensitive KRYPTOR ® is a new human Tg immunoassay 

available on the KRYPTOR compact PLUS with an automated recovery test. The 

assay is calibrated against the reference standard CRM457 and uses Time Resolved 

Amplified Cryptate Emission (TRACE) technology, based on a non-radiative transfer 

between 2 fluorophores, terbium chelate and cyanin 5.5. Sample volume and incubation 

time are 70 μl and 59 minutes, respectively. The direct measuring range of the assay 

is 0-200 ng/mL but samples up to 200,000 ng/mL can be measured without operator 

intervention by use of automatic out-of-range detection and dilution. Linearity was 

validated through the entire measuring range by diluting a sample (200,000 ng/mL) 

down to the LOQ; the mean bias obtained was 6.4%. Automatic dilutions performed 

on KRYPTOR compact PLUS have recoveries between 81 and 106%. Assay 

imprecision was evaluated following CLSI EP5-A2 (3 reagent lots, 2 instruments, 

20 days). The intra and inter-assay coefficients of variation were 18.6% and 19.8% 

at 0.15 ng/mL; 9.7% and 10.7% at 0.29 ng/mL; 2.4% and 5.1% at 1.1 ng/mL and 

1.5% and 4.6% at 129 ng/mL. The functional assay sentivity, the limits of detection 

(LOD) and quantitation (LOQ) were 0.15, 0.09 and 0.17 ng/mL, respectively, based 

on CLSI EP17-A procedures. The assay was compared to the Access Thyroglobulin 

assay (Beckman Coulter) (n=89, range 0.1 – 193 ng/mL). The Spearman correlation 

coefficient was 0.99 with a slope of 0.86 and intercept of 0.01 by Passing-Bablock 

regression fit. There were 53 samples with negative anti-Tg antibodies concentration 

(< 22 IU/mL using the Roche Elecsys anti-Tg assay), the automatic recoveries 

were all above 100% (range 102-127%); while in 36 samples with positive anti-Tg 

antibodies concentration (>22 IU/mL), the recoveries were between 68- 126%. The 

B·R·A·H·M·S hTg sensitive KRYPTOR assay is a new highly sensitive automated 

thyroglobulin assay proven to provide reliable results for the management of thyroid 

cancer patients and early detection of recurrences. 

A-44 

Comparison of responses assigned using immunoglobulin heavy/light 

chain (IgA-kappa / IgA-lambda) ratios to international myeloma 

working group response criteria 

P. Young, H. Sharrod, R. Hughes, H. Carr-Smith, S. J. Harding. The Binding 

Site Group Ltd, Birmingham, United Kingdom 

Background: Quantification of monoclonal immunoglobulins (M-Ig) by serum 

protein electrophoresis is required to assign responses, and as an indication of relapse 

in multiple myeloma (MM) patients, with imunofixation (IFE) being required to type 

and assign a complete response in SPEP negative patients. Whilst these measurements 

are suitable for assessment 

of gross M-Ig production they are limited when, for instance, the M-Ig co-migrates 

with other proteins when analysed by SPEP or when there is a broad migration when 

analysed by IFE. When SPEP is non-quantifiable total IgA (tIgA) is recommended as 

a quantitative alternative for M-Ig monitoring, however, as tIgA cannot distinguish 

between M-Ig and polyclonal background, it over-estimates M-Ig levels. Novel 

nephelometric assays that quantify IgAκ & IgAλ (heavy/light chain; HLC) have been 

developed. Here, we compare IgA HLC and SPEP/tIgA measurements and assess 

changes in HLC ratio (IgAκ/IgAλ; HLCr) as a method of monitoring IgA MM patients. 

Methods: IgAκ HLC (normal range: 0.48-2.82) IgAλ HLC (0.36-1.98) and HLCr 

(0.80-2.04) were measured in 60 serial samples from 21 (14 IgAκ; 7 IgAλ) IgA MM 

patients to identify HLCr change cut-offs that could be used to define responses; these 

cut-offs were then validated in 272 serial samples from 65 (40 IgA κ; 25 IgA λ) MM 

patients. HLCr responses were compared with IMWG responses in two ways: 1) 

responses were dichotomized into response (CR, VGPR and PR) v no response (SD 

and PD) and sensitivity, specificity, PPV and NPV were calculated for HLCr; and 2) 

individual assigned responses were compared using a Weighted Kappa analysis with 

a quadratic weighting. 

Results: The following response criteria were identified for changes in HLCr: 1) PD: 

≥24% increase in HLCr with absolute increase in involved IgA ≥5g/; 2) SD: 24% increase in HLCr without an accompanying 

5g/L increase in involved IgA and 20 PDs (median % change: 212%; range: 65% 

to 487%); There was good agreement between dichotomized HLCr-responses and 

IMWG-responses (sensitivity: 91.7% (95% CI: 87.2-95.1%); specificity: 73.9% (61.5- 

83.9%); PPV: 91.7% (95% CI: 87.2-95.1%); NPV: 73.9% (61.5-83.9%) and between 

individual assigned responses (Weighted Kappa: 0.86 (0.78-0.97); >0.81 is considered 

to be identical). 

Conclusion: HLC measurements display good agreement with SPEP/tIgA 

measurements and HLCr changes can be used to monitor IgA MM patients. Further 

clinical studies are needed to validate optimal HLCr cut-offs and to verify the clinical 

benefit of HLCr monitoring. 

A-45 

Withdrawn by Author 




A-46 

High-throughput screening of ALK, RET, and ROS1 fusion transcripts 

in Non-Small Cell Lung Cancer (NSCLC) by Multiplex Real-time RT- 

PCR High-Resolution Melting curve analysis 

S. Itoga 1 , K. Sato 1 , Y. Sakairi 2 , T. Ishige 1 , K. Matsushita 3 , I. Yoshino 2 , F. 

Nomura 3 . 1 Chiba University Hospital, Chiba City, Japan, 2 Department of 

General Thoracic Surgery, Chiba University Graduate School of Medicine, 

Chiba City, Japan, 3 Department of Molecular Diagnosis, Graduate School 

of Medicine, Chiba University, Chiba City, Japan 

Background: The identification of tumor-driving oncogenic transcripts is 

advantageous for molecular targeted therapy for NSCLC. However, specific detection 

of the ALK, RET, and ROS1-translocated fusion genes transcripts, coding strong 

kinases, is still challenging mainly because the breakpoints of these genes are diverse 

or inconsistent. The purpose of this study was to develop and evaluate a novel and 

simple high-throughput multiplex real-time RT-PCR high-resolution melting curve 

analysis (RRT-PCR HRM) that can be used for the detection of various ALK, RET, 

and ROS1 fusion transcripts. 

Methods: We used 264 tissues samples obtained from 132 NSCLC patients treated 

in Chiba University Hospital, Japan. Primary tumor tissue samples were obtained by 

conventional needle aspiration biopsy with flexible endo-bronchoscopy and lymph 

nodes tissues were obtained using a convex-type ultrasound probe. These biopsy 

tissue samples, rinsed with fluids (ultra-micro sample; uMS), were used for further 

genetic analysis. Translocated fusion genes such as EML4-ALK, KIF5B-ALK, 

CCDC6-RET, KIF5B-RET, TPM3-ROS1, SDC4-ROS1, SLC34A2-ROS1, CD74- 

ROS1, EZR-ROS1, and LRIG3-ROS1 were examined using the multiplex RRT-PCR 

HRM system. To determine the sensitivity of the RRT-PCR HRM, we performed a 

plasmid synthesized DNA titration study. 

Results: RNA was successfully extracted from both bronchoendoscopic biopsy 

samples and uMSs. ABL mRNA expression was used as the RNA internal extraction 

control: 6.2E+05 ± 1.2E+06 (mean ± SD) copies/μg RNA from tissue samples, and 

1.1E+05 ± 2.0E+05copies/μg RNA from uMSs. Fusion gene transcripts, including 

ALK (n =5), RET (n = 1), and ROS1 (n = 1), were identified in 7 cases. Identical 

results were obtained for both histological samples and MS. Additionally, plasmid 

templates representing all the transcripts were amplified, and they showed predicted 

PCR sizes. This method potentially enabled the detection of every fusion transcript, 

and 7-20 copies/reaction were obtained. 

Conclusion: We developed a novel and simple high-throughput multiplex RRT-PCR 

HRM system for detecting ALK, RET, and ROS1 fusion transcripts. This method is 

clinically useful for detecting kinase-fusion transcripts even in tiny lung cancer tissues 

obtained by bronchoscopic uMS. 

A-47 

Evaluation of absence of dietary interferences using FOB Gold ® Screen 

System in the determination of occult blood in fecal samples 

M. Gramegna, M. La Motta, G. Longo, M. Anelli, R. Lucini. Sentinel CH. 

SpA, Milan, Italy 

Background: 

In the determination of occult blood in fecal samples is critical to avoid interferences 

in the analytical results caused by animal hemoglobin present in the diet of tested 

subjects. For this purpose, it is fundamental to dispose of a reagent able to recognize 

human hemoglobin molecules exclusively. The objective of this study was to evaluate 

cross reactivity (analytical specificity) of hemoglobins of animal origin on clinical 

performances of FOB Gold ® Screen System. This study was performed on hemoglobin 

from bovine, pig, sheep, horse and goat. 

Methods: Were selected 5 healthy subject, over the age of 50 years (target age in 

the clinical screening) and under the age of 70 years. Subjects were not subjected to 

dietary restrictions. Healthy subjects were 

selected by subjecting the volunteers to test for occult blood (FOB). For each subject 

were tested 3 samples, in 3 different days, before starting to feed with dedicated 

diet. All subjects tested negative were involved in the study. The selected subjects 

will be submitted for at least 1 week at a diet consisting mainly of cooked bovine 

meat (100 g/day). The results must were negative throughout the period of 6 days. 

After the first phase with cooked meat, the selected subjects will be submitted for 

at least 6 days at a diet consisting mainly of raw bovine meat (100 g/day). Then, 

the subjects were controlled for a period of 6 days during normal diet. Two of these 

three steps (cooked meat, control after diet) were repeated using pig meat, sheep 

meat, horse meat, goat meat. The cut-off was fixed at 80 ng/mL. The FOB Gold 

System is an immunodiagnostic system developed for providing sensitive, accurate 

and reproducible measurements of human hemoglobin levels in feces specimens. It 

consists of latex reagents, calibrator set, controls set, sample collection tubes. All 

tests were performed in double using Beckman Coulter AU400 and Beckman Coulter 

AU480 clinical chemistry analyzers. 

Results: Control of subjects during diet based on bovine cooked meat: all subjects 

result negative after 6 sampling (all results < 80 ng/mL). Control of subjects during 

diet based on bovine raw meat: all subjects result negative after 6 sampling (all results 

< 80 ng/mL). Control of subjects during diet with pig cooked meat: all subjects result 

negative after 6 sampling (all results < 80 ng/mL). Control of subjects during diet 

based on sheep cooked meat: all subjects result negative after 6 sampling (all results 

< 80 ng/mL). Control of subjects during diet based on horse cooked meat: all subjects 

result negative after 6 sampling (all results < 80 ng/mL). Control of subjects during 

diet based on goat cooked meat: all subjects result negative after 6 sampling (all 

results < 80 ng/mL). 

Conclusion: Based on the results summarized below, there is not cross reactivity of 

hemoglobins of animal origin on clinical performances of FOB Gold H System. On 

the basis of these results, it is possible to conclude that is not requested diet restriction 

before testing of these reagents. 

A-48 

Assessing the necessity of including a crossover period when switching 

total PSA assays 

A. Rutledge, G. Pond, S. Hotte, P. Kavsak. McMaster University, Hamilton, 

ON, Canada 

Background: The National Academy of Clinical Biochemistry guidelines on the Use 

of Tumor Markers in Clinical Practice: Quality Requirements (2008) recommended 

that laboratories establish a defined protocol when changing tumor marker methods. 

This may necessitate including a crossover period during which patient samples are 

analyzed by both the 

current and new tumor marker assays in parallel. However, some tumor marker 

assays, such as total prostate-specific antigen (PSA), have been standardized, with 

traceability to the World Health Organization (WHO) standard. Thus, when switching 

standardized total PSA methods, it may not be necessary to provide overlapping 

testing if the method comparison during the validation is acceptable. The objective 

of this study was to assess agreement between Abbott Architect total PSA (new 

laboratory assay) and Roche Modular total PSA (current laboratory assay) during the 

method validation and subsequently in the crossover timeframe when both Abbott and 

Roche total PSA results were reported. 

Methods: In accordance with the Clinical and Laboratory Standards Institute 

(CLSI) Guideline EP09 (Method Comparison and Bias Estimation using Patient 

Samples), 40 patient samples (serum) were split and run on each platform for total 

PSA with Passing & Bablok regression analysis performed. After this validation, a 

crossover study was performed during which both the Roche and Abbott total PSA 

assays were reported clinically for 54 days. Passing & Bablok regression was also 

performed on this dataset. Agreement between results was determined according 

to CLSI Guideline C45-A (Verification of Comparability of Patient Results within 

One Health Care System), with the percent difference between results (calculated 

as the absolute difference between Roche and Abbott results on a sample, divided 

by the mean of those results) deemed acceptable if ≤0.33xCVi (CVi=intraindividual 

biological variation; 18.1% for total PSA). Analyses were performed using Analyse-it 

and Statsdirect software. 

Results: Of 40 paired samples in the validation analysis, the median total PSA values 

(ranges) were 3.08 μg/L (0.03-61.49 μg/L) and 2.85 μg/L (0.03-54.73 μg/L) for the 

Roche and Abbott assays, respectively. Regression analysis yielded: (Abbott total 

PSA)=0.99(95%CI:0.95-1.03)x(Roche total PSA)-0.01(95%CI:-0.04-0.00). During 

the crossover, 1110 paired results were obtained. The median total PSA values (ranges) 

were 3.30 μg/L (0.04-2710 μg/L) and 3.45 μg/L (0.05-2666 μg/L) for the Roche and 

Abbott assays, respectively, on 948 paired samples with detectable concentrations by 

both methods. In the 162 samples with at least one assay result below the functional 

sensitivity (Roche



Despite the excellent linear relationship between the Roche and Abbott assays, only 

490 samples (52%; 95%CI:49-55%) in the crossover period had a percent difference 

between the methods ≤0.33xCVi. 

Conclusion: This study highlights the importance of performing crossover studies 

when changing tumor marker platforms, even for a standardized assay such as total 

PSA. It is not sufficient to run 40 patient samples on each platform and rely on linear 

regression if comparability of results is the optimal goal. 

A-51 

Validation of a rapid lateral-flow test for the diagnosis and monitoring 

of immunoglobulin free light chains: retrospective analysis of sera 

from patients with plasma cell dyscrasias. 

J. Campbell, A. Stride, J. Heaney, M. Cobbold, Y. Wang, M. Goodall, S. 

Bonney, A. Chamba, T. Plant, Z. Afzal, R. Jefferies, M. Drayson. University 

of Birmingham, Birmingham, United Kingdom 

Background: Quantitation of serum κ and λ immunoglobulin free light chains (FLC) 

is central to the diagnosis and monitoring of patients with plasma cell dyscrasias, 

including multiple myeloma. At present, laboratory FLC tests offer the only means 

of quantitating FLC in urine and blood and often have a slow turnaround time that 

prevents early myeloma diagnosis or identification of relapse. We have developed a 

rapid lateral-flow test (Seralite) that simultaneously quantitates kappa and lambda 

FLCs in blood or urine in 10 minutes using highly-specific anti-κ and anti-λ FLC 

monoclonal antibodies (Campbell et al., 2013 JIM). 

Methods: Seralite validation was conducted by retrospective analysis of sera 

from patients with plasma cell dyscrasias from MRC UK Myeloma IX and XI trials. 

Specifically, 1,975 (MIX n=1,231, MXI n=744) samples at trial entry were used to 

assess the utility of Seralite for diagnosis. 

Results: Seralite displayed excellent clinical concordance with Freelite 

and immunofixation electrophoresis for identification of abnormal FLC levels. 

Additionally, cohorts of samples from patients with light chain only myeloma, nonsecretory 

myeloma, and intact immunoglobulin myeloma (IgAκ/λ, IgGκ/λ, IgMκ/λ, 

IgDκ/λ) were assessed through diagnosis, response to therapy, plateau and relapse. 

Seralite had excellent concordance with Freelite for the quantitation of serum FLC 

from diagnosis through monitoring. 

Conclusion: Prospective use of Seralite to diagnose and monitor plasma cell 

dyscrasias at the point-of-care should now be investigated. 

A-52 

Meeting the Needs of In-house Thyroid Cancer Patients: Identifying 

Appropriate Thyroglobulin and Thyroglobulin Antibody Testing 

Algorithms 

S. E. Wheeler 1 , J. Picarsic 2 , H. Blair 1 , O. Peck Palmer 1 . 1 University of 

Pittsburgh, Pittsburgh, PA, 2 Children’s Hospital of Pittsburgh, University 

of Pittsburgh, Pittsburgh, PA, 

BACKGROUND: The American Society of Cancer estimates in 2013 >60,000 

individuals will be diagnosed with thyroid cancer. The demand for accurate and timely 

in-house laboratory testing is high. Specifically, in differentiated thyroid carcinoma 

(DTC), the most common thyroid cancer, thyroglobulin (Tg) is used to assess disease 

recurrence in patients who have undergone thyroidectomy. Commercially available 

Tg immunoassay methods are most common but are susceptible to Tg antibody 

(TgAb) interference. In most laboratories TgAb is quantified and manufacturer cutoffs 

are used to categorize a specimen as TgAb negative (Tg analyzed by immunoassay) 

or TgAb positive (Tg measurement is referred to an alternate methodology). The 

Tg radioimmunoassay (RIA) method is a common alternative method as it is less 

susceptible to TgAb interference. Previous studies demonstrate that lower TgAb 

cutoffs for immunoassay testing increase the accuracy of Tg concentrations reported. 

However, referring samples to outside laboratories increases result turnaround time 

and patient costs. Identifying the limitations of in-house Tg can aid the laboratory in 

developing appropriate testing algorithms. 

OBJECTIVE: To investigate the most clinically appropriate TgAb cutoff for reflex 

Tg testing by RIA method in a patient population being managed for the recurrence 

of DTC. 

MATERIALS AND METHODS: Excess samples (n=61; -80°C storage) were 

obtained from adults (>/= 18 years old) post total thyroidectomy. These adults were 

monitored as outpatients for DTC recurrence by the Diabetes and Endocrinology Center. 

Samples were analyzed for TgAb using a simultaneous one-step immunoenzymatic 

assay (UniCel DxI 800 automated analyzer, Beckman Coulter, CA), a radioassay 

method (semiautomated; Kronus, ID) and an indirect noncompetitive enzyme 

immunoassay (Varelisa Thyroglobulin Antibodies EIA kit, Phadia GmbH, Germany). 

Tg was analyzed using a simultaneous one-step immunoenzymatic assay (UniCel 

DxI 800 automated analyzer, Beckman Coulter, CA), a solid-phase chemiluminescent 

immunometric assay (Immulite® 2500, Siemens, LA) and a RIA method (USC 

Endocrine Laboratories, CA). 

RESULTS: TgAb detection was examined. Concordance between the DxI 800 and 

Kronus was 91%. Concordance was significantly lower between DxI 800 and Phadia, 

and Kronus and Phadia, 71% and 78% respectively. We examined the effects of 

TgAb interference on Tg concentrations that ranged from 0-463 ng/mL (the upper 

limit for the DxI 800) with the DxI 800 TgAb recommended cutoff of



A-58 

Differentiating prostate cancer and prostatic hyperplasia by using 

capillary electrophoretic protein profiles 

H. Kataoka 1 , T. Sakaki 2 , M. Kamada 1 , K. Saito 3 , Y. Yamamoto 3 , K. Yabe 2 , 

T. Hisahara 1 , Y. Hatakeyama 1 , Y. Okuhara 1 , T. Shuin 1 , T. Sugiura 1 . 1 Kochi 

Medical School, Kochi, Japan, 2 A&T Corporation, Yokohama, Japan, 

3 

Kyoto University Graduate School of Medicine, Kyoto, Japan 

Background: The data from protein electrophoretic profile with capillary 

electrophoresis could be used for diagnosis of certain diseases including metabolic 

syndrome. Moreover, in certain analytical condition protein electrophoretic profile 

showed specific points of mobility for prostate cancer. Accordingly, the aim of this 

study was to determine the possibility of discriminating patients with prostatic 

hyperplasia and prostate cancer by utilizing protein electrophoretic profile data with 

ROC analysis. 

Methods: This study consisted of 25 men with prostate cancer and 55 men with 

prostatic hyperplasia. Measurement was performed by Capillary electrophoresis 

under the following condition: voltage; 7.8kV, temperature; 35.5°C, buffer solution; 

pH 9.9 alkalin buffer, and detection wavelength; 200nm and 214nm. Demarcation 

curve data were collected by measuring capillary electrophoresis with 10% of N-,N’- 

dimethyl form amide (DMF, 2μL) as internal standard in diluent. Standardization of 

the mobility was performed by peak position of both DMF and albumin as standards, 

and that of peak strength was performed by total protein concentration. All the 

other demarcation curves were standardized by the same method. Each point of the 

standardized curve and the confirmed diagnosis were used in the bootstrap ROC 

analysis to produce a map of area under the curve (AUC) value. 

Results: The diagnostic feature of PSA and its calculated F/T value obtained by 

the conventional method were AUC=0.69 and 0.79. By using the detection wave 

length of 214nm, prostate cancer had high point located between albumin tail and 

globulin (AUC=0.708), and between alpha-1 tail and albumin (AUC=0.714) of the 

standardized curve. Furthermore, when multiple logistic regression analysis were 

performed using 7 variables (5 excellent mobility areas, age and total protein), protein 

electrophoretic profile had good diagnostic ability to differentiate prostate cancer and 

prostatic hyperplasia (AUC=0.78). 

Conclusion: The differential diagnosis of prostate cancer and prostatic hyperplasia 

was possible by changing the detection wave length of the protein electrophoretic 

profile. 

A-60 

Value of serum free light chains in the monitoring of the treatment and 

relapse of a patient with IgD Kappa multiple myeloma associated with 

primary amyloidosis. 


González Rodríguez. Hospital Universitario Virgen Macarena, Sevilla, 

Spain 

Background: Multiple Myeloma (MM) is a malignancy of B cells characterized 

by an atypical proliferation of plasm cells. IgD MM has a very low incidence (2% 

of MM cases) and it´s characterized by an aggressive course and a worse prognosis 

than other subtypes. The free light chains in serum (FLC) are very important 

markers for monitoring patients with multiple myeloma (MM) and other monoclonal 

gammopathies. When the serum FLCs are present in low concentrations, they are 

difficult for the detection by conventional methods as serum protein electrophoresis 

(SPE) and immunofixation (IFE). We report the case of a patient where FLCs are 

either undetectable or barely detectable using the conventional qualitative assays. 

Case report: a 50 years old man was diagnosed in June 2011 of IgD Kappa multiple 

myeloma with primary amyloidosis associated. He began treatment with VAD 

(vincristine, doxorubicin and dexamethasone) and hemodialysis. He received three 

cycles of VAD from July 2011 to August 2011 but the κ/λ FLC ratio was altered 

during this treatment (from an initial value of 1570 mg/L in July to a value of 1633 

mg/L in August). The IFE was positive (IgD Kappa) during the treatment. Due to the 

minimum response of the disease and the development of demyelinating neuropathy, 

the treatment was changed to bortezomib and dexamethasone. Then, the patient 

received eight cycles from September 2011 to April 2012 with a normalization of 

the κ/λ FLC ratio from an initial value of 1579 mg/L in September to a value of 1.62 

mg/L at the end of March 2012 with negative IFE. The patient´s condition improved 

with this treatment and achieved the complete remission (CR). Three months later, 

the κ/λ FLC ratio began to increase predicting a relapse with a value of 2.52 mg/L in 

July, 4.27 mg/L in August, 60.23 mg/L in October and a maximum value of 135.85 

mg/L in December. In these months, the IFE was normal. In January 2013, the κ/λ 

FLC ratio remained altered (97.41 mg/L) and the IFE was positive (IgD Kappa) for 

first time in the relapse. 

Conclusions: This case is a good example of the utility k/λ FLC ratio in the monitoring 

of multiple myeloma. The k/λ FLC ratio can detect when the chemotherapy applied 

isn´t completely effective or it can predict future relapses in the patient. 

A-61 

Study Of Novel Genes-associated With The Risk Of Esophageal 

Squamous Cell Carcinoma By Whole Genome Expression Array 

H. Lin 1 , H. Shih 2 , M. Wu 3 . 1 Department of Laboratory Medicine,Teaching 

and Research center, Kaohsiung Municipal Hsiao-Kang Hospital 

and Graduate Institute of Occupational Safety, Kaohsiung, Taiwan, 

2 

Department ofDivision of Gastroenterology, Department of Internal 

Medicine , Kaohsiung Municipal Hsiao-Kang Hospital, Kaohsiung, Taiwan, 

3 

Department of Family Medicine, Kaohsiung Medical University Hospital, 

Department of Public Health, Kaohsiung Medical University,Center of 

Environmental and Occupational Medicine, Kaohsiung Municipal Hsiao- 

Kang Hospital, Kaohsiung, Taiwan 

Background:Esophageal cancer is the 6th leading cause of cancer death worldwide 

in 2008. In Taiwan, most of histological type of esophageal cancer was squamous 

cell carcinoma; majority of them happened in men. The annual incidence rate of 

esophageal cancer in men increased ~100% in recent decade (from 5.7/10 5 in 1995 to 

12.1/10 5 in 2007). The overall five-year survival rate for esophageal cancer was less 

than 15%, because, once diagnosed, its ability of invasiveness and metastasis is high. 

Therefore, it becomes crucial to identify the potential novel genes for the prediction of 

esophageal cancer malignancy in the clinic. Methods:Cooperated with the scientists 

from the Microarray Lab. Center of Biomedical Engineering Research Laboratory in 

Industrial Technology Research Institute (ITRI, Hsinchu, Taiwan), we analyzed three 

Taiwanese ESCC cell lines (CE48T/VGH, CE81T/VGH, and CE146T/VGH) and one 

Caucassian ESCC cell line (OE21) as well as three normal tissues of esophagus by 

using the cutting-edge microarray technique (Human OneArray expression system) 

which probes ~30,000-transcription expression profiling of human genes. Then, in 

order to investigate whether these selected candidate genes are really meaningful in 

vivo, we have finished cDNA array analyses in 17-paired ESCC tumor tissues and 

their normal parts. Result: Among them, we have identified the most significant 10 

down-regulated(DCN,PRELP,HBB,C7,HBA1,DES,COX7A1,PLVAP and MYL9) 

and 13 up-regulated(HMGA2,ECT2,UBAP2L,ZIC2,COPA,IMP-2,HOXC13,WAR 

S,FJX1,HOXA10,HOXD11,ADPGK and IMP-3) novel genes from cell lines. The 

role and mechanism of these most candidate genes were unknown in esophageal 

carcinogenesis. These candidate genes were compared by 17-paired ESCC tumor 

tissues and their normal parts using cDNA array analyses. All gene expression data 

were represented by T/N ratio. Because mean values can be easily influenced by some 

extreme high or low data, we use median to estimate the expression of these genes. 

The distributions of these 17 paired tissues among our candidate down-regulated genes 

show significant results. DCN(T/N=0.63),PRELP(T/N=0.39),HBB(T/N=0.57),C7(T/ 

N=0.15),HBA1(T/N=0.54),DES(T/N=0.08),COX7A1(T/N=0.28) and MYL9(T/ 

N=0.20) show low expression median(T/N ratio 1). 

Conclusion: Compared to the findings from cell lines, we found the high consistency 

in terms of RNA expressions in those candidate genes, allowing us to be more 

confidence that the 23 candidate genes we selected from 3-paired tumor/normal 

ESCC tissues using microarray technique of Human 1A (version 2) oligo microarray 

(Agilent Technologies, USA) may play an important role in the occurrence of ESCC 

A-62 

Real Time PCR Detection of the V600E BRAF Mutation 

C. G. Rasuck, F. S. V. Malta, V. C. Oliveira, F. A. Caxito. Hermes Pardini, 

Vespasinao, Brazil 

Background:The V600E BRAF mutation is associated to many different cancer types, 

specially melanoma, thyroid cancer and colorectal cancer (CRC). BRAF mutations 


A15



are present in approximately 50% of all melanoma, and 8% of all solid tumors. 

Heterozygous patients for the V600E mutation do not have a positive response for 

monoclonal EGFR-antibodies, and are indicated for monotherapy with Vemurafenib 

(ZELBORAF). This is the first time FDA (Food and Drug Administration) approves a 

medication based on the patient´s genetic profile. The quicker the tumor is genetically 

classified, the more effective can be the approach made by the physicians. The goal 

of this study is to detect the V600E BRAF mutation using a fast and not expensive 

method. 

Methods:Amplification was performed on StepOne Plus Real Time PCR (Applied 

Biosystems). A set of primers-probes with Primer Express Software (Applied 

Biosystems, CA) were designed. The fluorescent reporter for Taqman® MGB 

probes were FAM (Applied Biosystems). For this study, 70 patients with clinical 

and laboratorial diagnosis of CRC were tested for the mutation. Real time PCR was 

performed by a wild-type and a mutant mix, being 8 patients also sequenced for 

results confirmation (3 positives and 5 negatives for V600E BRAF mutation). 

Results:The wild-type mix had an amplification ranging from 52,000 to 87,000 UF 

(Fluorescence Units), with a plateau formation and Ct (Cycle threshold) between 25 

and 39. The mutante mix, in the positive patients, had a signal detection ranging from 

32,000 to 60,000 UF, didn’t show plateau formation and Ct ranging from 26 to 39. The 

DNA concentration should be between 0.1 and 90.0 ng/uL. 

Conclusion:The performed assay was a rapid, not expensive, and an efficient method 

to detect V600E BRAF mutation. 

A-63 

Prognostic value of serum free light chains ratio at diagnosis in Spanish 

population with multiple myeloma 


González Rodríguez. Department of Clinical Biochemistry, Hospital 

Universitario Virgen Macarena, Sevilla, Spain 

Background: monoclonal gammopathies are a group of disorders characterized by 

clonal expansion of B cells that usually secrete intact monoclonal immunoglobulin, 

monoclonal free light chains or both. The quantification of serum free light 

chains (FLCs) is used in the diagnosis, monitoring and prognosis of monoclonal 

gammopathies. The aim of this study is to evaluate the prognostic value of serum 

FLCs ratio at baseline in newly diagnosed multiple myeloma (MM) in a Spanish 

population. 

Methods: we studied 73 patients with newly diagnosed multiple myeloma (56 intact 

immunoglobulin MM (IIMM) and 17 light chains MM (LCMM)) during a period 

of five years (2008-2012). Serum free light chains were measured by turbidimetry 

(Freelite TM , The Binding Site, Birmingham, UK). Survival was defined as the time 

from initial diagnosis to death or the last follow-up and was calculated by the method 

of Kaplan and Meier. The survival curves were compared using the log-rank test. A p 

value 26 and



Conclusions: Srm-exosomes can provide a suitable material to measure circulating 

miRNA in melanoma and lower levels of miR-125b in srm-exosomes are associated 

with advanced melanoma disease, probably reflecting the tumor cell disregulation. 

Levels (median Ct and interquartile range) of miR-125b in serum and srm-exosomes in 

control, disease 

Patients Serum Srm-exosomes 

Controls 32.8(28.7-35.7) 30.2 (29.0-31.6) 

Disease free 33.3(29.3-36.8) 32.1 (31.0-35.7) 

Advanced melanoma 35.2 (32.8-37.2) 37.6 (31.3-39.1)* 

A-67 

Case report: Detection of c.180_181 TC>AA mutation in codon 61 of 

the KRAS gene by Pyrosequencing technique. 

P. Nishimura 1 , F. Gandufe 1 , V. Niewiadonski 1 , F. Abreu 1 , M. Freire 2 , N. 

Gaburo 1 . 1 DASA, Sao Paulo, Brazil, 2 DASA, Rio de Janeiro, Brazil 

The detection of KRAS gene mutations has been used to predict response to therapy 

with EGFR- inhibiting drugs like cetuximab and panitumumab in patients with 

metastatic colorectal cancer. Certain mutations can activate EGFR- independent 

signaling pathways, conferring resistance to these drugs. Other tumors can also 

present KRAS mutations, as lung, pancreas and thyroid. 

Our objective is to report a case where we detected a rare mutation in codon 61 of the 

KRAS gene using the Pyrosequencing technique. 

A 72 years old patient diagnosed with metastatic colorectal cancer was treated with 

surgery and chemotherapy (FOLFOX associated to Avastin). The test was performed 

on formalin-fixed, paraffin-embedded tumor specimen, after the selection of the 

specimen region to be analyzed by a pathologist. The DNA was extracted using the 

Qiaamp FFPE Tissue kit (Qiagen, Hiden, Germany). The codon regions 12, 13 and 

61 were amplified by PCR using the KRAS Pyro kit (Qiagen, Hiden, Germany). 

Successful and specific amplification of the region of interest was verified by 

visualizing the PCR product on capillary eleforesis (Qiaxcel,Qiagen). Preparation of 

single-stranded DNA was done using PyroMark Q24 vacuum workstation (Qiagen) 

according to the manufacturer instructions. The pyrosequencing reaction was done on 

the Pyro Mark Q24 (Qiagen). 

The pyrogram trace revealed no mutations in the codons 12 and 13 (wild-type) and the 

mutation c.180_181 TC>AA in codon 61 with a frequency of 30% 

Mutations in codon 61 of the KRAS gene are rare and there is little data in literature 

about its frequency and clinical significance. 

A-68 

Study of the reference interval for the Chromogranin A test 

D. Panisa, V. Alastico, I. Almeida, S. Mendonça, O. Denardin, N. Gaburo. 

DASA, Sao Paulo Brasil, Brazil 

Background: Chromogranin A (CgA) is a protein of 49 kDa composed by 439 coded 

amino acids in the chromosome 14 which is related to the presence of neuroendocrine 

tumors. Some drugs that are used to treat gastrointestinal dysfunctions may increase 

some serum levels of CgA, and may compromise the accuracy of the test. 

Objective: To conduct a study to define a reference range for chromogranin A in a 

clinical laboratory. 

Methods: CgA was determined through ELISA (Enzyme-Linked Immunosorbent 

Assay) method using Chromogranin A (IBL Internacional, Hamburg Germany) kit, 

in 200 laboratorial samples. Gender distribution was 50% (100 samples) male and 

50% (100 samples) female. The results were stratified in three classes: inferior to 20 

ng/mL, 21 to 100 ng/mL and superior to 100ng/mL. For the statistics analysis were 

calculated: standard deviation and variation coefficient. 

Results: Distribution of results between classes were 35% inferior to 20 ng/mL 

(mean:1,91; SD:5,63) 25% between 21 a 100 ng/mL (mean: 50,13; SD: 16,7) and 

40% superior to 100ng/mL (mean: 336,7; SD: 131,5). 

Conclusion: The database revealed that the interval superior to 100 ng/m is more 

reliable, representing a more accurate results. This value also represents a safe 

threshold of reactivity where we can exclude those patients whose CgA levels are 

high due to the use of drugs. 

A-69 

Highly Sensitive and Specific Single-Tube SNP Assay for Simultaneous 

Detection of NRAS and BRAF Mutations 

K. Madanahally Divakar 1 , S. Li 1 , S. Voronov 1 , V. Scialabba 1 , M. Schwab 2 , 

G. Tsongalis 2 , J. Riley 1 , L. Kong 1 . 1 PrimeraDx, Mansfi eld, MA, 2 Dartmouth 

Medical School, Hanover, NH 

Objective: Here, we report the development and verification of the ICEPlex NRAS/ 

BRAF SNP Panel, a multiplex PCR assay, which can detect 13 most clinically 

important NRAS mutations along with 4 other BRAF mutations using nucleic acids 

extracted from FFPE samples, in a single reaction on the ICEPlex* System. 

Clinical Relevance: The RAS genes are proto-oncogenes that are frequently mutated 

in human cancers and are encoded by three ubiquitously expressed genes: HRAS, 

KRAS and NRAS. These RAS genes have GTP/GDP binding and GTPase activity, 

and their proteins may be involved in the control of cell growth. RAS proteins exhibit 

isoform-specific functions and in NRAS, gene mutations which change amino acid 

residues 12, 13 or 61 activate the potential of the encoded protein to transform 

cultured cells with implications in a variety of human tumors, particularly cancers of 

the skin, blood and lymphoid tissue. 

Methodology: NRAS/BRAF SNP detection primers were designed using proprietary 

technology from PrimeraDx. All primers were analyzed in silico for primer-primer 

interaction. Cross-reactivity was determined using the ThermoBlast program and wild 

type cell line gDNA and DNA extracted from FFPE samples. Reaction conditions 

were optimized using proprietary PCR chemistry on the ICEPlex* System. 

Results: The single-reaction ICEPlex NRAS/BRAF SNP Panel targets 17 most 

clinically important mutations in the NRAS and BRAF genes. The kit includes a 

control assay, which serves as the DNA fragmentation control and for calculated a 

delta Ct to determine mutation status; and calibration controls to determine the size 

of amplicons. Analytical studies demonstrate the assay is sensitive (number of copies 

detected in one reaction), selective (mutant to wild type ratio), and specific (relative to 

wild type genomic DNA background). The assay requires just 5 μL of clinical sample 

extract for detection of NRAS and BRAF mutations. 

Conclusions: The ICEPlex NRAS/BRAF assay provides an accurate and sensitive 

detection of mutation status in a single tube reaction using low DNA input. 

Compatibility of this automated multiplexed assay may provide a valid tool for future 

applications in the clinic for diagnostic detection of genomic mutations in cancer, and 

thus may help initiate appropriate treatment regimen. 

*ICEPlex is for Research Use Only. Not for clinical diagnostic use. 

A-70 

Development and Verification of a Multiplex SNP Assay for Detection 

of 13 cMET Mutations on the ICEPlex System in a Single Reaction 

K. Madanahally Divakar, S. Gupta, J. Nolling, J. Riley, L. Kong. 

PrimeraDx, Mansfi eld, MA 

Objective: Here, we report the development and verification of the ICEPlex cMET 

SNP panel, a multiplex PCR assay, which can detect 13 most important cMET 

mutations using nucleic acid extracted from FFPE samples, in a single reaction on 

the ICEPlex* System. 

Clinical Relevance: cMET is a proto-oncogene that encodes the Hepatocyte Growth 

Factor Receptor, a receptor tyrosine kinase, which plays an essential role in normal 

cellular function and oncogenesis. In cancer cells, MET has been implicated in cellular 

proliferation, cell survival, invasion, cell motility, metastasis and angiogenesis. Recent 

studies have indicated cMET as a biomarker for various cancers as well as for drug 

resistance in the case of anti-EGFR therapies. The cMET protein highly overexpresses 

in cancer cells by several mechanisms. One of the mechanisms is via acquired point 

mutations in the tyrosine kinase domain. 

Methodology: cMET SNP detection primers were designed using proprietary 

technology from PrimeraDx. All primers were analyzed in silico for primer-primer 

interaction. Cross-reactivity was determined using the ThermoBlast program and wild 

type cell line gDNA and DNA extracted from FFPE samples. Reaction conditions 

were optimized using proprietary PCR chemistry on the ICEPlex System. 

Results: The single-reaction ICEPlex cMET SNP Panel targets thirteen most 

important mutations in cMET gene. The kit includes a control assay, which is used 

as DNA fragmentation control and for calculated a delta Ct to determine mutation 

status; and calibration controls to determine the size of amplicons. Analytical studies 


A17



demonstrates the assay is sensitivity (number of copies detected in one reaction), 

selective (mutant to wild type ratio), and specific (relative to wild type genomic DNA 

background). 

Conclusions: We have developed a novel multiplex assay, the ICEPlex cMET SNP 

panel, capable of detection of 13 cMET SNP mutations on the automated ICEPlex 

System in one single reaction. The ICEPlex cMET SNP panel will be a useful 

molecular tool for accurate diagnosis of cMET SNP mutations in clinical specimens, 

which will help in personalized patient management. 

*ICEPlex is for Research Use Only. Not for clinical diagnostic use. 

Results and Conclusion: The reference range was 2.0 to 36.52 U/mL with the Architect 

assay and 0.8 to 27.05 U/mL with Beckman. Our upper reference limit for the Architect 

assay was higher than that described by Roberts and La’Ulu Hotakainen et al (26.4 

U/mL) and is according to manufacturers range and several reports in literature to 

discriminate benign diseases and cancer. The correlation between evaluated methods 

was poor r = 0.7192 and bias of 19.18%. The performance characteristics of Architect 

assay, such as conjugated Fab 2’ without Fc portion could justify a higher “signal”. 

However, the similar reference ranges are not sufficient to explain discrepancies. The 

differences between manufacturers require basal realignment in face of changing the 

method for patients follow-up. 

A-71 

Diagnostic and prognostic association of epigenetic inactivation of 

DAPK1 and P16 genes in epithelial ovarian carcinoma patients 

M. Zuberi 1 , A. MIR 2 , I. Ahmad 1 , J. Javid 1 , P. Yadav 1 , M. Masroor 1 , S. Guru 1 , 

S. dholariya 1 , P. Ray 1 , G. Gandhi 3 , A. saxena 1 . 1 Maulana Azad Medical 

college, NEW DELHI, India, 2 University of Delhi, NEW DELHI, India, 

3 

LNJP Deptt of Gyaecology Maulana Azad Medical college, NEW DELHI, 

India 

BACKGROUND: Anomalous DNA methylation is the most common molecular 

detriment leading to the development of a tumour. The potential contribution of DNA 

methylation to oncogenesis is mediated by one or more of mechanisms that include 

DNA hypermethylation of tumour suppressor gene and chromosomal instability in 

cancers. The aim of this study was to investigate the promoter hypermethylation of 

DAPK1 and p16 gene during the progression of epithelial ovarian carcinoma. 

METHODS: A series of 50 ovarian carcinoma samples were evaluated. The 

promoter methylation status of p16 and DAPK1 was assessed by methylation-specific 

polymerase chain reaction. 50 ng of genomic DNA extracted from fresh peripheral 

blood was methylated in all CpG sites by DNA methylases and treated with the 

BisulFlash DNA Modification Kit. Converted DNA was amplified by using primers 

for promoters containing numerous CpG sites and then visualized on a 3.5% agarose 

gel under UV transillumination. The DAPK1 and p16 gene methylation status was 

correlated with age, menopause status, chemotherapy, stage and histopathology of 

the tumour. 

RESULTS: The frequencies of DAPK1 and p16 gene methylation in EOC patients 

was found to be 84% (p=0.0001) and 68%(p=0.0006) respectively . However 

no significant association was seen with age at diagnosis, menopause status, 

chemotherapy, stage and histopathology. 

CONCLUSIONS: These results imply that promoter hypermethylation of DAPK1 

and p16 may be employed as clinically useful biomarkers for prognosis and diagnosis 

of EOC noninvasively using genomic DNA. We suggest that aberrant promoter 

methylation of DAPK1/p16 may serve as a useful biomarker during the follow-up 

of EOC. 

A-72 

Comparison of two different methods for CA19-9 antigen 

L. G. S. Assunção, B. S. Moura, L. Moutinho, M. D. Farace, H. Garcia. 

LABREDE, BELO HORIZONTE, Brazil 

Background: The CA19-9 is a silalylated form of the Lewis blood group antigen 

and is a marker for pancreatic cancer. The agreement of CA19-9 results between 

manufacturers is variable due to characteristics of the tests, standardization and do not 

achieve the performance for early detection but monitoring disease progression. This 

study intended to evaluate discrepancies between CA-19-9 immunoassay Abbott- 

Architect® method in proficiency and patient samples with similar upper reference 

limit. 

Methods: The assay CA19-9XR (Abbott Architect i2000) was compared with GI 

Access Monitor - Beckman Coulter®. The methods correlation and reference value 

were studied by analyzing 419 samples, obtained from a population of presumably 

healthy voluntary blood donors, sent to Labrede (Reference Laboratory in Specialized 

Diagnostics, MG, Brazil). The tests were performed according to the manufacturers’ 

recommendations. Methods were compared using linear regression and the reference 

range was defined as the central 95% interval. Statistical analysis were performed 

by EP Evaluator® and applied CLSI nonparametric and parametric transformed 

protocols. 

A-73 

The evaluation of thyroglobulin measurement for clinical decision in 

patients with differentiated thyroid cancer 

S. Kittanakom, T. Feduszczak, J. Turner, A. Don-Wauchope. Hamilton 

Regional Laboratory Medicine Program, Department of Pathology and 

Molecular Medicine, McMaster University, Hamilton, ON, Canada 

Background and objective The follow-up and monitoring of serum thyroglobulin 

(Tg) is an important biomarker after thyroidectomy for differentiated thyroid cancer 

(DTC). Thyroglobulin (Tg) is a heterogenous 660-kDa glycoprotein and acts as prohormone 

in the intra-thyroid synthesis of thyroid hormones. Serum thyroglobulin 

(Tg) is usually undetectable after treatment for DTC, and thus it is crucial for the 

analytical assay to detect very low Tg levels. The aim of this study is to evaluate 

a possible change in method from radioimmunoassay (RIA) to an automated solidphase 

chemiluminescent immunoassay (ICMA) method. 

Method Method validation and comparision: In the new method, ICMA (Siemens 

Immulite), serum Tg is captured by ligand-labeled anti-Tg murine mAb and the 

alkaline phosphatase conjugated sheep polyclonal anti-Tg antibody. The method was 

calibrated against the standard material (CRM457) and its analytical performance was 

evaluated for both precision and linearity. The current method is radioimmunoassay, 

RIA, (Schering S.A., France) based on a mixture of 4 monoclonal anti-Tg antibodies 

and also calibrated against the standard material (CRM457). Clinical requirements: 

A meeting with key users from surgery and endocrinology was held. The physicians 

were provided with the opportunity to describe their requirements. We provided 

information on the current assay, the proposed assay and the recommendations from 

NACB Laboratory Medicine Practice Guidelines (LMPG). 

Results Method validation and comparision: Immulite 2000 ICMA Tg assay claims 

an assay range of 0.73-84 ug/L with functional sensitivity of 0.9 ug/L. The imprecision 




profiles (CV) are 8.4% repeatability (within-run), 17.8% within-lab (total) precision 

at level 5.43 ug/L. The linearity fit represented a correlation slope of 0.9795 (y= 

0.2876+0.9795x). Overall the results met the claims of the manufacturer for both 

within run and between run precision and for linearity. Comparative results from 

47 patient samples were evaluated by Passing-Bablok regression and Altman Bland 

plots. The results spanning 0.32 to 99.76 ug/L had a proportional bias of 1.45, and 

constant bias of 0.06. Similarly, the Altman Bland plot exhibited positive bias (5.318). 

Clinical requirements: The physicians are very satisfied with the RIA assay and 

the provision of both Tg and anti-Tg Ab result. They would like a faster turnaround 

time (TAT) as this would facilitate better patient care. They expressed concerns about 

antibody interference, differences between the two assays for individual patient 

results and the limit of detection. We recommended dual reporting for 12 months. 

Investigation of functional sensitivity for both assays, antibody interference will be 

performed and between run variability over 6 months as recommended in the LMPG. 

Conclusion: In management of DTC patients, very good analytical and functional 

sensitivity of the methods are critical to detect small amounts and/or to observe 

minimal changes in Tg concentration. The ICMA could be a suitable alternative as 

it provides a faster TAT and claims equal functional sensitivity to RIA. However, 

the different detection antibody may impact on individual patient results and the 

interpretation thereof. The involvement of physicians in the planning process allowed 

us the opportunity to make additional recommendations for the implementation of the 

proposed new assay. 

A-74 

WHAT ARE THE SERUM TUMOR MARKERS THAT BEST 

IDENTIFY OVARIAN MUCINOUS CANCER? 

C. CAÑAVATE SOLANO, A. GARCIA DE LA TORRE, J. D. 

SANTOTORIBIO, M. I. MORENO GARCIA, F. ARCE MATUTE, S. 

PEREZ RAMOS. Puerto Real University Hospital, Puerto Real (Cadiz), 

Spain, 

Background: Ovarian cancer is the second most common gynecologic malignancy 

and the most common cause of gynecologic cancer death in the United States. 

Mucinous tumors often contain cysts and glands lined by mucin-rich cells and 

constitute 5-20% of ovarian carcinomas. Measurement of the serum concentration 

of the cancer antigen 125 (CA 125) is the most widely studied biochemical method 

of screening for ovarian cancer. Cancer antigen 19.9 (CA 19.9) is a mucin protein 

that may be elevated in ovarian cancer. The aim of this study was to determine the 

accuracy of serum tumor markers for the diagnosis of ovarian mucinous cancer. 

Methods: Samples were collected preoperatively from patients for ovarian mucinous 

tumors. Two categories of patients were included in the analysis: Not ovarian 

cancer (ovarian mucinous cystadenomas and ovarian mucinous borderline tumors) 

and ovarian mucinous cancer. The following serum tumor markers were analysed: 

alpha fetoprotein (AFP), carcinoembryonic antigen (CEA), cancer antigen 15.3 (CA 

15.3), CA 19.9 and CA 125. All serum tumor markers levels were determined by 

electrochemiluminescence immunoassay (ECLIA) in MODULAR E-170 (ROCHE 

DIAGNOSTIC ® ). Statistical analysis was performed using the software MEDCALC ® . 

Results: We studied 102 patients with ages between 15 and 80 years (average = 44 

years). Ninety of 102 patients were not cancer (76 ovarian mucinous cystadenomas 

and 14 ovarian mucinous borderline tumors) and 12 were ovarian mucinous cancer. 

AFP, CEA and CA 15.3 were not statistically significantly different. AUC, cutoff 

value, sensitivity and specificity are shown in the following table: 

(CI: confidence interval) 

Sensitivity Specificity 

AUC (95 % CI) Cutoff 

(95 % CI) (95 % CI) 

0.83 

66.7 % 88,9 % 

CA 125 

59.08 U/ml 

CA 19.9 

(0.70-0.92) (p=0.0016) 

0.82 

(0.69-0.91) (p=0.0024) 

37.21 U/ml 

(22.7- 94.7) 

83.3 % 

(36.1- 97.2) 

(75.9- 96.3) 

79.5 % 

(64.7- 90.2) 

Conclusion: CA 125 and CA 19.9 were the serum tumor markers that showed a higher 

accuracy for the diagnosis of ovarian mucinous cancer. Preoperative CA19.9 and CA 

125 levels can be used to predict whether a suspected ovarian mucinous tumor is 

benign or malignant. 


A19


Automation/Computer Applications 




A-75 

CUSUM-Logistic Regression Analysis of Patient Laboratory Test 

Results for Monitoring Quality Controlr 

V. Gounden 1 , M. L. Sampson1, H. E. van Deventer 2 , A. T. Remaley 1 . 

1 

Department of Laboratory Medicine, Clinical Center, National Institutes 

of Health, Bethesda, MD, 2 Lancet Laboratories, Johannesburg, South 

Africa 

Background: The periodic analysis of quality control (QC) material is the primary 

method for monitoring the analytical performance of most laboratory tests. The main 

drawback of this approach is that test performance is not monitored in the period 

between QC material, which can result in the reporting of a large number of inaccurate 

results until a problem is discovered. The use of QC procedures based on patient test 

results, such as Average of Normals and Bulls algorithm, can help limit this problem, 

but these approaches are relatively insensitive and often require a large number of 

inaccurate test results before a problem can be detected. The objective of this study 

was to develop a new patient based QC procedure for as close as possible the “real 

time” detection of test errors. 

Method: Chem-14 panel results (Na, K, CL, urea, creatinine,HCO3, ALP, ALT, 

AST, glucose, albumin, Ca, total protein, total bilirubin) from a LX20 analyzer 

were collected over a five year period. Non-normally distributed data were log 

transformed. Each test result was predicted from the other 13 members of the panel by 

multiple regression, which resulted in correlation coefficients between the predicted 

and measured result of >0.7 for 8 of the 14 tests. A logistic regression model was 

developed for predicting a systematic proportional bias that utilized the measured test 

result, the predicted result, the day of the week and time of day. Reported test results 

and mathematically transformed values to simulate laboratory errors were used to 

train the logistic regression model. The output of the logistic regression model, which 

varied from 0 to 1, was tallied using a daily CUSUM approach. The desired level 

of error detection was based on CLIA guidelines for total allowable error and was 

set to limit false positives to only once every 10 days. Validation of the model was 

performed using a second independent set of patient data. 

Results: The following are the average run lengths (ARL) before error detection by 

CUSUM-Logistic regression for each analyte: Na 9.5(SD ± 3); K 15.5(SD ±5.5); 

CL 7.6(SD± 1.7); urea 40.3(SD± 23.6); creatinine 18.0(SD± 6.7); HCO3 64.3(SD± 

56.6); ALP 5.9(SD± 1.1); ALT 9.3(SD± 2.8), AST 10.1(SD± 1.8); glucose 5.5 (SD± 

1.4); albumin 27.2(SD± 13.2); Ca 3.9 (SD± 1.0); total protein 18.5(SD± 6.1) and total 

bilirubin 27.1(SD ± 21.6). 

In general, tests that showed a close correlation with another test in the panel had the 

smallest ARL. A few tests,such as albumin which varied greatly depending on the 

patient population (for example critically ill patients), also benefited from inclusion of 

the time of day and day of week into the model. For even those tests with relatively 

long ARL, such as HCO3, the time for error detection would still be typically less than 

the time period between the analyses of QC material for most clinical laboratories. 

Conclusion: A CUSUM-Logistic Regression analysis of patient laboratory data can 

be effectively used for the rapid detection of analytical laboratory errors. 

A-76 

Efficiencies realized 12-months post-implementation of an automatic 

tube sorting and registration system in a core laboratory 

F. Ucar 1 , M. Y. Taslıpınar 1 , G. Ozturk 1 , Z. Ginis 1 , G. Erden 1 , E. Bulut 1 , 

N. Delibas 2 . 1 Diskapi Yildirim Beyazit Training and Research Hospital, 

Department of Clinical Biochemistry, Ankara, Turkey, 2 

Hacettepe 

University Medical School, Department of Biochemistry, Ankara, Turkey 

Backgrounds: Laboratories are centers that have different and hard workload 

throughout the working day to achieve reliable laboratory data. Sample classification 

and registration have been recognized as an important and time-consuming process. 

When considering these processes, particularly higher-volume core laboratories 

have the potential to face with more problems such as need for more staff, delays 

and an increased variety of preanalytical errors. There is an increasing pressure on 

laboratories to automate processes due to intense workload and to reduce manual 

processes and errors. Very few studies to date have focused on the outcomes of 

implementation of automatic tube registration and sorting systems. In the present 

study, we aimed to evaluate the effects of an automatic tube registration and sorting 

system on the improvement of the specimen processing (specimen rejection and/ 

or loss, tubes flow, laboratory productivity, turnaround time (TAT) of test results, 

decreasing human errors). 

Methods: We evaluated an automatic tube registration and sorting system (HCTS2000 

MK2, m-u-t AG, Wedel, Germany) which was designed for clinical laboratories to sort 

closed primary sample tubes in accordance with the barcode information or through 

queries to the LIS. Each tube was separated from the others and uniquely identified 

and sorted into one of the target brings (It sorts up to 2000 tubes per hour). All of the 

estimated data, before (25 Feb 2010-24 Feb 2011) and after (25 Feb 2011-25 Feb 

2012) the implementation of the system were analyzed. TAT, the rate of the number 

of rejected samples and the unrealized samples (samples which had reached to the 

laboratory but were not realized for requested tests due to variable causes such as 

sample sorting errors and mislabeling errors) were compared. The number of tests 

performed in our laboratory in the year prior to the establishment of the system 

was 3.286.346, the number of the patients 457.143, the number of the sample tubes 

820.081, the number of unrealized tests 148.886 (4.5%) and the number of rejected 

samples was 3351 (0.40%) respectively. For 12-months post-implementation of 

the system, the number of tests performed in our laboratory was 4.874.670, the 

number of the patients 459.476, the number of sample tubes 920.152, the number of 

unrealized tests 68.874 (1.4%) and the number of rejected samples was 1661 (0.18%) 

respectively. Approximately 33% decrease was found in TAT after the establishment 

of tube registration and sorting system. The number of rejected samples and unrealized 

tests were significantly decreased. 

Conclusions: By reducing delays and errors in preanalytical processing and sorting of 

samples, significant improvements in TAT and unrealized number of laboratory tests 

were observed after the establishment of the system. Implementation of the system 

also decreased specimen rejection rates. Technological advances in laboratory systems 

have made important differences on laboratory workload and efficiency reducing 

manual processes and errors as well as increasing data reliability. An automatic tube 

registration and sorting system may also be suggested on the improvement of the 

specimen processing in a higher-volume core laboratory. 

A-77 

Detection of tumor cells in body fluids using the automated 

morphological analysis system CellaVision DM96 following the 

automated cell counting by the Sysmex XE5000. 

H. Takemura 1 , Y. Tabe 2 , K. Ishii 1 , K. Kasuga 3 , T. Horii 1 , T. Miida 2 , A. 

Ohsaka 1 . 1 Juntendo University Hospital, Tokyo, Japan, 2 Juntendo University 

School of Medicine, Tokyo, Japan, 3 Cella Vision AB, Lund, Sweden 

Background: Cell enumeration and differential analysis of nucleated cells in body 

fluid is important diagnostic tool for several diseases including cancer. In recent years, 

automated hematology analyzers have been valued as an acceptable alternative to the 

microscopic cell counts of body fluid material. However, the detection of tumor cells 

in body fluids still requires the microscopy-based manual analysis, which is timeconsuming 

and labor-intensive. In this study, we investigated the capability of the 

automated morphological analysis system CellaVision DM96 (DM96; Cellavision, 

Lund, Sweden) to detect tumor cells in body fluids, and further evaluated the efficacy 

of systemic processing of the DM96 following an automated cell counting by the 

Sysmex XE-5000 (XE-5000; Sysmex, Kobe, Japan) for screening of cancer cells in 

body fluids. 

Methods: A total of 61 body fluid samples (pleural fluids 45 and ascitic fluids 16) 

obtained from patients with various cancers were analyzed. For cell enumeration, 

the manual cell counting with hemocytometer was performed. The hematology 

analyzer XE-5000 determined the number of cells with differential counts, including 

polymorphonuclear cells (PMNs), mononuclear cells (MNs), and high fluorescence 

cells (HF-BF) that are corresponding with macrophages, mesothelial cells, and 

tumor cells. For morphological analysis, cytospin slides were prepared with the 

May-Grunwald Giemsa staining method. Manual differential counts (100 cells) were 

performed by two experienced technologists. Subsequently, all slides were analyzed 

by the DM96 with verification by two laboratory technologists (post-classification). 

To detect tumor cells, we reviewed the DM96 overview scanning images of each 

sample. Cytological examination (Papanicolaou stain) was performed for the clinical 

diagnosis of invasion of tumor cells. Pearson’s product-moment correlation coefficient 




test and Spearman’s rank correlation coefficient test were used for statistical analysis. 

This study was approved by the Juntendo University Institutional Review Board and 

performed in accordance with institutional guidelines. 

Results: In the test for accuracy, correlation coefficients between the manual cell 

counting and the XE-5000 showed good results for total cell number (r=0.990), for 

PMNs (r=0.989) and for MNs (r=0.994). For cell differentiation, the DM96 (postclassification) 

resulted in a good correlation to the manual observation (r=0.953). We 

also found a high correlation coefficient between the HF-BF cells % (XE-5000) and 

the non-hematopoietic cells % (DM96) (r=0.975). Cytological examination detected 

tumor cells in 25/61 cases, and tumor cells positive samples showed significantly 

higher HF-BF cells % than negative samples (p=0.01). With regard to sensitivity for 

detecting tumor cells, the manual microscopic observation had a sensitivity of 76%, 

the DM96 automated analysis (post-classification) had a sensitivity of 52%, and the 

review of the DM96 overview scanning images showed the highest sensitivity of 80%. 

Conclusion: The automated image-recognition technology of the DM96 may provide 

satisfactory detection of tumor cells in body fluids. A combination of enrichment with 

the XE-5000 hematology analyzers followed by the DM96 morphologic analysis may 

be an attractive alternative to the manual methods for primary cancer screening in 

body fluids. 

A-78 

Regression, difference graph and mountain plots 

A. Kallner. Karolinska University hospital, Stockholm, Sweden 

Background: Develop additional calculations and visual tools to enhance the 

evaluation of method comparison data. Introduce the concept of an A-zone and B+C 

zones, and the “empirical cumulative frequency” or “mountain plot” (CLSI EP 21) in 

a multifunctional and interactive spreadsheet. 

Methods: Results from a comparison of T4 concentration measurements by two 

methods were displayed in a scatterplot. Data, single or duplicate measurements were 

partitioned in three intervals and the regression estimated in each using ordinary linear 

regression (OLR). This allows the the dataset and/or the differences to be suitably 

truncated. The entire dataset was evaluated by OLR and/or Deming regression. The 

necessary λ-value should be defined according to known or measured (duplicates) 

measurement uncertainty. The distribution of the differences between the methods 

was evaluated as skewness and a statistical significance calculated by Student’s t-test 

and Wilcoxon signed rank test. The absolute and relative differences were shown 

in Bland-Altman-type graphs and with a “tilted mountain plot” superimposed. The 

A-zone could be set to any predefined value for the entire dataset or chosen partitions. 

Results: Comparison of results is often limited to regression analyses, difference 

graphs and a significance test. In this report we introduce a considerable flexibility in 

managing the data, a new use of the mountain plot and interpretation of the difference 

plot and defining acceptable zones as a complement to correlation estimates and risk 

analyses 

Conclusion: A simple and straight forward spreadsheet programming can add much 

to the evaluation and understanding of method comparisons. 

Figure. Difference graph with partitions and limits of differences and the “tilted” 

mountain plot 

A-80 

Integration of an Automated Sample Preparation Workstation for the 

Analysis of Immunosuppressant Drugs by LC-MS/MS 

R. Zhang 1 , M. Jarvis 2 , A. Taylor 2 . 1 Beckman Coulter, Indianapolis, IN, 2 AB 

SCIEX, Concord, ON, Canada 

Background:For Research Use Only. Not For Use In Diagnostic Procedures. 

Liquid chromatography-tandem mass spectrometry technology provides laboratories 

with a powerful tool for robust, accurate, sensitive detection of a wide variety of 

analytes. Method automation reduces the possibility of human error at many different 

stages, including preparation of calibration standards, sample preparation, and 

data processing. The objective of this work was the automation of an LC-MS/MS 

method for the analysis of the immunosuppressant drugs Tacrolimus, Cyclosporine 

A, Sirolimus, and Everolimus, to eliminate human error, increase reproducibility, 

eliminate subjectivity during data processing, and save time. 

Methods:An LC-MS/MS method for the analysis of immunosuppressant drugs 

was developed, making use of commercially available whole blood calibrators and 

controls. In addition to manual preparation, all steps of sample processing could 

be automated using a BioMek NXP platform. The sample preparation consisted of 

a simple protein precipitation using ZnSO4 solution. After centrifugation, the clear 

supernatant was injected directly onto the LC-MS/MS system. Samples were loaded 

in test tube format and the final samples were prepared in a 96-well plate format. The 

LC-MS/MS data acquisition, processing, and reporting were automatically performed 

using the Cliquid® software. 

Results:The reproducibility of the automated protocol versus manual protocol 

was assessed by preparing and analyzing replicates of each calibration standard. 

The measured CVs were at least equivalent between protocols over the entire 

concentration range covered by the assay. The method displayed good linearity for all 

four immunosuppressant drugs, with R>0.999. 

Conclusion: The automation of an LC-MS/MS method for the analysis of the 

immunosuppressant drugs Tacrolimus, Cyclosporine A, Sirolimus, and Everolimus 

was achieved. The automation eliminates human error, increases reproducibility, 

eliminates subjectivity during data processing and saves time. 

A-81 

A Novel Personalized Delta Check Approach 

T. Kampfrath, J. Miller. University of Louisville, Louisville, KY 

Introduction: Inaccuracies in specimens of patients may lead to misdiagnosis and 

inappropriate therapy. The primary purpose of a delta check is to detect misidentified 

specimens. The delta check procedure compares the change in concentration of an 

analyte with a delta check limit (DCL) for that analyte. A change greater than the 

DCL sets a delta check flag for that analyte and will be further investigated by the 

technologist. This procedure is called univariate (multianalyte) delta check (UDC) 

and generates many false positive flags. DCL’s are typically taken from the literature 

independent from the patient population served by the laboratory. Here, we describe 

a novel software tool that customizes the DCL for historical patient data of that 

particular laboratory. 

Methods: The software accepts BMP or other laboratory results from an output 

file from the LIS, or from manual input. These results are assumed to be correctly 

identified and free of interferences and contamination. Next, it generates a set of 

misidentified samples by intentionally pairing results from two different patients. 

Additionally, for each analyte individually, the program determines which delta 

check type (absolute change, percent change, rate of absolute change, or rate of 

percent change) best differentiates correctly identified and misidentified samples for 

that analyte. The software uses the optimum delta check type for each analyte and 

calculates the sensitivity, specificity and efficiency for each analyte alone and in all 

255 possible combinations. 

Results: The output of the software is a table of the most efficient delta check 

combinations along with a comparison to the laboratory’s current delta-check system. 

Furthermore the software possesses a unique feature that allows the user to determine 

the maximum number of flags the laboratory can handle per day or per shift and 

adjusts the DCL accordingly. 


A21



Conclusion: Here, for the first time we are able to allow the laboratory director to set 

the DCL according to the laboratory’s patient population and staffing constraints. This 

novel software tool objectively optimizes the Delta Check procedure for a laboratory 

and can save time and money by reducing the number of false positive delta check 

flags without sacrificing sensitivity. 

A-82 

Workflow Process Improvement and Quality in Biochemistry Lab: 

DSM Westman Labs’ Journey 

B. Olyarnyk 1 , C. Brown 1 , C. Bauman 1 , P. Payette 2 , J. Korbo 2 , A. Sokoro 1 . 

1 

Diagnostic Services of Manitoba - Westman Laboratory, Brandon, MB, 

Canada, 2 Roche Diagnostics, Laval, QC, Canada 

Introduction: The Institute of Medicine’s (IOM) healthcare domains for assessment 

of laboratory quality provides attributes of a laboratory test: safe, effective, patientcentered, 

timely, efficient and, equitable. Laboratories must aim to meet these criteria. 

Automation, particularly, preanalytical automation provides the opportunity to meet 

these criteria. At Diagnostic Services of Manitoba (DSM) we have engaged ourselves 

to meet this obligation in our service. Westman lab is one of DSM’s tertiary care labs 

that also act as a reference lab. The Biochemistry section processes approximately 

752,000 samples annually (~2.5 million tests). About 20% of the samples are from 

the 150-bed attached hospital: the rest are referral work. Most of the specimens arrive 

throughout the end of the dayshift and throughout the evening shift. Approximately 

50% of these samples are destined for the automated analyzers, which includes two 

cobas 6000 lines served by a Modular Pre-Analytics (MPA) preanalytical system and 

one Integra 800. 

Objective: To redesign and implement the biochemistry lab workflow processes 

utilizing LEAN concepts. 

Methods: Workflow mapping of the biochemistry lab and specimen management area 

was done leading to analysis of inefficiencies in the outpatient testing process. All of 

the processes were then streamlined to conform to LEAN concepts. This included 

protocols for telephone handling, sample registration and triaging, insufficient 

volumes, acceptable container types, and staffing. Outcome measures that were used 

included turnaround time (TAT), sample rejection rates, testing volumes, and staff 

workload/satisfaction. 

Results: TAT improved five-fold and NSQ by over nine-fold; all this despite a 

challenging service demand of 30,000 samples per month on the MPA. Employee 

satisfaction improved among the second shift as the workload evened out. 

Conclusion: Preanalytical automation and streamlining of workflow processes 

utilizing LEAN concepts improves laboratory efficiency and quality. Those 

improvements facilitate the provision of services with attributes that meet the Institute 

of Medicine’s (IOM) healthcare domains for laboratory quality. 

A-83 

A Design-of-Experiment Approach to the Optimization of Automated 

Sample Preparation of Clinical Samples 

R. H. Wohleb, R. Geyer, M. Svoboda, K. Adelberger, G. Burssens. Tecan 

Schweiz AG, Männedorf, Switzerland 

Background: Clinical analytes from biological fluids must be separated from the 

sample matrix prior to a multi-parameter LC-MS/MS analysis in order to minimize the 

deterioration of chromatographic separation or ionization of the analytes. As a simple 

and easy-to-use tool for sample preparation, the AC Extraction Plate was developed 

which separates Immunosuppressants and/or other analytes from the sample matrix. 

The purifying process requires the use of three liquid mixtures for extraction, wash 

and elution. A 5 to 10 min plate shaking process replaces cumbersome centrifugation/ 

evacuation steps. The “pipette-and-shake” workflow allows for the efficient 

optimization of the parameters involved in the sample preparation procedure with a 

liquid-handling workstation using a Design-of-Experiment (DoE) approach. 

Objective: It is imperative that a proper pH be combined with solvents, modifying 

salts and other reagents that enable cell lysis and minimize analyte protein binding 

while preventing protein precipitation. The object of this study was to develop an 

automated approach to the optimization of these process parameters and workflow 

using Design-of-Experiment (DoE). 

Materials and instrumentation: 

1. Absorption Chemistry coated 96 well plate _ Tecan AC Extraction plate® 

2. Freedom EVO® Liquid Handling workstation (TECAN, Switzerland) equipped 

with a plate shaker (Te-Shake) 

3. Shimadzu Prominence HPLC connected to an AB SCIEX 4000 QTRAP®. 

Methodology: The four Immunosuppressants, Cyclosporine D, Everolimus, Sirolimus 

and Tacrolimus were determined quantitatively from whole blood extracts by LC-MS/ 

MS. The extraction step is strongly dependent on the pH and the organic content of the 

extraction solvent. The ratio of aqueous modifier to organic solvent(s)was optimized. 

The workflow using the extraction plate was performed in the following way: 

1) A modifier was mixed with an organic solvent. 

2) This mixture was combined with serum containing the analyte of interest in the well 

of the Extraction Plate. 

3) After extraction by orbital shaking of the plate, the solution was removed completely 

and a wash solution was added to each well. 

4) After the wash, the analytes were eluted with an elution solvent and analyzed 

quantitatively by LC-MS/MS. 




Results:16 Variations of 5 parameters (3 salts and 2 solvents) were used to determine 

their influence on the MS/MS peak areas of the four Immunosuppressants when 

from spiked whole blood. Enhancement of the signal intensity and/or signal_to-noise 

values (S/N) for the Immunosuppressant extraction was determined for the chemical 

parameters Acetonitrile, LiCI, Ascorbic acid, NH4OH, Carbonate, Isopropanol. A 

negative influence was found for Methanol, Ethanol, Formic acid, NaCholate and 

Citrate. Ammonium acetate and GDTA were rather neutral. 

Conclusions: The automated “pipette-and-shake” workflow allowed for the efficient 

DoE optimization of the parameters involved in the sample preparation procedure. 

Using this approach with the extraction plate, a set of 15 parameters (e.g., pH, salt, 

solvent) could be screened with only 4 experiments without changing the protocol 

for the liquid handling workstation. An optimized mixture for the extraction of 

Immunosuppressants Cyclosporine D, Everolimus, Sirolimus and Tacrolimus 

from whole blood was selected. An improved sensitivity for all four analytes of 

approximately 3-4 fold was achieved by using the Design-of-Experiment (DoE) 

approach. 

A-84 

Direct Sampling From Pediatric Collection Tubes on the Abbott 

Architect Clinical Chemistry Instruments 

M. S. Warner 1 , C. Wilson 2 . 1 Winston-Salem State University, Winston- 

Salem, NC, 2 UNT, Denton, TX 

Background The ability to sample directly from pediatric collection tubes eliminates 

the need to transfer small volume samples to sample cups for testing and maintaining 

sample identity integrity. A feasibility study was performed to find an acceptable dead 

volume for several peditube types investigated. 

Method Testing was performed using five typical, readily available pediatric collection 

tubes, (four contained Lithium Heparin), and three sample tubes with false bottoms. 

Architect sample cups were tested as controls. Assays were AlbG, CaC, GluC, Na-C, 

K-C, Cl-C and TP with 2.0uL to 15.0uL sample volumes. The initial sample volume 

was based on each assay’s insert, with an 8uL sample overaspiration volume (23uL 

for ISE assays), plus a 50uL dead volume. Assays were ordered with 5 reps per assay. 

BioRad LiquiChek Level 2 was used for sample and was pipetted directly into the 

tubes. The weight of each tube was recorded before and after sample was added. 

Architect sample cup and false bottom tubes were placed directly into sample carriers. 

The remaining five pediatric tubes were placed in Becton-Dickinson tube extenders 

in sample carriers. After testing, tubes were weighed again and the weight recorded. 

Volume remaining in tubes was calculated from the density of the sample. Tubes with 

aspiration errors before 5 reps completed were re-tested with increased 10uL dead 

volume. Process continued until 5 reps for each assay completed with acceptable 

results. Study was repeated with a new sample volume based on increased dead 

volume. After the run with five replicates completed successfully, the process was 

repeated in single replicates for all tubes without aspiration errors. The tubes were 

re-weighed and weights recorded. Process was repeated until an aspiration error was 

obtained for each tube. The volume remaining in the last tube with acceptable results 

was calculated from the density of the sample and the dead volume for each tube 

determined. Pediatric collection tubes used were Becton Dickson BD 365958, Becton 

Dickson BD 365987, Greiner 450479, Sarstedt 16.443.100 and Terumo T-MLHG. 

False bottom tubes were Sarstedt 60.613.010, Sarstedt 60.614.010 and Sarstedt 

60.617.010. 

Results This study was successful if all five replicates initially run completed without 

any aspiration errors and with acceptable results. Six replicates for each assay, a total 

of 42 tests, completed without any aspiration errors and with acceptable results. 

Suggested dead volumes for the tubes were determined to be 85uL for BD-365958, 

93uL for BD-365987, 75uL for Greiner 450479, 77uL for Sarstedt 16.443.100, 78uL 

for Terumo T-MLHG and 74uL for Sarstedt 60.613.010, Sarstedt 60.614.010 and 

Sarstedt 60.617.010. The gel layer in the pediatric collection tubes and the shape of the 

false bottom tubes contributed to the dead volume required to get acceptable results. 

Conclusion An acceptable dead volume can be assigned for each of the specific tube 

types that were investigated. The use of validated peditubes allows direct sampling of 

critical volume samples, eliminating the manual transfer step and the possibility of 

patient misidentification and potential labeling errors when the sample is transferred 

from a peditube to a sample cup. 

A-85 

Validation of DRG:Hybrid XL, a Fully Automated Random Access 

Analyzer for Immunoassays and Clinical Chemistry, for 17-OH 

Progesterone 

M. Herkert 1 , S. Passig 1 , B. Uelker 1 , T. Dudek 1 , C. Lauf 1 , H. Vaupel 1 , F. 

Becker 1 , R. Hellmich 1 , C. E. Geacintov 2 . 1 DRG Instruments GmbH, 

Marburg, Germany, 2 DRG International Inc., Springfi eld, NJ 

The DRG:HYBRID-XL ® Analyzer is an innovative and unique instrument that 

allows the simultaneous measurement of up to 20 samples, with up to 40 different 

immunoassays and clinical chemistry parameters including turbidimetric tests. After 

loading of ready-to-use reagent cartridges, typical assay times range from 10-90 

minutes. The barcoded master curve can be adjusted by 2-point recalibration. 

Objective: To validate the Hybrid XL, the steroid hormone 17-α-Hydroxyprogesterone 

(17-OHP) was analyzed in human serum. 17-OHP is produced by both the adrenal 

cortex and gonads. In adult non-pregnant women, 17-OHP concentrations vary over 

the menstrual cycle with concentrations being higher in the luteal phase than in the 

follicular phase. The hormone is of clinical interest because it is released in excess 

in congenital adrenal hyperplasia, and is moderately elevated in 11-β-hydroxylase 

deficiency. 

Methodology: The 17-OHP assay is a solid phase enzyme-linked immunosorbent 

assay, based on competitive binding. 25 μl of serum are incubated for 1 hour at 37°C 

in a coated well together with 200 μl of enzyme conjugate. Thereby, endogenous 17- 

OHP of a patient sample competes with a 17-OHP-horseradish peroxidase conjugate 

for binding to the coated antibody. Unbound components are washed off, and 200 μl 

of TMB substrate is added to the well to start the color reaction. After 30 min, 150 μl 

TMB are transferred from the well to a cuvette, and the optical density is measured 

at 645 nm (450 nm reference wave length). Quantification is done based on a master 

standard curve that is barcoded on the kit box. 

Validation: 17-OHP can be quantified from serum and plasma (EDTA, heparin, 

citrate) on the DRG:Hybrid XL. The dynamic range of the assay is between 0.11-20 

ng/mL. The sensitivity was determined according to EP-17A. The limit of detection 

is 0.11 ng/mL and the limit of quantification is 0.18 ng/mL. The mean within-run 

precision (determined with 6 samples covering the measuring range of the assay) is 

3.98% (n=16; range from 2.65-6.23%). The mean between-run precision is 9.16% 

(16 different runs; n=32; range from 7.05-14.98%). The mean recovery is 101.1% 

(n=5; range from 88.4-114.9%). The mean linearity is 100.9% (n=5; range from 76.7- 

111.2%). Cross-reactivity was evaluated by determining the effective concentration 

at 50% displacement of various compounds that are structurally related to 

17-α-Hydroxyprogesterone. Cross-reactivity is below 0.01% for Estriol, Aldosterone, 

Androstenedione, Testosterone, DHEA, DHEA-S, Prednisone, Cortisol, and Estradiol. 

Cross-reactivity for Progesterone was 1.2%. Bilirubin and Hemoglobin (up to 0.5 mg/ 

mL) and Triglycerides (up to 30 mg/mL) have no influence on the assay results. The 

accuracy of the 17-OHP assay on the DRG:Hybrid XL instrument was determined 

by comparison with 17-OHP manual Elisa (EIA-1292) from DRG Instruments. The 

correlation coefficient is 0.998 (n=118; y=1.053x; sample concentration, range 0.11- 

19.86 ng/mL). Normal values range between 0.12-2.49 ng/mL (males) and 0.06-3.93 

ng/mL (females). 

Conclusion: The performance of new DRG Hybrid XL analyzer to reproducibly 

quantify 17-OHP is in good agreement with the manual ELISA from DRG Instruments. 

A-86 

Automation in the pre analytical phase and sample flow: Gains in 

productivity and safety in a Brazilian clinical laboratory 

F. C. S. Roseiro, A. R. Bertini, C. Pereira, C. A. O. Galoro, J. Y. Ferraro, C. 

C. T. Silva. DASA, São Paulo, Brazil 

Introduction: The workflow of samples within the pre-analytical laboratory stage 

is already well defined. However, laboratory workloads are constantly growing at 

the same time that laboratories are under pressure to contain or lower costs. The 

sample reception department of CientíficaLab Laboratory (DASA), business unit that 

provides laboratory services to the Brazilian Public Market, received in March 2010 

almost 25,000 tubes per day, with about 2 million tests to be processed in the lab. This 

department had at that time 34 FTEs, with a productivity indicator of 56,923 tests 

/ FTE / month. All activities were processed manually, including bar code reading, 

sorting and aliquoting. A decision to improve and automatize most of these tasks was 

made. 


A23



Objective: To present the productivity and quality gains in the sample reception 

department after the introduction of automation systems 

Methods: The methodology used in March 2010 was 100% manual. The bar code 

of the first patient sample was read and all secondary labels were printed, with the 

frequency of two or more tubes from the same patient. A high number of aliquots 

(approx. 98,000 per month) was necessary due to the lack of an integrated and smart 

sample flow inside the lab. 

The introductions of two automated technologies in 2011 and 2012 increased the 

productivity and efficiency of the lab: 

Implementation of Siemens LabCell in September 2011 and of the Sorter MUT HCTS 

2000 in January 2012. 

Results: The introduction of the new productivity tools resulted in the improvement 

of many performance indicators. We could also observe a much greater satisfaction of 

the staff with the current process design. The main results were: 

1) Decrease in the number of daily stored tubes by 400-500 units because of a better 

sample flow and integration of the analytical instruments; 

2) Reduction in the numbers of pre analytical errors by 60%; 

3) Decrease in absenteeism of the staff and increase in productivity by 26%; 

4) Improvements in the sample traceability between departments; 

5) Drop in the number of aliquots by 52%; 

6) Safety in the process of receiving and handling the samples. 

Conclusion: Productivity measured in August 2012 increased by 26%, and the 

number of tests / FTE / month reached 77,090 in the sample reception department. 

It was possible to decrease the number of repetitive tasks, reducing the number of 

human errors and increasing the staff satisfaction and safety. 

A-87 

VALIDATION OF URINE PARAMETERS IN THE SYSMEX UF1000 

IN A BRAZILIAN LABORATORY 

E. M. Oliveira, R. A. Cavalcanti, L. L. Jaques, S. B. Ferreira, R. Balherini, 

M. d. Menezes, S. D. S. Vieira, D. R. B. Mansur, M. Molina, N. Z. Maluf, 

C. F. D. Pereira. DASA, Barueri, Brazil 

Background: The urinalysis department of DASA SP core lab implemented in 2012 

the Sysmex UF1000 analyzers for its routine urine tests. The new flow was designed 

to sequentially process biochemical analysis in the Roche Urisys 2400 equipment 

and urine sediment analysis in the UF1000. The methodology of the last instrument 

is to count the urinary cells and elements by flow cytometry. It performs the analysis 

and counting of erythrocytes, leukocytes, epithelial cells, cylinders, crystal, mucus, 

sperm, bacteria and yeasts. We performed the validation of this equipment using 

the following protocol: linearity study of the erythrocytes, leukocytes and bacteria 

measurements; evaluation of the reliability index for positive samples; carry-over; 

repeatability and reproducibility. 

Objective: Validation of parameters analyzed in the equipment Sysmex UF 1000. 

Methods:To assess linearity, we used three samples with different results to study the 

linearity of erythrocytes, leukocytes and bacteria. For the evaluation of the reliability 

index, 40 samples were studied and compared with the Neubauer chamber microscope 

analysis, which was the methodology previously used by the laboratory. To assess 

the Carry-over, high and low samples were used as recommended by the quality 

commission of our laboratory and to review repeatability, we used two samples, one 

with normal result and another with altered result, each one analyzed 20 times in 

a single instrument. The evaluation of reproducibility was done with two levels of 

controls, processed 20 times each one in 5 consecutive days, four times a day. 

Results and Conclusion: The verification of linearity showed coefficient of 1.0 for 

erythrocytes, 1,0 to leukocytes and 1,0 for bacteria; we concluded that the linearity 

obtained a good performance. In the assessment of the reliability index of positive 

samples, we observed a concordance of 88.7% for the erythrocyte; a concordance of 

95.2% for leukocytes; a concordance of 88.5% for the presence of epithelial cells, 

88,6% for cylinders; 88,6% for crystals, 99.3% for yeast, 99.3% for presence of 

spermatozoa and 56.4% for bacteria. We concluded that we obtained an excellent 

agreement according to Kappa analysis. In the evaluation of carry-over, all analyzes 

of leukocytes, erythrocytes and bacteria had obtained results within acceptable limits. 

For the repeatability we observed CV values between 1.64 and 8.20. We noted that 

the highest CVs were related to red blood cell count. Evaluating the reproducibility 

we observed the CV values between 1.54 and 8.41, very similar to the repeatability 

results. However, the larger CVs for reproducibility were related to bacteria count. 

The equipment UF1000 has been validated according to our procedures. 

A-88 

Performance Evaluation of a New Albumin BCP Assay on the High- 

Throughput ADVIA Chemistry Systems 

R. Jacobson, S. Cherian, J. Dai. Siemens healthcare Diagnostics, Tarrytown, 

NY 

Background: Albumin is the major serum protein in normal individuals. It is 

synthesized in the liver and has a half-life of 2 to 3 weeks. The main biological 

functions of albumin are to maintain the water balance in serum and plasma and to 

transport and store a wide variety of ligands, e.g. fatty acids, calcium, bilirubin and 

hormones such as thyroxine. Serum albumin measurements are used in the diagnosis 

and treatment of numerous diseases primarily involving the liver and kidneys. 

The Albumin BCP procedure is based on the binding of bromocresol purple specifically 

with human albumin to produce a colored complex (1). Due to an enhanced specificity 

of BCP to albumin this method is not subject to globulin interference (2). A new 

assay* for albumin BCP on the automated ADVIA ® Clinical Chemistry Systems is 

under development. The objective of this study was to evaluate the performance of 

this new Albumin BCP (ALBP) assay on the ADVIA Chemistry Systems. 

Materials and Methods: In the ADVIA Chemistry ALBP assay, diluted sample is 

reacted with bromocresol purple (BCP) dye to form an albumin-BCP complex that 

is measured as an endpoint reaction at 596/694 nm. This assay uses an ADVIA 

Chemistry albumin calibrator. The performance evaluation in this study included 

precision, interference, linearity, and correlation with the Siemens ADVIA Dimension 

Albumin BCP assay. Data were collected for all ADVIA Chemistry Systems (ADVIA 

1200, ADVIA 1650, ADVIA 1800, and ADVIA 2400), which use the same ADVIA 

Chemistry ALBP reagents, ADVIA Chemistry albumin calibrator, and commercial 

controls. 

Results: The imprecision (%CV) of the ADVIA Chemistry ALBP assay with twolevel 

commercial controls ranging from 2.6 to 4.0 g/dL (n = 80), each measured 

over 20 days on all systems, was less than 1.2% (within-run) and 2.5% (total). The 

analytical range of the new assay was from 0.6 to 8.0 g/dL. The assay correlated 

well with the Siemens Dimension albumin assay: Y (ADVIA Chemistry) = 0.99x 

(Dimension albumin) + 0.05 (r = 0.99; n = 69; sample range: 0.9 -7.8 g/dL). The new 

assay also showed no interference at an albumin level of ~3.3 g/dL with unconjugated 

or conjugated bilirubin (up to 60 mg/dL), hemoglobin (up to 500 mg/dL), and lipids 

(Intralipid, Fresenius Kabi AB) up to 525 mg/dL. Minimum reagent on-system 

stability and calibration frequency were 50 days with a reagent blank measurement 

of every 30 days. 

Conclusion: The data demonstrate good performance of the Albumin BCP assay on the 

high-throughput ADVIA Chemistry Systems from Siemens Healthcare Diagnostics. 

* Under development. Not available for sale. 

Reference: 

Louderback A, Measley AH, Taylor NA. A new dye-binder technique using 

bromocresol purple for determination of albumin in serum. Clin Chem 1968; 14: 793- 

4. Brackeen GL, Dover JS, Long CL: Serum albumin. Differences in assay specificity. 

Nutr Clin Pract 4:203-205, 1989 

A-89 

Evaluation of 34 parameters on the multiparameter analyzer AU5811® 

m. fonfrede, S. Abdou, D. Bonnefont-Rousselot. pitie salpetriere hospital, 

paris, France 

Background: As a result of major reorganisation of the practice of Medical Biology 

in France, Clinical Chemistry laboratories have to manage a high number of patient 

samples while maintaining the analytical quality of results. High throughput analyzers 

are thus required for new installations. The Clinical Chemistry laboratory of GH Pitié 

Salpêtrière Charles Foix is facing such a challenge, which is why we evaluated the 

overall analytical performance and practicality of the Beckman Coulter AU5811 

analyzer with special attention to throughput and turn-around time. 

Methods: Between the beginning of December 2012 and the end of January2013 

we evaluated 34 parameters: 26 serum tests, including 9 specific proteins, and 8 

urine tests including microalbuminuria. Quality controls (2 to 3 levels) were used 

to estimate within-run and total precision. Patient samples obtained after routine 

analysis were used for studies on linearity, cross-contamination (tested on potassium 

and CK) and the usual interferences associated with haemolysis, icterus and turbidity. 

Correlation on patient samples from the routine laboratory practice was performed 

in comparison with the Roche Modular P for serum chemistry and urine tests, Roche 




Integra 400 for serum proteins, and Thermo Scientific Konelab with DiagAm reagent 

for microalbuminuria. Valtec protocol designed by the French Society of Clinical 

Biology was used for comparison analysis. 

Results: For within-run precision using QC materials (n=30) all 93 coefficients of 

variation were below 2 %, 68 % being lower than 1 %. For total precision (n=30), CVs 

for serum chemistry parameters were below 2.5 % except for CO2 and creatinine. 

Urine chemistry parameters showed CVs below 2.5 %, and urine microalbuminuria 

CV was below 3.7 %. There was no significant cross-contamination between 

samples, and the method linearities were consistent with the manufacturer’s claims. 

Interferences were mainly associated with icterus: above a bilirubin concentration of 

400 μmol/L a decrease of recovery was observed for creatinine (Jaffe), total protein 

and cholesterol. Grossly haemolysed samples showed decreased bilirubin recovery. 

Correlation studies were very satisfactory; some differences were observed with urine 

protein results, but this is due to the well-known interference of some polypeptidebased 

plasma expanders. Time for obtaining the results of 900 tests (9 parameters 

on 100 samples) was 36 min. 06 sec., starting from stand-by. Turnaround time (TAT) 

for an emergency sample with 7 tests was 11 min. when the analyser was in routine 

operation. 

Conclusion: The analytical features and the throughput of the AU5811analyser make 

it suitable for a laboratory dealing with a large number of samples and looking for fast 

TAT for emergency analysis. 

A-90 

Throughput Evaluation of ACCELERATOR p540 Perianalytical 

Sample Processor using Primary and Secondary Aliquot Samples 

A. DeFrance 1 , J. Lucio 1 , K. Reed 1 , Y. Smith 1 , D. Overcash 2 . 1 Abbott 

Laboratories, Irving, TX, 2 Abbott Laboratories, Abbott Park, IL 

Introduction: The ACCELERATOR p540 is a fully automated perianalytical sample 

processor that performs sample loading and identification, decapping, aliquoting, 

and sorting operations. The p540 consists of two managed integrated modules. The 

aliquoter module has aliquoting and sorting capabilities and the sorter module has the 

capability of sorting into preconfigured instrument specific racks. Primary tubes are 

pre-loaded into five position racks and introduced to the aliquoter. The primary sample 

tubes and aliquot samples are sorted to the Aliquoter and /or connected Sorter module. 

The objective of this study was to measure the p540’s throughput per hour of primary 

collection tubes and of various aliquot sampling profiles. 

Methodology: The p540 was programmed using an LIS to process an assortment of 

capped primary collection tubes and aliquots. The throughput in terms of number of 

tubes processed per hour was measured. Variations were ordered calling for one, two, 

or three aliquots from the primary tube. In one experiment, sample tubes were sorted 

to the Sorter Module connected to the Aliquoter Module via a bridge connection. 

In a second experiment, all tubes were sorted to the Aliquoter Module secondary 

sorting garage. The p540 can be configured for either path or a combination of both 

for maximum tube throughput. 

Results: The table summarizes the throughput results for the various combinations of 

primary tubes, aliquots, and processor paths. 

Tube Throughput Under Various Workload Conditions 

1 Primary tube + 1 1 Primary tube +2 

Aliquot 

Aliquots 

All 

All Tubes All Tubes All Tubes 

Tubes 

Sent to Sent to Sent to 

Sent to 

Secondary Sorter: Secondary 

% Aliquots Sorter: 

Garage: Total Garage: 

Total 

Total No. of No.of Total No. of 

No.of 

tubes/hr tubes/hr tubes/hr 

tubes/hr 

1 Primary tube + 3 

Aliquots 

All Tubes 

Sent to 

Sorter: 

Total 

No.of 

tubes/hr 

All Tubes 

Sent to 

Secondary 

Garage: 

Total No. of 

tubes/hr 

0 483 490 483 490 483 490 

10 529 534 517 558 538 589 

20 572 562 543 603 565 691 

30 575 565 551 658 536 713 

50 592 637 566 756 580 708 

70 614 722 578 775 592 694 

100 642 862 597 779 611 697 

Conclusion: The p540 significantly increases workflow efficiency as a standalone 

sample processor as demonstrated by this throughput study. Utilizing a LIS, 

approximately 500 primary tubes can be processed with increasing efficiency 

as the number of aliquots increase. This study demonstrates the benefit of sorting 

tubes directly to analyzer specific racks while maintaining satisfactory throughput. 

The p540 Aliquoter and Sorter Modules provide sorting capabilities as desired for 

optimum efficiency. 

A-91 

Optimization of sample workflow with focus in the pre-analytical 

phase in a reference laboratory in Brazil 

L. G. S. Carvalho 1 , C. Pereira 2 , A. Bertini 2 , F. E. Pereira 1 , G. Ludovico 1 , J. 

A. D. Maciel 3 , T. P. Souza 3 . 1 DASA, Cascavel, Brazil, 2 DASA, São Paulo, 

Brazil, 3 DASA, Rio de Janeiro, Brazil 

Background: The workflow of samples within the pre-analytical laboratory stage is 

already well defined. However, laboratory workloads are constantly growing at the 

same time that laboratories are under pressure to contain or lower costs. In addition to 

that, it is not always available sorting automation instruments to meet adequately and 

timely the distribution process and all the variety of sample recipients demanded for 

sorting. The causes can vary from tubes standardization (difficult to obtain in reference 

labs) to demand fluctuation (due to commercial or seasonal reasons), common in 

reference labs routine. When these variables are present, sample flow is less efficient, 

increasing materials and employees cost, as well as arising potential human errors. 

Alvaro laboratory receives around 50.000 tubes a day only for the serum work area 

tests and provides a very important attribute to its customer: single tube submission of 

the tests, what makes the sorting process a challenge for the lab. The aim of this study 

is to present the tools and processes developed to achieve excellence and efficiency in 

the pre analytical phase of a large and differentiated reference lab. 

Methods: New setting rules for sample distribution (sorting) and RSD samples flow 

(RSD work cycle tray creation) were proposed within the pre analytical system and 

was implemented via IT solution, allowing the integration between three lab sectors 

of higher sample volume (Biochemistry, Immunology and Immunochemistry). This 

integration was established based in the criteria of speed, capacity and throughput, 

together with the institution of a tube “transfer” flow between these areas. This 

new procedure simplified the analytical flow and enabled the generation of fewer 

aliquots, giving preference to route the single tube. The labor-intensive sorting and 

aliquoting practice was dedicated only to manual tests or specific routines, which 

lead to standardization of manual distribution, compared to those used in automated 

distribution (RSD). These rules were customized according to the lay out and 

instrument design of Alvaro Laboratory. 

Results: With the implementation of the optimized manual and RSDs sorting process, 

we obtained in the period of June 2011 to June 2012, a saving of 112,000 aliquoting 

tubes, decreasing the overall aliquoting percentage rate from 16.7% to 5.5% and 

improving the patient / Aliquot rate from 5.96 to 18.34. 

Conclusion: This project allowed quantitative and qualitative gains that conducted 

the lab to improvements in productivity, cost and turnaround time for the sorting 

process, with positive impact on key performance indicators. 

A-92 

Overutilization of Hemoglobin A1c and Serum protein Electrophoresis 

Tests in a Large Tertiary Hospital 

M. Fenelus, T. C. Brandler, L. Bilello, L. K. Bjornson. North Shore 

University Hospital Laboratory, Manhasset, NY 

Introduction: Under the new Healthcare Reform Act, laboratory professionals are 

expected to review ordering patterns for clinical laboratory tests to ensure appropriate 

and efficient use of laboratory resources. Inappropriate ordering practices contribute 

to the high cost of healthcare. It is incumbent upon members of the laboratory to work 

with their clinical colleagues to achieve appropriate utilization of laboratory tests. 

Objective: To review utilization of two laboratory tests, Hemoglobin A1c (HbA1c) 

and Serum Protein Electrophoresis (SPEP) over a 6 month period. 

Methods: A retrospective computerized query of our clinical data repository was 

performed to document all HbA1c and SPEP tests performed from January to June 

2012 for a large tertiary care hospital in central Long Island, NY (North Shore 

University Hospital). HbA1c test results totaling 4,736 from 3,940 patients and 

SPEP test results totaling 272 from 256 patients were examined. This study examines 

utilization of HbA1c and SPEP tests, which are usually ordered once per admission. A 

second order for the SPEP test within 7 days and HbA1c within 30 days is considered 

overuse in our study. 

Results: Review of the HbA1c data showed 415 out of a total of 3,940 patients had 

two or more HbA1c ordered within one month which confers a 10.5% overutilization 

for this test. Review of SPEP data showed more than one SPEP ordered within the 

same week for 9 out of 256 patients, which confers a 3.5% overutilization for this test. 


A25



Conclusion: Review of the utilization of HbA1c and SPEP in our institution 

demonstrated overutilization of 10.5% and 3.5% occurred for HbA1c and SPEP, 

respectively. For HbA1c most of the duplicate orders occurred on the same day or 

within two consecutive days. The probable explanation for this is that two different 

physicians independently ordered the test unaware that it had already been ordered. 

An alternate explanation, that the physician was suspicious of the result and reordered 

the test for confirmation, is much less likely considering the time span of one to 

two days. These percentages represent overutilization of these tests that could be 

prevented most directly by adding software or intelligent rules to the laboratory or 

hospital information systems alerting physicians to previous orders in order to avoid 

duplication. 


Molecular Pathology/Probes 





A-93 

Rapid and Cost Effective Measurement of Circulating Cell Free Graft 

DNA for the Early Detection of Liver Transplant Rejection 

J. Beck 1 , S. Bierau 1 , S. Balzer 1 , R. Andag 2 , P. Kanzow 2 , S. Hennecke 1 , J. 

Schmitz 1 , J. Gaedcke 3 , O. Mörer 4 , J. Slotta 3 , P. D. Walson 2 , O. Kollmar 3 , 

M. Oellerich 2 , E. Schütz 1 . 1 Chronix Biomedical, Göttingen, Germany, 

2 

Dept. Clinical Chemistry, University Medicine, Göttingen, Germany, 

3 

Transplantation Surgery, University Medicine, Göttingen, Germany, 

4 

Dept. Anesthesiology, University Medicine, Göttingen, Germany 

Background: Cell free DNA (cfDNA) from grafts in the circulation of transplant 

recipients is a potential rejection biomarker. Its usefulness was shown in heart 

transplantation during the maintenance phase, using chip and massive parallel 

sequencing of donor and recipient DNA. Major drawbacks of such methods are high 

costs, long turnaround and need for donor DNA. We aimed to develop a method that 

overcomes these obstacles. 

Methods: Plasma samples from four patients soon after liver transplantation (LTx) 

and from 11 stable LTx patients were used. Single Nucleotide Polymorphisms (SNPs) 

were selected for high minor allelic frequencies. Useful SNPs are homozygous 

in recipient and in graft but with different alleles. Assuming Hardy-Weinbergequilibrium, 

this should be ~12.5% of such SNPs; therefore, 37 Taqman assays were 

established. cfDNA was extracted from ≥1mL EDTA-plasma and subjected to a library 

preparation, followed by PCRs on a LightCycler480 to define useful heterologous 

SNPs. These were then used for graft DNA quantification using digital droplet PCRs 

(BioRad QX100) expressed as fractional percent abundance. 

Results: At 2% fractional abundance the recovery was 100% (SD:3%) with a 

total imprecision of 6-16%. The amount of graft DNA in stable LTx patients was 

5% (SD:4.7%). The one patient with biopsy proven rejection at day 43 showed a 

steep increase in graft cfDNA to 50% on day 32, several days before aspartate 

aminotransferase (AST) and bilirubin increased significantly (Figure). In contrast, the 

patients with complication free courses had



characteristic for this stage of disease. Detection of renal dysfunction, before apparition 

of albuminuria remains a goal for both, clinician and laboratory physician. The exact 

mechanisms underlying hyperglycemia dependent renal injury are unknown. The aim 

of our study was to evaluate the relationship between podocyte apoptosis markers and 

hyperglycemia in patients with diabetic nephropathy. 

Methods. We examined the urines of a group of 23 patients with DN histopathologically 

diagnosed (11 with normoalbuminuria and 12 with microalbuminuria) and 5 healthy 

subjects. Patients with DN were divided in two categories: blood glucose levels < 

200 mg/dl and ≥ 200 mg/dl. Midstream urine was collected in sterile containers and 

centrifuged. The podocytes were isolated and cultivated. The immunofluorescent 

method was applied to observe and identify the urinary cell morphology. We used 

podocalyxin and nephrin antibodies to identify podocyte cells. Cell viability and 

proliferation was detected using MTT test. Apoptosis was evaluated by RT-PCR 

analysis of caspase 3 and 9, immunohistochemical detections of Bax and western 

blot for survivin. 

Results. After cell culture, the number of podocytes was significantly 

increased in patients with diabetic nephropathy compared with control group. 

Immunohistochemical expression of proapoptotic protein Bax was positive in 86,95% 

of cases (20 patients) and was correlated with high level of glucose. Compared with 

normal controls, in patients with DN we noticed the up - regulation of caspase - 3 

(91,3% of cases) and caspase - 9 (100% of cases) versus lower expression of anti - 

apoptotic protein survivin (96.65% of cases). 

Conclusions. We conclude that apoptosis of podocytes have a role in the onset and 

progression of diabetic nephropathy and it is correlated with hyperglycemia levels. 

A-97 

Directly detect high risk HPV oncogenes E6/E7 mRNAs from Pap 

smear without RNA purification, reverse transcription or PCR 

L. Zhang 1 , T. Liu 2 , R. Chuang 1 , X. Li 2 , X. Li 2 , R. Diaz 1 , L. Chen 1 , J. 

Erickson 1 , P. Okunieff 3 , A. Zhang 1 . 1 DiaCarta Inc, Hayward, CA, 2 Kodia 

Biotechnology, CO., Ltd., National Univ. Science Park, Zhengzhou, China, 

3 

Shands Cancer Center, University of Florida, Gainesville, FL 

Human Papillomavirus (HPV) infection causes nearly all cervical cancers and it is 

one of the most prevalent cancers in women. Most cancers of the vulva and vagina are 

induced by oncogenic HPV types. In precancerous lesions, most HPV genomes persist 

in an episomal state whereas in many high-grade lesions and carcinomas, genomes are 

found integrated into the host chromosome. Two viral genes, E6 and E7, are invariably 

expressed in HPV-positive cancer cells. Their gene products are known to inactivate 

the major tumor suppressors, p53 and retinoblastoma protein (pRB), respectively. E6 

oncoprotein has the capability to up regulate the expression of apoptotic inhibitors; 

In addition,the E6 and E7 oncogenes cooperate to effectively immortalise primary 

epithelial cells. It has been demonstrated that HPV E6/E7 expression level plays a key 

role in the progression of invasive carcinoma of the uterine cervix via the deregulation 

of cellular genes controlling tumor cell proliferation. HPV E6/E7 oncogenes have 

been proven to be robust biological markers for prognosis assessment and specific 

therapy of the disease. 

We have developed a highly sensitive and specific nucleic acid hybridization assay 

using branched DNA (bDNA) to amplify the signals. Specific probe sets were 

designed that bind to the E6/E7 oncogene of each HPV subtype. The assay can 

simultaneously detect E6/E7 mRNAs for all 14 high-risk HPV subtypes directly from 

Pap smear samples without RNA purification, reverse transcription or PCR. All HPV 

mRNA targets are captured through cooperative hybridization of multiple probes, and 

probe set design determines the specificity of each HPV subtype of E6/E7 mRNA. 

Probe set oligonucleotides bind a contiguous region of the target E6/E7 mRNAs 

and selectively capture target RNAs to a solid surface during hybridization. Signal 

amplification is performed via sequential hybridization of Pre-Amplifier, Amplifier 

and label probe. The assay is highly specific and sensitive, and can detect as low as 50 

transcript molecules per mL. Using same patient samples, we demonstrated that the 

test is more sensitive and specific than HC2 assay. 

A-98 

The CYP1A2*1D Polymorphism Has A Significant Impact On Olanzapine 

Serum Concentrations 

F. Czerwensky, S. Leucht, W. Steimer. Klinikum rechts der Isar, TU 

München, Munich, Germany 

Background: Olanzapine is one of the most widely prescribed second-generation 

antipsychotic (SGA) drugs. CYP1A2 is believed to be the most relevant metabolizing 

enzyme. Therefore, polymorphisms affecting CYP1A2 activity may have an important 

impact on olanzapine serum concentrations and clinical outcome. The CYP1A2*1D 

polymorphism is a very interesting SNP, since a recently published report shows a 

significant impact on CYP1A2 activity in smokers [1]. We, therefore, tried to detect 

the CYP1A2*1D polymorphism by using the LightCycler (Roche, Mannheim, 

Germany) and investigated its influence on pharmacokinetics and clinical outcome. 

Methods: We developed a new rapid-cycle polymerase chain reaction on a LightCycler 

2.0, which was cross-validated with RFLP analyses using primers described by Chida 

et al [2]. The best results were achieved with the following setup: forward-primer:5´G 

CCCACTCCAGTCTAAATCAAA3´, reverse-primer:5´AGGACAAGCCTTAAATT 

GGATG3´, sensor-probe:5´LC705-TGATTGTGGCACATGAACCCC-phosphate3´, 

anchor-probe:5´GAGGTCGAGGCTGCAGTGAGC-fluorescein3´, 35x (95°C-10sec, 

59°C-20sec, 72°C-30sec), 500nM CYP1A2*1D forward and 625nM reverse 

primers, 60nM hybridization probes, 100ng DNA, 3.125mM MgCl2 and 2μl master 

hybridization mixture (Roche Diagnostics, Mannheim, Germany), total volume 20μl. 

Ninety-eight Caucasian inpatients who received olanzapine as part of their treatment 

for at least 4 weeks were included in our retrospective investigation. Steady-state 

serum concentrations were measured 12-14h post-dose by a method modified from 

Kirchherr et al [3]. Baseline demographics, psychopathological state, response and 

side effects were assessed at admission to hospital and after 4 weeks by means of the 

PDS rating scale, the clinical global impression (CGI) rating and the dosage record 

and treatment emergent symptom scale (DOTES). Dose and body weight corrected 

serum concentrations and PDS- and CGI-improvement were compared for genotype 

by analysis of variance. Analysis of covariance was used to exclude confounding 

factors and Pearson correlation to investigate the relationship between olanzapine 

serum concentrations, PDS- and CGI-improvement and side effect scores. 

Results: All 98 patients were genotyped successfully on the LightCycler and 56 

samples were cross-checked with RFLP. The results were in complete concordance. 

Carriers of the delT-alleles showed 2.3 or 1.5 (homozygous: n=3, heterozygous: 

n=6) times higher dose corrected serum concentrations (ANOVA, p=0.003) and 1.9 

(n=3) or 1.8 (n=5) times higher dose and body weight corrected serum concentrations 

(ANOVA, p=0.009) than wildtype-allele carriers (n=89/85;1.60 ng/mL per mg;116.23 

ng/mL per mg/kg). In a model adjusted for age, sex, baseline weight (available for 

n=93) and CYP1A2 inducers (carbamazepin, smoking) the CYP1A2*1D genotype 

still revealed a significant impact on dose corrected serum concentrations (ANCOVA, 

p=0.004, estimated marginal means for delT/delT,T/delT,T/T [ng/mL per mg]: 3.49, 

2.67, 1.62 (n=3/5/85)). No significant relationship between serum concentrations or 

CYP1A2*1D genotype and side effects or response was detected. For side effects this 

is not surprising since the majority (98%) of patients displayed concentrations in or 

below the therapeutic range (20-80 ng/mL) probably due to dose optimization, e.g. 

following TDM. 

Conclusion: We developed a fast and reliable method for detecting CYP1A2*1D. 

Our results indicate for the first time that carriers of the delT-allele develop 

significantly higher dose corrected olanzapine serum concentrations, independent of 

the confounding factors age, sex, baseline weight and concomitant CYP1A2 inducers. 

Before genotype-based dosage recommendations can help olanzapine treated patients 

further studies are needed. 

1.Dobrinas,M:ClinPharmacolTher:2011Jul:90(1):117-25 

2.Chida,M;JpnJCancerRes:1999Sep:90(9):899-902 

3.Kirchherr,H.;JChromatogrBAnalytTechnolBiomedLifeSci:2006:843:100-113. 

A-99 

Outcome Of Acute Myeloid Leukemia Patients According To 

Cytogenetic And Molecular Characteristics 

P. Akl, M. Cherry, R. Allen, A. Kanaly, W. Moore, S. Pant, S. Dunn. 

University of Oklahoma Health Sciences Center, Oklahoma city, OK 

Background: Acute myeloid leukemia (AML) is a heterogeneous group of neoplastic 

disorders with great variability in clinical course, response to therapy, and molecular 




mechanism to disease. Karyotyping provides the most important prognostic 

information in adult AML, but 50-60% of patients are cytogenetically normal or have 

non-informative cytogenetic aberrations and are thus categorized as intermediaterisk. 

However, this group is highly heterogeneous with a broad spectrum of responses 

to therapy. Recently, several recurrent molecular markers have proven valuable in 

further risk-stratifying these intermediate-risk AML cases. Among adverse prognostic 

markers, FLT3 mutations are particularly unfavorable and most FLT3(+) patients are 

destined for bone marrow transplantation. In addition, DNMT3A, IDH1 and IDH2 

mutations have been independently associated with particularly adverse outcomes in 

intermediate-risk adult AML. By contrast, mutations in CEBPA and NPM1 have been 

associated with favorable prognosis. The purpose of this study is to assess frequencies 

and interactions of these molecular markers compared to laboratory and clinical data 

for a cohort of AML patients at the University of Oklahoma Health Sciences Center. 

Patients and methods: A retrospective chart review of all AML patients evaluated 

between January 2000 and February 2011 was performed. Demographics, laboratory 

testing, bone marrow biopsy diagnosis, cytogenetics, chemotherapy and stem 

cell transplantation were collected on all patients. There were 113 adults and 16 

children. Available archived DNA was subjected to PCR followed by fragment 

analysis by capillary electrophoresis to test for FLT3, NPM1, CEBPA mutations or 

by pyrosequencing to test for DNMT3A (codon 882), IDH1 (codon 132) and IDH2 

(codons 140 and 172) mutations. For survival analyses, Kaplan-Meier method was 

used. Analyses were restricted to intermediate-risk adults due to the limited pediatric 

cases. 

Results: Among the 113 adult patients, 61 (56%) were categorized as intermediaterisk; 

16/61 (26%) were FLT3(+), 17/61 (28%) were NPM1(+), 6/61 (10%) were 

CEBPA(+), 10/61 (16%) were DNMT3A(+), 4/61 (7%) were IDH1(+) and 6/61 (10%) 

were IDH2(+). Univariate survival analyses of the intermediate-risk group indicated 

inferior overall survival (OS) with FLT3 and combination of FLT3 and DNMT3A 

mutations (p



Conclusions We found that cfDNA is subject to a temperature-triggered degradation 

in serum but not in EDTA-plasma. Moreover, exogenous and endogenous nucleases 

were active only in serum. EDTA probably by chelation of divalent ions inhibits blood 

nucleases conferring an ex-vivo protection to cfDNA. Ultimately, we developed a realtime 

fluorescence method to detect nuclease activity in clinical samples. 

A-102 

Development of a rapid, novel assay for CYP2C19*17 variants. 

S. Lewis 1 , H. Han 1 , S. Banerjee 2 , B. Little 3 . 1 Tarleton State University, Fort 

Worth, TX, 2 Veterans Affairs Medical Center, Dallas, TX, 3 Tarleton State 

University, Stephenville, TX 

Clopidogrel bisulfate is a thienopyridine inhibitor of the platelet P2Y12 adenosine 

diphosphate receptor. Most patients undergoing the insertion of a drug eluting stent 

after myocardial infarction are prescribed clopidogrel bisulfate (Plavix ®) and 

aspirin as anti-platelet therapy. Numerous investigations of patients prescribed the 

anti-platelet drug clopidogrel bisulfate (Plavix®) have demonstrated relationships 

between patient’s CYP2C19 genotype and their response to clopidogrel as related 

to clinical outcomes such as blood clots, stent thrombosis, bleeding, myocardial 

infarctions and major cardiovascular events (MACE). Loss of function CYP2C19*2 

and *3 variants have been associated with higher levels of ADP-induced platelet 

aggregation in patients receiving clopidogrel therapy, and therefore have a greater risk 

of major cardiovascular events, including stent thrombosis (ST). The CYP2C19*17 

allelic variant was shown to significantly reduced ADP-induced platelet aggregation 

in clopidogrel treated patients and conferred an increased risk of bleeding, In order to 

undertake large studies to clarify the relationship of CYP2C19 variants on clopidogrel 

metabolism, additional laboratory tests need to be developed that are more rapid, less 

expensive and cover the spectrum of clinically significant variants. Of significant 

interest to investigators of the pharmacogenetic relationship of clopidogrel bisulfate 

(Plavix ®) and CYP2C19 variant alleles, is the ability to detect the clinically 

significant CYP2C19 allelic variants. The CYP2C19*17 allelic variant may not be 

detected by all commercially available genotyping platforms. The objective of this 

study was to develop a novel qualitative CYP2C*17 qualitative genotyping assay 

using real-time PCR on DNA samples using primers and fluorescently labeled 

probes. 

Blood samples were collected in EDTA tubes and DNA extracted using the Roche 

MagNa Pure. DNA concentration of samples was determined to obtain the desired 

optimum final concentration 25g/mL for controls. PCR primer and probe pair design 

were prepared by Fluorestric Inc. (Park City, Utah) with known CYP2C19*17 SNP 

ID= rs 12248560. http://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?rs=12(248560) 

The Roche HybProbe Assay (Real-Time PCR) was used to genotype all patients 

for CYP2C19*17 allele. PCR was performed in 20-μl volumes in the presence of 

1x Roche Genotyping Master mix, 4.0 mmol/L magnesium chloride (MgCl2), 0.2 

μmol/L of each probes, and 0.5 μmol/L of each primers. Genotyping and melting 

curves were evaluated for each sample. The genotyping assay for CYP2C19*17 

was optimized with the control samples (wild-type samples lacking CYP2C19*17, 

heterozygous, and homozygous variants). This novel, rapid, real-time PCR assay 

to detect both heterozygous and homozygous CYP2C19*17 variants, demonstrates 

a 100% sensitivity and 100% specificity when validated with ten positive and ten 

negative samples previously confirmed by another method. This assay is reproducible 

(inter-assay CV=0.22; Intra assay CV=0.16-0.22) and requires only a real-time PCR 

system with allele-calling software. By combining this novel assay with other author 

developed assays novel assays to detect CYP2C19* 2 and *3 alleles or commercially 

available assays, investigators may detect clinically significant CYP2C19 allelic 

variants. Future clinical studies are needed to corroborate published results 

demonstrating an increased risk of bleeding in CYP2C19*17 individuals. The use of 

CYP2C19 genotyping prior to the selection of anti-platelet therapy shows promise to 

reduce mortality and morbidity in patients with coronary artery stents. 

A-103 

Simple NAT2 haplotyping using allele-specific sequencing 

S. Kang, G. Park, S. Jang, D. Moon. Chosun university hospital, Gwangju, 

Korea, Republic of 

BACKGROUND: N-Acetyltransferase 2 (NAT2) is a common metabolizer of many 

clinical drugs. NAT2 haplotyping requires a complex procedure. Allele-specific PCR 

followed by direct sequencing or cloning sequencing are common methods used for 

haplotyping. However, these common methods require labor-intensive procedures. 

Allele-specific sequencing was designed for haplotyping of the NAT2 gene. 

METHODS: Using rapid DNA polymerase with high-fidelity, we amplified the 

NAT2 coding region for direct sequencing, allele-specific sequencing, and cloning 

of genomic DNA from 207 healthy Korean subjects. Analysis of the 873-bp coding 

region of NAT2 was performed in order to search 11 of the most common single 

nucleotide polymorphisms (SNPs). For cases that were heterozygous for 282C>T, 

803A>G and 857G>A, we performed sequencing analysis using the allele-specific 

sequencing primer for one specified allele at one locus. We performed cloningsequencing 

analysis for confirmation of the haplotyping results of allele-specific 

sequencing. 

RESULTS: Allele-specific sequencing determined actual haplotypes for cases that 

were heterozygous for two or more SNPs. For cases that were homozygous for SNPs, 

the haplotypes of NAT2 were possibly determined. 

CONCLUSION: We have developed a simple method for NAT2 haplotyping using 

allele-specific sequencing; this could be an innovative method that reduces laborintensive 

procedures and complex inferring algorithms. 

A-105 

Detection of the single nucleotide polymorphism (rs1468384) in 

niemann-pick c1-like 1 gene using a PCR-RFLP assay in Nepalese 

healthy cohort 

K. P. Singh 1 , U. Timilsina 2 , H. K. Tamang 3 . 1 Maharajgunj Medical Campus 

(IOM), Kathmandu, Nepal, 2 College for Professional Studies, Kathmandu, 

Nepal, 3 Kantipur Dental College Teaching Hospital, Kathmandu, Nepal 

Background: Niemann-Pick C1-Like 1 (NPC1L1) protein is a newly identified 

sterol influx transporter actively involved in the cholesterol homeostasis pathway. 

NPC1L1 proteins are highly expressed in the apical membrane of enterocytes and 

the canalicular membrane of hepatocytes. Single Nucleotide Polymorphism (SNP) 

rs1468384 of Niemann-Pick C1-Like 1 Gene is the result of a nucleotide change 

G to A at position 2993 of the cDNA sequence in exon 2, and it results in the 

substitution of isoleucine for methionine at amino acid 510 of the NPC1L1 protein. 

This polymorphism shows decrease in the stability of the protein as analysed in 

silico by MuPro and StructureSNP softwares. Related data on allelic frequency of 

this polymorphism in Nepalese population are not available. In this study we have 

identified the SNP rs1468384 by Polymerase Chain Reaction - Restriction Fragment 

Length Polymorphism (PCR-RFLP) technique and determined the allelic frequency of 

this polymorphism in Nepalese subjects by genotype counting. 

Methods: A total number of 74 healthy subjects were randomly selected within 

Kathmandu valley. DNA from blood cells was isolated with the DNAsure ® blood 

mini-kit from Genetix, India. The PCR reaction was optimized for 200 ng of DNA. 

The primer pair selected was according to Praveen P. Balgir et al. 2009 precisely 

amplifying the SNP specific Exon2 fragment of NPC1L1 gene. PCR products showing 

a single prominent band of 437bp were processed for restriction digestion with BccI 

(New England Biolabs). 

Genotype distribution and Allelic frequency were calculated using PopGene. 

S ⋀ 2(version 1.00) software. All the statistical analysis were done using IBM SPSS 

Statistics (version 19) software. All tests of statistical significance were two sided with 

95% confidence intervals (CI). 

Results: Among the total 74 subjects under study, 30 subjects were males while 44 

subjects were females. Their mean age was 34.93 ± 10.11 years (males : 34.93 ± 10.57 

and females: 34.93 ± 9.93 years). After digestion of the 437 bp fragment obtained by 

PCR amplification, the three possible genotypes were distinguishable: homozygous 

AA (437 bp), heterozygous GA (437, 278 and 159 bp), and homozygous GG (278 

and 159 bp). Genotype count for homozygous GG allotype was the highest while 

a complete absence of homozygous AA allotype was found. Genotype distribution 

was in accordance with Hardy-Weinberg Equilibrium (X 2 =2.02, DF=1). Genotype 

frequency distribution among Gender was not statistically significant as analysed by 

Chi-square test (X 2 = 0.62, DF=1, p value =0.427). ‘G’ allele frequency (p=0.8581) 

was found to be high in Nepalese population compared to that of ‘A’ allele (q=0.1419). 

Conclusions: The study of genotype frequency distribution for SNP rs1468384 in 

Nepalese population for the first time will definitely serve as a major achievement 

in understanding some complex disease states as atherosclerosis resulting due to any 

interruption in the cholesterol pathway. Relatively higher prevalence of rs1468384 

polymorphism among Nepalese population was found in this study. 




A-106 

Evaluation of six SNPs of microRNA machinery genes and risk of 

tuberculosis in Chinese Tibetan population 

X. Song, S. Li, Y. Zhou, J. Zhou, X. Lu, J. Wang, Y. Zhou, Y. Ye, L. Wang, 

B. Ying. West China Hospital of Sichuan University, Chengdu, China 

Background: MicroRNAs (miRNAs) act as posttranscriptional regulators of 

gene expression by targeting mRNA transcripts for either mRNA degradation 

or translational repression. Recent studies suggest that miRNAs might involve 

in the immunological mechanism for anti-tuberculosis(TB) protection. Whether 

the polymorphisms in genes involved in the processing of miRNAs into maturity 

influence the susceptibility of a person to TB has not yet been elucidated. In this study, 

we investigated the association between TB risk and single nucleotide polymorphisms 

(SNPs) in microRNA machinery genes in Chinese Tibetan population, which live in 

the high altitude environment, leading to a series of physiological characteristics 

differentiate from plainsmen. 

Methods: We assessed the associations between TB as a risk and six potentially 

functional SNPs from five miRNA processing genes (DROSHA, DGCR8, DICER, 

AGO1, and GEMIN4) in a case-control study of 294 tuberculosis patients and 287 

frequency-matched (age, gender, and ethnicity) controls from Tibetan/a native of 

Tibet. All the SNPs (rs10719, rs3757, rs3742330, rs636832, rs7813, and rs3744741) 

were genotyped by high resolution melting method. 

Results: The genotype distributions of the six SNPs in patients and controls were 

all within Hardy-Weinberg equilibrium (HWE) except rs3744741 and rs3757 whose 

genotype distributions in controls were not in accordance with HWE. The allele and 

genotype frequencies of rs3742330 were quite different in patients and controls. 

Genotype frequencies of these three SNPs (rs10719, rs636832, rs7813) didn’t show 

great vibration between tuberculosis patients and normal subjects. Meanwhile, allele 

frequencies of these three SNPs analogously distributed between case and control 

group. The genotype frequency of rs3744741 was obviously different in patients 

and controls, and as for rs3757, neither genotype nor allele distribution was found 

to be associated with tuberculosis, however, we could not draw conclusions as their 

genotype distributions were deviated from HWE. All the cases were divided into two 

groups based on infection sites: the pulmonary tuberculosis group and the co-infected 

with both pulmonary and extra-pulmonary tuberculosis group. Between two groups, it 

did not really make any big difference of genotype distributions and allele frequencies 

of the six SNPs. 

Conclusion: Our results suggested that the specific genetic variants in microRNA 

machinery genes may affect TB susceptibility. In this study, rs3742330 of the DICER 

gene was found to be associated with altered TB risk in Tibetan. This finding suggests 

that rs3742330 might be a useful marker for determining the susceptibility to TB 

in Tibetan and that the DICER gene might be involved in the development of this 

disorder. Further epidemiological and functional studies in a larger population are 

warranted to validate these results. 

A-107 

Comparison of Hybrid Capture II and a New Multiplex Real-Time PCR assay 

for the Detection of Human Papillomavirus (HPV) Infections 

C. Yi, M. Kwon, S. Yu, K. Ko, H. Woo, H. Park. Kangbuk Samsung 

Hospital, Seoul, Korea, Republic of 

Background: Human Papillomavirus (HPV) testing is an important part of cervical 

cancer screening and management of women with atypical screening results. The 

aim of the present study was to evaluate performance of a new multiplex real-time 

PCR assay (Anyplex II HPV28 Detection, Seegene, Korea) for detecting high risk 

HPVs compared to the Hybrid Capture 2 (HC2) assay. 

Methods: A total of 1,114 cervical swab specimens were consecutively obtained in 

healthy women who visited a healthcare center. All specimens underwent testing for 

HPV detection using the HC2 assay. If any discrepant results of HPV assays were 

detected using the two methods, these samples were additionally tested with multiplex 

PCR and direct sequencing using common and type specific primers. 

Results: Among the 1,114 specimens, the HC2 assay detected 6.5% (72/1,114) cases 

of HPV with high risk screening, while the Anyplex II HPV28 assay identified 12.4% 

(138/1,114) cases with high risk genotypes. The overall percent agreement between 

the HC2 and Anyplex II HPV28 tests was 91.4% (1,018 out of 1,114 specimens). 

Discrepant results between these assays were presented in 96 cases and these 

specimens underwent further analysis by multiplex PCR and direct sequencing. Of 

these 96 specimens, 15 cases were positive only by HC-II but the 9 cases were low 

risk HPV genotypes or other types, and 81 cases were positive only by Anyplex II 

HPV28 but the 67 cases were high risk HPV genotypes including 13 cases of 16 and/ 

or 18 HPV genotypes and 54 cases of non-16/18 high risk genotypes, respectively. 

Conclusion: When comparing the HC2 and Anyplex II HPV28 assay for the 

detection of high risk HPV genotypes, the Anyplex II HPV28 assay exhibited higher 

concordance with comprehensive genotyping. The Anyplex II HPV28 assay could be 

used as a single test for identifying HPV types form clinical specimens. 

A-108 

A case of de novo non-mosaic isodicentric X chromosome: 46,X,idic(X) 

(q24) 

D. Jeon 1 , W. Lee 1 , S. Park 1 , J. Lee 1 , J. Ha 1 , N. Ryoo 1 , J. Kim 1 , H. Kim 2 . 

1 

Department of Laboratory Medicine, Keimyung University School 

of Medicine, Daegu, Korea, Republic of, 2 Department of Pediatrics, 

Keimyung University School of Medicine, Daegu, Korea, Republic of 

Isodicentric X chromosomes with an Xq deletion are uncommon. Most of previous 

cases were mosaic 45,X/46,X,idic(Xq), which showed mainly Turner stigma, 

then caused confusion in analysis of phenotype-karyotype correlation. Nonmosaic 

46,X,idic(X) with Xq deletion are very rare and their phenotypes typically 

include irregular menstruation, primary or secondary amenorrhea, and possibly 

gonadal dysgenesis. Therefore, most of patients were diagnosed at later age due to 

reproductive problem or atypical sexual development. Short stature is a very rare 

finding in non-mosaic 46,X,idic(Xq) patients, to the best of our knowledge, there 

have been no case who was diagnosed due to short stature as main abnormality. We 

describe a 8-year-old patient with a de novo non-mosaic isodicentric X chromosome. 

She visited our hospital due to short stature (119cm, 5-10 percentile). The patient 

was generally healthy and had no dysmorphic features, including Turner stigmata, 

psychologic problem or medical concerns. Tests for follicle stimulating hormone, 

luteinizing hormone, growth hormone, and thyroid profile were within normal. 

Karyotyping showed non-mosaic 46,X,idic(X)(q24), and FISH using CEP X probes 

showed isodicentric X chromosomes in 300/300 metaphase cells. The karyotypes 

of both parents were normal indicating that this is a de novo changes. Now, the 

patient is being treated with growth hormone, getting regular follow-up. Although 

this patient has only short stature without other abnormalities now, further hormonal 

changes must be checked until she reaches the age of puberty for checking abnormal 

reproductive problems. 

A-109 

The first report of 47,XXX/47,XX,+8 mosaicism 

D. Jeon 1 , W. Lee 1 , S. Park 1 , J. Lee 1 , J. Ha 1 , N. Ryoo 1 , J. Kim 1 , H. Kim 2 . 

1 

Department of Laboratory Medicine, Keimyung University School 

of Medicine, Daegu, Korea, Republic of, 2 Department of Pediatrics, 

Keimyung University School of Medicine, Daegu, Korea, Republic of 

Trisomy 8 mosaicism (T8M), also known as Warkany syndrome, is found about 

1/25,000 to 50,000 live borns. The phenotype is variable from normal to severe 

malformation, and includes an abnormal faces, reduced joint mobility, various 

vertebral and costal anomalies, eye anomalies, camptodactyly and deep plantar 

and palmar creases. Mental retardation is frequent and varies from mild to severe 

although some have normal intelligence. Because of extremely variable phenotype 

and disappearance of abnormal cell line from peripheral blood by aging, trisomy 8 

is often goes undiagnosed. Most, perhaps all, cases are mosaic with a normal cell 

line, 46,XY or 46,XX, because complete trisomy 8 is lethal. However, to the best 

of our knowledge, mosaicism of triosmy 8 with trisomy X has not been reported, 

yet.We report a 10-year-old girl with 47,XXX/47,XX,+8 mosaicism. She visited our 

hospital for evaluation of tall stature and frequent infections. Her weight was 50 Kg 

(95-97 percentile) and height was 160 cm (>97 percentile). She had deformity of 

toes and camptoctyly of left middle finger. But other skeletal abnormalities or face 

abnormalities were not noticed. She had severe frequent upper respiratory infection, 

oral ulcer and vaginal discharge for 6 years. In conventional karyotyping of peripheral 

blood, 47,XXX[35]/47,XX,+8[15] mosaicism was found in 50 metaphase cells. In 

FISH analysis, whereas peripheral blood cells showed trisomy 8 in 40%, buccal 

cells showed in 12.5%. Karyotype of both parents showed normal. Although the 

phenotype of trisomy 8 is highly variable, tall stature is very rare. Our patient has 

tall stature and this is likely to be related to 47,XXX cell line rather than trisomy 8. 

However, skeletal abnormalities found in toes or fingers are similar with those found 


A31



in T8M. Although little correlation between the level of mosaicism and the extent 

of the clinical phenotype has been reported, relatively low percentage of trisomy 8 

cell compared to trisomy X cell might result in relative mild phenotypes. Moreover, 

trisomy 8 cells of this case are guessed to originate from 47,XXX cell through mitotic 

dysjunction, because trisomy 8 cells are less frequent than trisomy X cells in not 

only peripheral blood but also buccal tissues, and most of trisomy 8 is thought to 

be due to mitotic dysjunction during early zygotic development. Here, we report the 

first case of 47,XXX/47,XX,+8 mosaicism who showed tall stature and mild skeletal 

abnormalities. 

A-110 

Establishing Analytical Methods for CYP2D6 Genotyping and 

Measurement of Tamoxifen and its Metabolites for the Assessment of 

Tamoxifen Therapy 

B. Y. L. Wong 1 , L. Fu 2 , A. Romaschin 3 , E. Warner 4 , H. Vandenberghe 3 , D. 

E. C. Cole 5 . 1 Sunnybrook Health Sciences Centre, Toronto, ON, Canada, 

2 

Department of Clinical Pathology, Sunnybrook Health Sciences Centre; 

Department of Laboratory Medicine and Pathobiology, University of 

Toronto, Toronto, ON, Canada, 3 Department of Biochemistry and Li Ka 

Shing Research Institute, St. Michaels Hospital; Department of Laboratory 

Medicine and Pathobiology, University of Toronto, Toronto, ON, Canada, 

4 

Department of Medical Oncology, Odette Cancer Centre, Sunnybrook 

Health Sciences Centre, Toronto, ON, Canada, 5 Department of Clinical 

Pathology, Sunnybrook Health Sciences Centre; Department of Laboratory 

Medicine and Pathobiology, Pediatrics (Genetics), and Medicine, 

University of Toronto, Toronto, ON, Canada 

Background and objectives: Some studies have demonstrated a clinically relevant 

impact of CYP2D6 genotype on outcome of tamoxifen therapy. However, recent data 

suggests that less than 40% of interindividual variability in plasma levels of active 

metabolite endoxifen can be explained by CYP2D6 genotype. Our study aimed to 

(1) establish analytical methods for CYP2D6 genotyping and measurement of 

tamoxifen and metabolites; (2) evaluate the genotype-phenotype relationships; (3) 

explore the potential roles of genotyping and therapeutic-drug-monitoring (TDM) in 

individualizing tamoxifen therapy. 

Methodology: Subjects: 100 consecutive breast cancer patients were recruited from 

the Medical Oncology Clinics at Sunnybrook Odette Cancer Centre over 6 months. To 

be included in the study, patients needed to be receiving tamoxifen 20 mg/day for at 

least 6 weeks, for chemoprevention, adjuvant therapy or metastatic disease. 

CYP2D6 Genotyping: Extracted DNA was genotyped using long-range PCR and 

multiplexed primer extension reactions. Long-range PCR products for duplication or 

deletion were detected by 1% agarose gel electrophoresis. SNaPshot reaction products 

were detected by ABI PRISM 3100-Avant Genetic Analyzer (Applied Biosystems, 

USA). Measurement of tamoxifen and metabolites: Tamoxifen and metabolites were 

quantitated by liquid chromatography tandem mass spectrometry (LC-MS/MS), 

with an LC-20AD Prominence binary solvent delivery system with a column oven, 

DGU-20A3 online degasser and SIL-HTc controller (Shimadzu, Kyoto, Japan) and 

3200 QTrap triple quadrupole mass spectrometer equipped with heated electrospray 

ionization source (ABSciex). 

Statistic analysis: SPSS v20.0 (SPSS Inc., Chicago IL) software package was used 

for data analysis. 

Results and validation: 

1. Our genotyping method determined 13 polymorphic CYP2D6 variants and the 

major rearrangements of the entire CYP2D6 gene. The alleles detected included: *2A, 

*2, *3, *4, *6, *8, *9, *10, *14, *17, *29, *35, *41, gene deletion *5, and gene 

duplication. Our method was validated by testing control samples from ParagonDx 

(n=9) as well as parallel comparisons with other laboratories using different methods 

(n=50). 

2. Our LC-MS/MS method was able to quantify the plasma concentrations of 

tamoxifen, endoxifen, 4-hydroxytamoxifen (4OHtam), N-desmethyltamoxifen 

(NDtam) simultaneously. In our cohort, the median plasma concentrations (and range) 

of these compounds were: 253 (75-734), 16 (2.3-64), 2.3 (0.5-6.2) and 468 (73-1120) 

ng/mL (n=98), respectively. 

3. Based on genotyping results, our patients were classified into 6 subgroups: 

ultra metabolizers (UM, increased, n=4); extensive metabolizers 1 (EM1, normal, 

n=39); EM2 (slightly reduced, n=18); EM3 (modestly reduced, n=22); intermediate 

metabolizers (IM, moderately reduced, n=12); and poor metabolizers (PM, 

significantly reduced, n=4). This metabolic profiling significantly correlated with 

endoxifen levels as well as log-transformed ratios of endoxifen/NDtam and ratios of 

4OHtam/tamoxifen (p10-fold). These could not be explained by genotype alone. 

Conclusions: 

1. Our CYP2D6 genotyping method is an accurate and reproducible means of detecting 

an allelic panel selected for our local patient population. 

2. CYP2D6 genotyping predicts plasma levels of tamoxifen and its metabolites. 

3. Both approaches of genotyping and TDM may be used for future studies to evaluate 

the impact of genetic variations, metabolite levels and adherence to individualized 

tamoxifen therapy. 

A-111 

Genotyping in the Chemistry Laboratory: Workflow for CYP2C9 

Single Nucleotide Polymorphism (SNP) Identification 

A. Kantartzis, W. Clarke, M. A. Marzinke. The Johns Hopkins University 

School of Medicine, Baltimore, MD 

Background: Genetic variability in drug metabolizing enzymes, including 

members of the hepatic cytochrome P450 (CYP450) superfamily, may have 

significant pharmacokinetic and pharmacodynamic consequences in an individual. 

For example, CYP2C9 genetic variability can influence the metabolism of anticoagulants, 

anti-epileptics and analgesics. Therefore, knowledge of an individual’s 

genotype, specifically of single nucleotide polymorphisms (SNPs), could drastically 

improve drug dosing as well as reduce the frequency of adverse events. Current 

pharmacogenetic testing methods, such as pyrosequencing and GeneChip arrays, are 

costly and laborious. In this study, we present the development of a novel, streamlined 

approach for SNP identification, using CYP2C9 as a model. The method includes an 

initial screen for aberrant genetic sequences via high resolution melting curve (HRM) 

analysis. This is followed by reflexed testing of non-wild type variants using probebased 

quantitative PCR (qPCR) to detect whether variants contain the specific SNP 

of interest. 

Method: Sequence-specific primers were designed to amplify regions flanking 

the CYP2C9 SNPs, within wild type (WT) and variant CYP2C9*2 (430C>T) and 

CYP2C9*3 (1075A>C) control DNA samples. PCR reactions for both HRM and qPCR 

were prepared using the QIAgility liquid-handling system and DNA amplification 

occurred on the Rotor-Gene Q thermocycler (QIAGEN). All qPCR reactions contained 

either a WT or variant probe and amplifications were normalized to a housekeeping 

gene (albumin). HRM analysis as well as qPCR quantitation was performed by the 

Rotor-Gene Q software. Within-run and between-run precision (% CVs) for both 

HRM and qPCR approaches were calculated from the melting temperatures for HRM 

(n=5) and from cycle thresholds (C T 

) for probe-based qPCR (n=3). 

Results: HRM screening was able to differentiate wild-type CYP2C9 amplicons from 

both CYP2C9*2 and CYP2C9*3 variants, by producing distinct melting curve patterns 

for all three controls. HRM analysis showed within-run and between-run precision of 

0.02% and 0.13% for CYP2C9 WT, 0.02% and 0.16% for CYP2C9*2 and 0.11% and 

0.16% for CYP2C9*3, respectively. Reflexed probe-based qPCR analysis was then 

carried out on wild type and variant controls. Quantitation of reactions containing the 

WT probe resulted in the detection of the amplified WT control but not of the mutant 

control. Subsequently, analysis of reactions containing the mutant probe resulted only 

in the detection of the amplified mutant sample. Within and between-run precision for 

the probe based qPCR assays were calculated as 0.62% and 1.11% for CYP2C9 WT, 

3.53% and 1.23% for CYP2C9*2 and 4.49% and 3.59% for CYP2C9*3, respectively. 

All PCR amplicons were confirmed for primer specificity by electrophoresis and for 

genotyping accuracy by single nucleotide extension Sanger-sequencing. 

Conclusion: HRM analysis is a precise and robust screening tool for discriminating 

CYP2C9 WT from non-WT variant genotypes. Since variants are seen at a



A-112 

Preparation from stabilized blood samples for quantitative RT-PCR 

without conventional RNA purification using the Life Technologies 

Stabilized Blood-to-CT Nucleic Acid Preparation Kit for qPCR 

W. Nie, T. Barta, D. Gutierrez, A. Shi, J. Wang. Life Technologies, Foster 

City, CA 

Background: Traditionally, RNA purification is the first step for gene expression 

analysis, but even the fastest and simplest RNA purification methods take about 1 hour 

total time for only twelve blood samples collected in either PreAnalytiX PAXgene 

or Life Technologies (LT) Tempus blood RNA tubes. To expedite and simplify 

the gene expression analysis workflow, Life Technologies (LT) has developed an 

innovative Stabilized Blood-to-Ct kit that creates a lysate from 500 uL of stabilized 

blood (either PAXgene or Tempus Blood RNA tubes) in three straightforward steps: 

pellet, wash and digestion. The procedure can be performed at room temperature 

within 60 minutes per 96 samples; substantially shortening the time consuming RNA 

preparation process. Real-time RT-PCR can be performed with the prepared lysates 

immediately afterwards. 

Methods: Blood were collected with LT Tempus blood RNA tubes. In parallel, one 

tube was processed using MagMAX RNA Isolation kit and pure RNA generated, the 

other tube was divided into 16X500ul aliquots, processed in one batch using Bloodto-Ct 

Nucleic Acid Preparation kit for qPCR, and lysates generated. Pure RNA and 

16 prepared lysates were then reverse-transcribed to cDNA, respectively, using 

SuperScript VILO cDNA Synthesis kit. Since each Blood-to-Ct kit can process as low 

as 500ul stabilized blood (the volume ratio of blood to stabilization buffer is 1:2), the 

amount of RNA in the prepared lysate may not be enough for testing and/or archiving, 

therefore, additional pre-amplification step was added in this study, starting cDNA 

materials were increased prior to qPCR and the resulting pre-amplification products 

were then used for qPCR. qPCR was performed using LT ViiA7 real-time PCR system 

(384 well format). Data were analyzed to evaluate not only between pure RNA and 

lysate, but also between non-amplified and pre-amplified DNA samples. 

Results: The amount of RNA from prepared lysates were quantified using LT 

Qubit, pure RNA was quantified using NanoDrop to roughly control the range of 

input amount in the RT step. The quantities of generated cDNA and further preamplified 

dsDNA measured by NanoDrop were very close from both RNA resources. 

The starting cDNA materials were increased more than 300 times through preamplification 

process. The uniformity of pre-amplification was checked, out of tested 

7 lysates and 1 pure RNA samples across 10 TaqMan Gene Expression assays (8x10 

values), only 3 values show ΔΔCt>1.5, and two of them can be explained with the 

relatively low yields (high Cts) of one lysate. Ubc was used as reference gene for the 

ΔΔCt calculation. The reproducibility of 16 manual preps using Blood-to-Ct kit was 

also analyzed and average CV of Cts is 0.0388. 

Conclusions: Our data shows comparable real-time RT-PCR performance of lysates 

prepared using LT Stabilized Blood-to-Ct kit with pure RNA isolated using MagMAX 

for Stabilized Blood Tubes RNA Isolation kit. Quantities of cDNA materials were 

increased more than 300 times through pre-amplification, providing unbiased 

amplification of targeted amplicons for analysis with TaqMan Gene Expression 

Assays. 

A-116 

Modified carbon fiber microelectodes with ruthenium oxide 

nanoparticles for sensitive detection of nitric oxide in biological 

samples. 

T. Bose, T. Bomberger, M. Bayachou. Cleveland State University, 

Cleveland, OH 

Nitric oxide is an important biological molecule that has diverse functions in human 

physiology. The concentration of NO in tissues and cells are of vital importance and 

the presence of too high or too low concentration of this reactive metabolite is the 

source of a variety of disease states. The major challenges with NO measurement 

are its low nano-molar concentrations in tissues and short half-life. This calls for the 

development of a method that is both sensitive and selective for the accurate detection 

of NO in biological systems. Out of the available analytical methods, electrochemical 

tools are most promising because they allow for miniaturization of probes as well as 

direct and accurate detection. 

We fabricated the microelectrodes in house using single carbon fibers of 7μm diameter 

mounted on copper wires, sealed in glass capillaries with 2-mm of the tip exposed. We 

have developed a method based on electrodeposited ruthenium oxide nanoparticles 

on the surface of bare carbon fiber microelectrode as a platform for catalytic NO 

detection. Ruthenium has high affinity for NO and readily forms nitrosyls that can be 

oxidized electrochemically. This property is one among other reasons that led us to 

select ruthenium as an electrocatalyst of choice for NO detection. 

The electrodeposition of ruthenium oxide nanoparticles is performed in perchloric 

acid solution containing RuCl3 precursor with constant cycling of the potential at 100 

V/s scan rate for 20 minutes. Under optimum conditions, the nucleation of ruthenium 

oxide occurs on the surface of the carbon fiber, with somewhat aligned growth of the 

nuclei that are in the 100-nm range in diameter as characterized by field emission 

scanning electron microscopy (FESEM). 

Electrocatalytic oxidation of the NO is assessed by cyclic voltammetry and 

amperometry in standing solutions. The ruthenium-modified microelectrodes exhibit 

rapid and reproducible response to NO at low applied potential (+0.5V vs. Ag/AgCl). 

Close analysis of the voltammograms shows that the addition of NO causes the anodic 

current of the Ru4+/6+ couple to increase with concomitant loss of reversibility. This 

behavior is a typical signature of an electrocatalytic process triggered by the oxidation 

of NO. The modified carbon microelectrodes typically show a five-fold increase in 

sensitivity compared to bare carbon microfibers. Our ruthenium-based NO sensor 

shows a detection limit in the vicinity of 500 pM, which is orders of magnitude lower 

than bare carbon fibers. We also show that this modified NO sensor has excellent 

linearity in relatively a wide range, including very low concentrations of NO. 

Application of this sensor in analytical measurement of NO in biological samples and 

at the level of live single cells will be presented and discussed. 

A-117 

Polymorphisms Of Renin Angiotensin System Genes In Uterine 

Leiomyomas Among Egyptian Females 

S. H. Gomaa 1 , A. M. Zaki 1 , M. M. Mokhtar 1 , M. S. Swelem 2 . 1 Medical 

Researh Institute, Alexandria University, Alex, Egypt, 2 Faculty of Medicine, 

Alexandria University, Alex, Egypt 

Background: Uterine leiomyomas are the most common gynecological benign 

myometrial neoplasms. They are benign tumours that arise from a single uterine 

smooth muscle cell. They commonly cause severe symptoms that can seriously impact 

women’s health. They have been associated with infertility and recurrent abortion as 

well as obstructed labour and post-partum haemorrhage. They are the most important 

indication for hysterectomy however; the exact etiology is not clearly understood. 

Several genetic, environmental and ethnic factors have been proposed.The renin 

angiotensin system (RAS), in particular Angiotensin Receptor Type 1 (AT1R) and to 

a lesser extent angiotensin II, angiotensin converting enzyme (ACE) and Angiotensin 

Receptor Type 2 (AT2R), are often up-regulated during the progression from normal 

to malignant phenotypes indicating a possible correlation between RAS and tumour 

progression. There is emerging evidence that the incidence of cancer is reduced in 

patients undergoing long-term treatment with drugs that inhibit RAS. Other evidence 

suggests that angiotensin II directly stimulates cell growth via the AT1R and that 

its blockade inhibits tumour growth thus, genetic polymorphisms of RAS could be 

involved in development of uterine leiomyomas. The present study investigated the 

association of A1166C single nucleotide polymorphism (SNP) of AT1R gene and 

insertion deletion (I/D) polymorphism of ACE gene with uterine leiomyomas in 

Egyptian females. 

Subjects: 70 females diagnosed as having uterine leiomyomas (preoperative pelvic 

ultrasonography and postoperative histopathological examination of the tumourtissue) 

were enrolled in the study(patient group) as well as 54 matched healthy females who 

never suffered from nor having family history of leiomyomas (control group). Intake 

of ACE inhibitors, angiotensin II receptor blockers or any drugs that affect ACE or 

angiotensin II levels or hormonal replacement therapy were excluded. 

Methods::Ethylene Diamine Tetraacetic Acid (EDTA)-anticoagulated venous 

blood specimens were collected from the patients and controls. Deoxyribonucleic 

acids (DNA) was extracted from peripheral blood leucocytes using Genomic DNA 

Purification Kit, Fermentas and genotypes of A1166C polymorphism of AT1 receptor 

gene were detected by means of a polymerase chain reaction (PCR) amplification 

using specific primers followed by restriction digestion of PCR products using Dde-I 

enzyme, while PCR was used for the detection of I/D polymorphism of ACE gene 

using specific primers. 

Results: The genotype distribution patterns of A1166C polymorphism of AT1R gene 

among controls and leiomyoma patients were both in agreement with Hardy-Weinberg 

equilibrium (p=0.273 and p=0.494 respectively).Genotype frequencies in both groups 

revealed a statistically significant difference (p = 0.028) using Fisher-Freeman- 

Halton’s test, where patients had a higher frequency of CC genotype than controls 

(8.6% versus 0%), a higher frequency of AC than controls (35.7% versus 25.9%) 


A33



and a lower frequency of AA than controls (55.7% versus 74.1%). The distribution 

of different alleles in both groups was statistically significant (p=0.037704) using the 

Fisher’s exact test. However, ACE I/D polymorphism was not found to be associated 

with uterine leiomyoma. Statistical analysis done using SPSS program version 20. 

Conclusions: We found a significant association of A1166C polymorphism in AT1R 

gene with uterine leiomyoma among Egyptian females suggesting that its potential 

regulatory function warrants further investigation. 

A-118 

Detection of Microsatellite Instability in Colorectal Cancers 

F. B. De Abreu, M. C. Schwab, L. J. Tafe, G. J. Tsongalis. Dartmouth- 

Hitchcock Medical Center, Lebanon, NH 

Background: Microsatellites are repetitive sequences distributed throughout the 

genome which are frequently copied incorrectly during DNA replication. The 

DNA mismatch repair (MMR) system, which consists of several proteins including 

MLH1, MSH2, MSH6 and PMS2, is responsible for the control and correction of 

these errors. Microsatellite markers are used to detect a form of genomic instability, 

known as microsatellite instability (MSI), which results from failure of the MMR 

system. MSI can be detected in approximately 15% of all colorectal cancers (CRCs). 

Approximately 3% of MSI CRCs cases are due to an inherited germline mutation 

in one of the DNA MMR genes, the other 12% are associated with a non-inherited 

form of DNA MMR inactivation caused by promotor methylation of the MLH1 gene. 

Here we provide validation data for microsatellite instability detection in patients with 

colorectal cancer. 

Methods: In this blinded study, DNA was isolated from 27 paired formalin-fixed 

paraffin-embedded colon tissues (normal and tumor) using Gentra PureGene Blood 

Kit Plus (Qiagen). We used the MSI Analysis System, version 1.2 (Promega) that 

includes fluorescently labeled primers for co-amplification of seven markers including 

five mononucleotide repeat markers (BAT-25, BAT-26, NR-21, NR24 and MONO-27) 

and two pentanucleotide repeat markers (Penta C and Penta D). The mononucleotide 

markers are used for MSI determination, and the pentanucleotide markers are 

used to confirm that the paired sample (normal and tumor) are from the same 

individual. Genomic DNA was amplified according to manufacturer’s instructions 

and PCR products were analyzed using ABI 3500 Genetic Analyzer with POP-7TM 

polymer and 50 cm capillary. The results were analyzed using Applied Biosystems 

GeneMapper® 4.1 software. Tumors showing instability at two or more markers were 

defined as MSI-H, and those with instability at one repeat or showing no instability 

were defined as MSI-L and MSS tumors, respectively. Results were compared to MSI 

results from previous testing. 

Results: Of the 27 paired DNA samples, our assay was able to identify, with 100% 

accuracy, tumors with high or low instability and microsatellite stable tumors (8 

MSI-H, 1 MSI-L, 18 MSS). There was 100% reproducibility of detection between 

independent runs. 

Conclusions: Our data supports the use of the MSI Analysis System to provide highly 

sensitivity and reliable detection of microsatellite instability in a clinical laboratory. 

A-122 

Paternity inclusion and exclusion in different types of genetic kinship 

investigations conducted in a clinical laboratory of the Federal District 

(Brazil). 

C. Chianca 1 , T. Santa Rita 1 , J. Vasques 2 , L. Abdalla 2 , S. Costa 2 , C. Sousa 2 , 

G. Barra 2 . 1 Universidade de Brasília, BRASILIA, Brazil, 2 Laboratório 

Sabin de Análises Clínicas, BRASILIA, Brazil 

Background: The paternity test is progressively becoming a clinical laboratory 

test. This analysis is based on comparing at least fifteen short tandem repeat (STR) 

DNA markers between the child and alleged father, in the presence or absence of 

the biological mother, which classifies the exam in trio or duo, respectively. The 

incompatibility in three or more STRs characterizes a paternity exclusion. The 

compatibility between all regions characterizes a paternity inclusion. The description 

of the types of cases (duo/trio) and results (inclusion/exclusion) in clinical laboratories 

are scarce. In this work, these parameters were evaluated retrospectively after eighteen 

months of implementation of this test in our laboratory. 

Methods: Through the retrospective analysis of our database, we assessed the genetic 

kinship investigations performed between May 2011 and October 2012. Nine hundred 

and fourteen investigations were conducted, all involving individuals residing in 

Brazil’s Federal District. The type of case, the conclusion and their distribution over 

the months were recorded and presented as absolute and/or relative frequency and 

mean ± standard deviation, when appropriate. The chi-square test was used to compare 

the obtained ratios. University of Brasília ethical committee approved this study. 

Results: Out of a total of 914 paternity cases, the trios occurred in a higher prevalence 

compared to duos, 596 (65.2%) versus 318 (34.8%). Moreover, the inclusions were 

more prevalent than exclusions, 610 (66.7%) versus 304 (33.3%). Besides that, the 

proportion of inclusion/exclusion were similar between trios and duos, 201 (33.72%) 

exclusions for trios and 103 (32.39%) exclusions for duos (p=0.68). Furthermore, the 

inclusion/exclusion and trio/duo proportions remained homogeneous in the eighteenmonth 

studied period, 34.78 ± 6.78% for exclusions (p = 0.45) and 34.72 ± 5.26% for 

duos (p = 0.97). 

Conclusion: In paternity testing, the trios were more frequent than duo. This result 

can be explained by the fact that trio has lower complexity analysis than duo, because 

the alleles not transmited from mother are determined with precision, making it a test 

cheaper than duo. Furthermore, the paternity inclusion is the most prevalent result type 

and the inclusion/exclusion proportion observed in this study is similar to that reported 

by forensic laboratories (32%). Moreover, the homogenity in inclusion/exclusion and 

trio/duo proportions suggest that these parameters associated with paternity testing 

remain similar over time. 

A-123 

HCV genotype distribution and determination of other variables 

related to the virus by assessing a clinical laboratory results database 

C. Chianca 1 , T. Santa Rita 1 , W. Vivas 2 , L. Velasco 3 , L. Abdalla 3 , S. Costa 3 , 

G. Barra 3 . 1 Universidade de Brasília, BRASILIA, Brazil, 2 Universidade 

Tiradentes, ARACAJU-SE, Brazil, 3 Laboratorio Sabin, BRASILIA, Brazil 

Background: In 2011, FDA announced a recall of an in vitro nucleic acid amplification 

test for the quantification of HCV RNA that has been shown to under-quantify a subset 

of genotype 4 in patient specimens by approximately 1.0-1.5 log 10 in the absence of 

any sequence mismatches. The distribution of these tests also applies to this country. 

As the HCV genotype has significant geographic variation, this recall encouraged us 

to determine the prevalence of HCV genotypes and others variables related to the 

virus by assessing our clinical laboratory results database, and evaluating the possible 

impact of this under-quantification in our region. 

Methods: Through retrospective analysis of our HCV genotyping database, we 

assessed the sample results between January 2005 and September 2011. 480 samples 

were analyzed, 394 (82%) genotypes were determined and 86 (17.9%) had negative 

results (no genotypes detected). Of these, 280 (58,2%) underwent quantification of 

HCV RNA in the same day. The genotype prevalences and RNA quantification were 

identified and presented by gender and age group



A-124 

A CASE REPORT OF HEREDITARY HYPERFERRITINEMIA- 

CATARACT SYNDROME 

J. D. SANTOTORIBIO 1 , C. CAÑAVATE SOLANO 1 , A. GARCIA DE LA 

TORRE 1 , A. TORAL PEÑA 2 , F. ARCE MATUTE 1 , S. PEREZ RAMOS 1 . 

1 

Puerto Real University Hospital, Puerto Real (Cadiz), Spain, 2 Santa 

Isabel Hospital, Sevilla, Spain 

Background: Hereditary Hyperferritinemia-Cataract Syndrome (HHCS) is an 

autosomal dominant disorder characterized by elevated serum ferritin levels, without 

iron overload, and early-onset bilateral cataract. Its prevalence is at least 1/200,000 

and is caused by mutations within the iron responsive element (IRE) located in the in 

the 5’ untranslated region (UTR) of L-Ferritin gene (FTL). We report a new case of 

family affected with HHCS. 

Methods: We studied father and daughter (54 and 26 years old respectively) 

with hyperferritinemia and clinically silent bilateral cataract. No other clinical 

manifestations were noted and main causes of elevated ferritin levels had been 

previously excluded. Both patients underwent sequencing of the IRE region using the 

following methodology: 

- Extraction and purification of genomic DNA from EDTA whole-blood samples. 

- DNA amplifi cation by polymerase chain reaction (PCR). 

- Direct sequencing of the double stranded purifi ed PCR product. 

- Bioinformatics analysis of the DNA sequence obtained by comparison with the 

reference nucleotide sequence of the gene FTL. 

Results: Serum iron profile of the father was: serum iron = 94 μg/dl, ferritin = 1215 

ng/ml and transferrin saturation of 27.2%. The daughter´s profile was: serum iron = 

86 μg/dl, ferritin = 700 ng/ml and transferrin saturation of 22%. Both patients showed 

the heterozygous IRE mutation c.-171C>G. This change has been described once as 

disease-causing mutation (BioBase). 

Conclusion: Sequencing of the IRE region may be included in the study of patients 

with hyperferritinemia and cataract. This case provides further evidence that the 

nucleotide change 171C>G in the IRE region of the FTL gene is causing HHCS. 

A-125 

Extraction and Amplification of Total Nucleic Acid (TNA) using BD 

MAX ExK TNA-2 and Ribonucleic Acid (RNA) Enrichment using 

BD MAX ExK DNase with Cerebrospinal Fluid (CSF) or Fresh 

Stool (Liquid or Soft) Specimens* 

R. Labourdette, V. Blanchette, I. Bourque, V. Brochu, H. Galarneau, J. 

Grondin, S. Lapointe, S. Létourneau, S. Roy, S. Simard, C. Roger-Dalbert. 

BD Diagnostics, Quebec, QC, Canada 

Background: The BD MAX System is a next generation sample-to-answer 

molecular testing platform. The new BD MAX TNA (for Total Nucleic Acid) 

suite, part of the Open System Reagent (OSR) series, combines specimen-specific 

extraction reagents (ExK) with universal PCR reagents (MMK) allowing users to 

extract, purify and amplify multiple RNA and DNA targets from a single biological 

specimen with their own user defined protocols. Users can select specimen volume, 

and individually program thermocycling and analysis parameters. A Specimen 

Processing Control (SPC), consisting of an armored RNA incorporated into the 

extraction reagents controls for extraction efficiency, reagent integrity and PCR 

inhibition by the sample. The objectives of this study were to demonstrate the capacity 

of the BD MAX ExK TNA-2 to extract, amplify and detect TNA and the capacity of 

the BD MAX ExK DNase to enrich the RNA fraction of the extracted nucleic acids 

by degrading the DNA fraction. 

Methods: Sample preparation and amplification were performed from CSF and fresh 

stool specimens using the BD MAX System. For CSF, a volume of 200 μL was added 

to the Sample Buffer Tube (SBT) and for stool, a 10 μL loop was dipped into the stool 

and then released in SBT. The RNA target was an inactivated Hepatitis C virus (HCV) 

at 1000 IU/mL in SBT while DNA targets were Klebsiella pneumoniae carbapenemase 

(KPC) genomic DNA at 2000 copies/mL and a Group B streptococcus (GBS) strain at 

1000 CFU/mL. A Specimen Processing Control (SPC) consisting of an armored RNA 

was co-extracted and co-amplified with the targets to control extraction efficiency, 

reagent integrity and PCR inhibition by the sample. The SPC is formulated with the 

BD MAX ExK TNA-2 extraction reagent, and the corresponding primers and probe 

are dried within the BD MAX TNA MMK(SPC) reagent. Target-specific primers 

and probes are added to the reagent prior to use. Two combinations were tested with 

CSF (HCV/KPC/SPC; n=11 and GBS/SPC; n=5) and one with stool (GBS/SPC; n=6). 

For both specimens types, TNA testing was performed with BD MAX ExK TNA-2. 

For CSF only, BD MAX ExK DNase reagent was used to enrich the RNA portion of 

the target by degrading the DNA portion. 

Results: When the BD MAX System was used with the BD MAX ExK TNA-2, a 

positive signal was obtained for KPC, HCV and SPC from CSF specimens (n=11) and 

for GBS and SPC from CSF (n=5) and stool specimens (n=6). 

With the BD MAX ExK TNA-2 and the BD MAX Exk DNase, a positive signal was 

obtained for HCV and SPC from CSF specimens (n=11). No signal was obtained for 

KPC. 

Conclusion: The BD MAX ExK TNA-2 used with BD MAX TNA MMK(SPC) can 

co-amplify DNA, RNA and SPC in CSF; and DNA and SPC in stool. 

The BD MAX ExK DNase can enrich RNA by degrading DNA in CSF processed with 

BD MAX ExK TNA-2. 

*The BD MAX ExK TNA-2, Exk DNase and TNA MMK(SPC) are not available for 

sale or use. 

A-126 

Validation of a diagnostic test for respiratory virus (CLART Pneumovir 

array) for clinical use in a private hospital in São Paulo - Brazil 

N. H. Muto, J. N. M. Rodrigues, V. M. Oliveira, C. L. P. Mangueira, J. R. R. 

Pinho, R. Sitnik. Hospital Albert Einstein, São Paulo, Brazil 

Background: Acute respiratory infections represent the most common causes of 

medical consultation and hospitalization worldwide during the winter season. Due 

to the variety of possible pathogenic agents and the high frequency of coinfections, 

it is necessary to use diagnostic methods that allow multiple, sensitive, efficacious 

and rapid identification of all possible viruses present in the clinical sample to apply 

the appropriate treatment for the patient. Methods: In order to provide this type of 

diagnostic test in patients of a private hospital in São Paulo - Brazil, we performed 

validation of the CLART Pneumovir array kit in our clinical laboratory. The kit is able 

to simultaneously detect 19 most common respiratory virus. The test was evaluated 

according to CAP guideline for qualitative assay. 

Methods: In order to provide this type of diagnostic test in patients of a private 

hospital in São Paulo - Brazil, we performed validation of the CLART Pneumovir 

array kit in our clinical laboratory. The kit is able to simultaneously detect 19 most 

common respiratory virus. The test was evaluated according to CAP guideline for 

qualitative assay. 

Results: For accuracy, we tested 29 samples with previous immunofluorescence 

result. We had a 90% correlation; however 34% of concordant samples also presented 

a co-infection with another virus, possible due to a higher comprehensiveness 

and sensitivity of the array test. For reproducibility, 09 samples were assayed 3, 4 

or 5 times each one, and results were concordant with exception of contamination 

in 13% of replicates. That contamination led us to make adjustments to minimize 

environmental and operator contamination. During this process, we performed 

negative reproducibility using 28 samples of DEPC-treated water to ensure that the 

adjustments were effective. For sensitivity, considering the high cost of the test, we 

established the limit of detection of one virus. Using a quantified H1N1 control we 

established the LOD of 150 copies/test and performed 20 replicates which resulted in 

80% confidence. 

Conclusion: CLART Pneumovir array test has been validated and included in the 

clinical laboratory of the Hospital. The availability of the test represents an additional 

tool for clinical management, providing valuable information to the diagnostic 

process. 

A-129 

Detection of mutations in the genes NPM1 and FLT3 in Acute Myeloid 

Leukemia in patients with normal primary karyotype 

L. Caputo, F. Gandufe, A. Cobacho, O. Denardin, L. Scarpelli, N. Gaburo. 


Background: The acute myeloid leukemia (AML) affects individuals of all races 

and ages, predominantly in Caucasians. The AML is characterized as a malignant 

neoplasm of hematopoietic progenitor cells. About 50% of this type of leukemia 

has chromosomal abnormalities. The other 50% of karyotypes lacking cytogenetic 


A35



alterations have been stratified according to molecular findings that distinguish 

predictions. 

Objective: In this work we studied the frequency of these mutations in normal 

karyotype patients with newly diagnosed AML and in patients with AML undergoing 

study for minimal residual disease (MRD). 

Methods: A total of 10 bone marrow samples in heparinized syringe or tube were 

studied (5 patients with “de novo” AML and 5 AML undergoing treatment. Karyotype 

analyses was performed on all samples using short duration cell culture without 

mitogens agents, followed by the standard protocol for cell harvest and banding G. 

In each patient at least 20 metaphases were karyotyped and the final report described 

according to the norms of the International System for Cytogenetic Nomenclature 

(ISCN, 2009). Concurrently studies were performed to NPM1 and FLT3 mutations 

by multiplex PCR followed by capillary electrophoresis, in which patterns have been 

checked for specific peaks in the electropherogram of each gene. 

Results: Among patients with AML “de novo” and with normal karyotype (3/5), 

considered intermediate risk group, only 1 patient showed NPM1+ and FLT3-, the 

others showed NPM1- and FLT3-. All these patients were categorized in the favorable 

risk group. Among patients with AML undergoing treatment and normal karyotype 

(4/5), there were no mutations in these genes. In the study of minimal residual disease 

(MRD), both as karyotype molecular methods were concordant for the evaluation of 

treatment efficacy. 

Conclusion: Our results, despite the small sample, together with the literature data, 

can guide the physician to apply karyotype and mutation study of gene NPM1 and 

FLT3 in patients with AML “de novo” and AML undergoing treatment because the 

categorization risk in these patients is important for management and monitoring of 

therapeutic treatment. 

A-130 

Analysis of SNP Genotype Calls Made with Chromosomal Microarrays 

in Reference and Case Samples 

F. B. De Abreu, G. J. Tsongalis, J. A. Lefferts. Dartmouth-Hitchcock 

Medical Center, Lebanon, NH 

Background: Chromosomal microarray (CMA) allows genome-wide testing of 

copy number variations (CNVs) using copy number probes and/or single nucleotide 

polymorphism (SNP) probes. CMAs have become an important tool for medical and 

biological research and clinical diagnostic tests. At Dartmouth-Hitchcock Medical 

Center, clinical CMA testing is being performed in postnatal individuals for clinical 

presentations including intellectual disability, development delay, autism spectrum 

disorders and multiple congenital anomalies. Although these genotypes for individual 

SNPs can be obtained they are typically used more collectively to aid in evaluating 

copy number changes or detecting long contiguous stretches of homozygosity. Here 

we evaluate the individual SNP genotype calls in a SNP chromosomal microarray. 

Methods: We ran four cases and a normal reference sample in duplicate using the 

CytoScan®HD microarray (Affymetrix) with probes targeting 749,157 different SNPs 

loci and 1.9 million non-polymorphic loci with an average intragenic spacing of 880 

base pairs and 384 base pairs for 340 genes. Microarrays were analyzed and genotypes 

obtained using the ChAS software (Affymetrix). All samples passed standard quality 

control measures. 

Results: Of the 749,157 SNPs included on each microarray an average of 741,624 

(98.99%) calls were made per array (range of 734,360-744,941). When comparing 

duplicate runs of the same sample, the percentage of concordant SNP genotype 

calls was 99.92% for the reference DNA sample and 98.84%, 99.67 %, 99.89%, and 

99.93% for the patient samples. 

Conclusions: Although chromosomal microarrays including SNP probes are not 

generally used for genotyping purposes, we evaluated the SNP genotype calls in 

several samples to determine the reproducibility of the SNP calls as a measure of the 

overall reproducibility of the microarray. The reproducibility between samples and 

their duplicates was on average 99.65% with respect to SNP genotype calls that were 

made. The variability in call rates and concordance rates might be attributed to minor 

differences sample processing. 

A-131 

Rapid and Simultaneous Genotyping of HPV During Routine 

Screening of Liquid Cytology Specimens Using the Roche cobas ® 4800 

H. B. Steinmetz, B. J. Dokus, A. B. Hawk, D. M. Green, V. Vijayalakshmi 

Padmanabhan, E. J. Gutmann, J. D. Marotti, X. Liu, J. A. Lefferts, L. J. Tafe, 

G. J. Tsongalis. Geisel School of Medicine at Dartmouth and Dartmouth- 

Hitchcock Medical Center, Lebanon, NH 

Background: Persistent infection with human papillomavirus (HPV) is implicated 

in the pathogenesis of cervical cancer and the presence of HPV can be detected in 

almost all of these cases. There are approximately 40 different types of HPV that 

can infect humans and 14 of these are considered high-risk for the development of 

cervical cancer and its precursor lesions. Routine testing for high risk HPV DNA is 

now the standard of care in the United States. The Roche cobas® 4800 HPV test is 

an automated platform that has been cleared by the FDA for the detection of high risk 

HPV infection in PreservCyt® cytology specimens. This test screens for high risk 

HPV and simultaneously provides genotyping data for HPV 16, HPV 18 or “other” 

high risk HPV types. As genotyping results may impact clinical care, we describe 

the frequency of high risk HPV detected by this new assay in a routine screening 

environment. 

Methods: We screened 834 cytology ThinPrep Preservcyt samples from January 

to February 2012 for the presence of HPV DNA and simultaneously genotyped for 

HPV16, HPV18, and “other” high risk HPV. Acrometrix HPV High Risk Positive 

Controls were used to verify the detection of these genotypes. Cytology samples were 

processed on the ThinPrep3000 processor using standard protocols. All samples were 

then tested with the Roche cobas® HPV assay. 

Results: Of the 834 samples screened, 113 (13.5%) were positive for the presence 

of HPV DNA. Of these positive samples, seventeen were genotyped as HPV 16, 

twelve as HPV18 and eighty four as “other” high risk types. The results of ten samples 

suggested co-infection with multiple HPV types (four had other High Risk HPV + 

HPV18 , five had other High Risk HPV + HPV16, and one sample had HPV16 + HPV 

18). Appropriate assay controls, which included both positive and negative controls, 

were included in each run and gave the expected results. None of the samples required 

repeat testing. 

Conclusions: High risk HPV testing by molecular techniques is an important tool in 

the diagnostic algorithm of cervical epithelial lesions. Our data confirm the presence 

of high risk HPV types including the significant presence of high risk HPV types other 

than types 16 and 18, in our patient population. 


Nutrition/Trace Metals/Vitamins 





A-132 

Vitamin D Status in Bulgarian Patients with Chronic Hepatitis C Virus 

Infection 

D. Gerova 1 , B. Galunska 1 , I. Ivanova 1 , I. Kotzev 1 , T. Tchervenkov 1 , S. 

Balev 1 , D. Svinarov 2 . 1 Medical University, Varna, Bulgaria, 2 Medical 

University, Sofia, Bulgaria 

Background: Vitamin D status is of significant importance for improving human 

health, and for prevention of many diseases. Hepatitis C virus (HCV) infection 

is a major global health challenge affecting over 3 million people worldwide. 

Epidemiological studies provided evidence that vitamin D deficiency may confer 

increased risk of viral infections, including HCV infection. The main objective of 

this retrospective study was to determine the prevalence of vitamin D deficiency and 

insufficiency in Bulgarian patients with HCV infection, and to assess its relationship 

to the severity of liver disease and response to interferon-based therapy. 

Methods: Study encompassed 296 patients with proven HCV infection who 

consented to participate: 161 males (54.4%) aged 42.08±14.87 (range 18-82) years, 

and 135 females (45.6%) aged 45.72±14.34 (range 18-72) years; frequency of the 

different HCV genotypes was 87.3% for GT1, 0.5% for GT2, 11.7% for GT3 and 

0.5% for GT4. Determination of 25-hydroxyvitamin-D (25OHD, sum of 25OHD 3 

and 25OHD 2 

) was performed by a validated ID-LC-MS/MS method (d 3 

25D 3 

utilized as internal standard), with accuracy and precision within 7.5%; extraction 

recoveries averaging 57-73%; linearity range 3.0-300.0 nmol/L, (R2>0.99). Patient 

demographics, HCV-genotype, viral load (quantitative real-time reverse-transcription 

PCR), histological grade and stage (according the METAVIR classification), AST 

levels, treatment, and treatment outcomes, were assessed with respect to vitamin D 

status. For statistical analysis, means±SD were determined, and an unpaired t-test 

with Welch’s correction for comparison of means of different parameters was used, 

with level of significance set at p80nmol/L). Seasonal difference in vitamin D status was significant: 

37.60±1.7 (from November to April) vs 70.55±2.4 (from May to October), p



Conclusion: The Siemens ADVIA Centaur Vitamin D Total assay standardized to the 

VDSP should be a valuable tool in clinical laboratories for the accurate measurement 

of vitamin D sufficiency in human sera. 

* The ADVIA Centaur Vitamin D Total assay standardized to the VDSP is in 

development and is not available for sale. 

A-137 

Comparison of a novel microbiological assay with standard HPLC 

determination of vitamin B6 in plasma 

S. M. Loitsch 1 , K. Reuter 1 , G. Oremek 2 , J. Stein 3 , T. Dschietzig 4 . 1 Institute of 

Pharmaceutical Chemistry, University of Frankfurt, Frankfurt, Germany, 

2 

University Hospital Frankfurt, Central Laboratory, Frankfurt, Germany, 

3 

Crohn-Colitis Centre Rhein-Main, Frankfurt, Germany, 4 Immundiagnostik 

AG, Berlin, Germany 

Background: Higher plasma homocysteine is associated with a higher cardiovascular 

risk. Apart from renal insufficiency, deficiencies of vitamins B6, B12, and 

folic acid pose the most common causes of moderately elevated homocysteine. 

We have developed novel, micro-titre plate-based turbidimetric kits (ID-Vit R ) to 

determine biologically active B6, B12 and folic acid by measuring bacterial growth 

in factor-deficient media. 

Methods: The novel ID-Vit R microbiological assay for determination of vitamin B6 

in human plasma uses micro-titre plates pre-coated with lyophilized Saccharomyces 

cerevisiae thus avoiding numerous problems associated with the maintenance 

and use of stock cultures. It was compared here with a high-performance liquid 

chromatographic (HPLC) assay. In 170 healthy individuals and in 68 patients with 

coronary artery disease (CAD, 37 patients with acute coronary syndrome [ACS], 31 

with stable CAD), data obtained using the HPLC gold standard method were compared 

with the ID-Vit R results. Intra-assay and inter-assay coefficients of variation were 

evaluated; regression and Bland-Altman analyses were performed. Homocysteine in 

CAD patients was measured by HPLC. 

Results: The new microbiological assay correlates well with the HPLC assay (r = 

0.89; p1.5 mg/dl. Neither HPLC nor ID-Vit R values for 

B6 correlated with homocysteine levels. 

Conclusion: The microbiological assay with pre-coated plates and the HPLC 

standard assay are in good agreement. The new assay can easily be automated and is 

less laborious than common microbiological assays. The lack of correlation between 

B6 vitamin and homocysteine can be accounted for by the fact that homocysteine 

in our CAD patients was in the high-normal range and that a relevant percentage of 

patients had impaired renal function. 

A-138 

Absence of association between serum folate and the development of 

preeclampsia in women exposed to folic acid supplementation and food 

fortification 

S. Thériault 1 , Y. Giguère 1 , J. Massé 2 , S. B. Lavoie 3 , J. Girouard 2 , E. Bujold 2 , 

J. Forest 1 . 1 CHU de Québec Research Center, Québec, QC, Canada, 2 CHU 

de Québec, Québec, QC, Canada, 3 CHU Sainte-Justine, Montréal, QC, 

Canada 

Background: Folic acid supplementation was recently proposed as a possible means 

to reduce the risk of preeclampsia (PE). This study aims to determine if serum 

folate concentration early in pregnancy is associated with hypertensive disorders of 

pregnancy (HDP) in a population exposed to folic acid supplementation and food 

fortification. 

Methods: This is a nested case-control study, based on a prospective cohort of 7,929 

pregnant women recruited between 2005 and 2010 in the Quebec City metropolitan 

area, including 214 participants who developed HDP and 428 controls matched for 

parity, multiple pregnancy, smoking status, gestational and maternal age at inclusion 

and duration of blood samples storage. Diagnosis of HDP was made according to the 

Society of Obstetricians and Gynaecologists of Canada classification. Serum folate 

levels were measured before 20 weeks of gestation with an electrochemiluminescence 

assay on an Elecsys 2010 system (Roche Diagnostics). 

Results: More than 98% of the participants took folic acid supplements in a timeframe 

ranging from before pregnancy to the end of the first trimester. Mean serum folate 

levels were accordingly high and there were no differences between women who 

further developed HDP compared to their controls (60.1 nmol/L vs 57.9 nmol/L; 

p=0.51). No differences were observed in any of the subgroups (Table 1). The 

proportions of participants with serum folate below the 10 th percentile (< 21.1 nmol/L) 

of our local nonpregnant population were similar between groups and no participant 

had levels generally defined as folate deficiency (< 10 nmol/L). 

Conclusion: In an unbiased cohort of pregnant women benefiting from a national 

policy of folic acid food fortification combined with a high adherence to folic acid 

supplementation, serum folate levels are high and do not differ between women who 

develop HDP and women who remain normotensive. Further supplementation with 

higher doses is unlikely to be beneficial in such populations. 

Table 1: Serum folate levels in women with hypertensive disorders of pregnancy and their 

controls 

GH Ctl GH mPE Ctl mPE sPE Ctl sPE HDP Ctl 

n 77 154 69 138 68 136 214 428 

Mean (nmol/L) 60.7 55.5 63.8 62.7 55.7 55.9 60.1 57.9 

SD (nmol/L) 42.5 37.2 44.3 40.3 43.2 36.9 43.2 38.2 

Median (nmol/L) 44.7 43.9 47.8 45.6 42.4 42.4 44.6 44.2 

IQ (nmol/L) 32.9 33.5 25.6 36.8 17.4 23.7 26.5 29.7 

Folate ≤ 10th percentile (21.1 

1.3 4.5 1.4 1.4 5.9 3.7 2.8 3.3 

nmol/L)(%) 

Ctl: Control group; GH: gestational hypertension; mPE: mild preeclampsia; sPE: severe 

preeclampsia; HDP: hypertensive disorder of pregnancy; SD: standard deviation; IQ: 

interquartile range. 

No significant differences between the means (p > 0.05) 

A-139 

Intrinsic Factor Blocking Antibody Interference Is Not Detected In 

Five Automated Cobalamin Immunoassays 

S. Merrigan 1 , D. Yang 2 , J. A. Straseski 1 . 1 ARUP Laboratories, Salt Lake 

City, UT, 2 University of Wisconsin School of Medicine, Madison, WI 

Background: Several authors have recently reported falsely normal cobalamin 

(vitamin B 12 

) results in patients diagnosed with pernicious anemia. Interference of 

native intrinsic factor blocking antibody (IFBA) with automated immunoassays has 

been proposed as a cause of these falsely elevated results. Interference with cobalamin 

results is a concern, since almost 70% of pernicious anemia patients test positive for 

IFBA. 

Objective: In light of a recent voluntary vendor recall of cobalamin reagent due 

to IFBA interference, our objective was to investigate five additional automated 

cobalamin immunoassays to determine if they were similarly affected. 

Methods: We created six human serum pools with high (>911 pg/mL [>672 pmol/L]), 

normal (210-911 pg/mL [155-672 pmol/L]), or low (



Conclusions: In summary, of five automated cobalamin assays evaluated, none 

showed a significant decrease in cobalamin concentration after immunoglobulin 

precipitation by PEG. This was illustrated in serum pools, regardless of cobalamin 

concentration, and in a previously spurious patient sample. These results suggest that 

these five automated cobalamin assays do not cross-react with IFBA. While all results 

should be corroborated with clinical signs and symptoms, laboratories may use this 

information to monitor clinical assay performance. 

A-140 

Simple and Rapid assay for Simultaneous determination of 

serum chromium and cobalt by inductively coupled plasma-mass 

spectrometry 

H. Choi 1 , S. Lim 2 , Y. Park 2 , S. Lee 3 . 1 Departments of Laboratory Medicine 

& Genetics, Samsung Medical Center, Sungkyunkwan University School of 

Medicine, Seoul; Chonnam National University Hospital, Gwangju, Korea, 

Republic of, 2 Department of Orthopedic Surgery, Samsung Medical Center, 

Sungkyunkwan University School of Medicine, Seoul, Korea, Republic 

of, 3 Departments of Laboratory Medicine & Genetics, Samsung Medical 

Center, Sungkyunkwan University School of Medicine, Seoul, Korea, 

Republic of 

Background: Trace element analysis has been used for evaluation of toxicity 

in environmental contamination and occupational exposure, and deficiency of 

essential elements in nutritional status. Recently, Cr and Co metal ions are known 

to be associated with surface corrosion and wear particles of implants in patients 

with hip resurfacing prosthesis. These metal ions may serve as an indicator of the in 

vivo performance of MoM bearing surfaces. However, there are few reports about 

validation of the assay for simultaneous measurement of serum Cr and Co levels for 

Asian population. The aim of this study was to develop rapid and sensitive assay for 

simultaneous measurement of serum Cr and Co using inductively coupled plasmamass 

spectrometry (ICP-MS) in clinical laboratory practice, and to evaluate the 

analytical performance and clinical usefulness of this assay. 

Methods: We evaluated the linearity, accuracy, precision and lower limit of 

quantification (LLOQ) of an ICP-MS method (Agilent 7500CE ICP-MS, Agilent 

Technologies, Japan) to determine serum Cr and Co concentration in accordance 

with the FDA guidelines for bioanalytical method validation. This method was 

used to determine serum Cr and Co levels of 185samples from 74 patients after hip 

resurfacing arthroplasty (HRA) and compare that of 51 healthy controls. 

Results: This ICP-MS method for serum Cr and Co levels showed good linearity 

(linearity range, 0-20 μg/L, 0-20 μg/L; linear regression coefficient, r 2 > 0.999, r 2 

> 0.999, respectively). Accuracy was satisfactory for all tested concentrations of Cr 

and Co (%bias, -1.5 ~ 2.5%, -3.3 ~ 1.6%, respectively). The intra- and inter-assay 

coefficient of variations (CV) for both metal ions did not exceed the limit of 10% for 

LLOQ (0.02 μg/L of Cr, 0.01 μg/L of Co, respectively) and were within 5% for the 

other concentrations (intra- and inter-assay CV, 1.2 ~ 2.6 and 1.9 ~ 4.4% of Cr; 1.4 

~ 2.7 and 1.9 ~ 4.7% of Co). The serum Cr and Co concentrations (mean±SD) were 

0.60±0.12 μg/L and 0.29±0.15 μg/L in 51 healthy subjects. In 185 serum samples 

from 74 orthopedic patients (median duration implanted, 36 months; range, 1-140 

months), the median concentration of serum Cr and Co were 2.6μg/L (0.3 ~ 116.8) 

and 1.4μg/L (0.1 ~ 127.8), respectively. The levels of Cr and Co in patient group was 

significantly higher than the levels in healthy controls (Mann-Whitney test, p



used with a 4x3.0mm SecurityGuard ULTRA C18 cartridge. HPLC mobile phase A 

was 0.1% formic acid in DI water; B was acetonitrile. Flow rate was 0.8mL/minute 

with a 7-minute step program. The signal was detected with a UV detector. 

Results: Optimal response of vitamin C was observed when UV wavelength was 

set at 245nm. Using an easy LC/MS/MS compatible mobile phase, vitamin C was 

well retained at ±2.7-minute and baseline-to-baseline separated with great resolutions 

using the Kinetex 5μm XB-C18 column. Meta-phosphoric acid was the most effective 

protein precipitant. Vitamin C samples extracted with 5% meta-phosphoric acid were 

stable on a cooled autosampler for at least 48-hour. Protein precipitation with the 

Impact plate is simple and can be easily automated. Three levels of plasma quality 

control samples were prepared at 1, 10 and 35μg/mL. The percentage of coefficients 

of variation for the intra-assay precision were 1.74% to 3.16% (n=12) and for the 

inter-assay precision were 1.80% to 4.82% (n=6). The mean recovery was 98.2% 

with CV=4.8% (n=7). The calibration curve was linear in the whole range tested of 

0-100μg/mL (R2=0.9999). LOD was 0.78μg/mL and LOQ was 1.56μg/mL There 

were no inferences with uric acid which has a similar structure to vitamin C. 

Conclusion: A simple HPLC-UV method with high-throughput protein precipitation 

is established for accurate and reproducible quantitation of human plasma vitamin C. 

A-144 

Evaluation of Frequency of Vitamin D Deficiency in a cohort of 9058 

women aged more than 60 years 

L. F. A. Nery 1 , G. R. Martins 1 , C. M. Araújo 1 , S. S. S. Costa 1 , L. A. Naves 2 . 

1 

Laboratório Sabin, BRASILIA, Brazil, 2 Endocrine Unit, University of 

Brasilia; Laboratório Sabin, BRASILIA, Brazil 

BACKGROUND: Falls and high risk of bone fractures are important health problems 

in elderly people. The frequency and impact of 25-OH-vitamin D deficiency in these 

patients is unknown in tropical and sunny countries. 

OBJECTIVE: The objective is to determine the frequency of vitamin D insufficiency 

and deficiency in elderly women over 60 years living in the central region of Brazil. 

SUBJECTS AND METHODS: This is a retrospective study. A total of 9058 patients 

were selected from a clinical laboratory cohort, referred by clinicians to the laboratory 

to measure 25 OH vitamin D (chemiluminescence- Diasorin) in a period comprised 

between January 2012 and January 2013. All patients that received calcium or 

vitamin D supplementation in the last 3 months were excluded. Comparion between 

frequencies was analyzed by Fisher Test. 

RESULTS: The patients were divided in three groups, according to age, in group 1 

61-70 years old, Group B 71-80 years old, group 3 > 81 years old... Patients with 25 

OH Vitamin D < 20 ng/ml were considered deficient, and patients with 25 OH Vitamin 

D < 30 ng/ml were considered insufficient, and levels> 30 ng/ml were considered 

normal. Vitamin D deficiency was observed in 31%, 42% and 50%of groups 1, 2, 3 

respectively. Patients presented vitamin D 21-30 ng/ml respectively in 46%, 37%, and 

31% of patients from groups 1, 2, 3. The difference was not statistically significant in 

the subgroup analysis concerning vitamin D insufficiency (p=0.19) 

CONCLUSIONS: The results suggest that deficiency and insufficiency of vitamin 

D is very frequent in elderly women in our region, although the recommendation 

to provide supplements, and increase the sun exposure consists in a strategy to be 

considered with other factors by the clinicians. 

A-145 

Determination of Frequency of Vitamine D deficiency in Acromegalic 

patients compared to control healthy subjects 

P. S. Barbosa 1 , L. F. A. Nery 2 , D. H. Barros 1 , C. M. Araújo 2 , G. S. Mota 1 , 

S. S. S. Costa 2 , L. A. Naves 3 . 1 Endocrine Unit, University of Brasilia, 

BRASILIA, Brazil, 2 Laboratório Sabin, BRASILIA, Brazil, 3 Endocrine 

Unit, University of Brasilia; Laboratório Sabin, BRASILIA, Brazil 

Acromegaly is a rare endocrine disorder, related to hypersecretion of growth hormone 

(GH) and insulin like growth fator-1 (IGF-1), with important effects on bone and 

articular diseases. These tissues are very sensitive to calcium metabolism, and the 

role of PTH, and vitamin D on osteoarthicular disorders is not clear. Recent studies 

suggested that rises on IGF-1 can influence 25 (OH) vitamine D plasma levels. 

Objective: Evaluate the relation between activity of Acromegaly and calcium 

metabolism. Subjects and Methods: We recruited 35 patients with active acromegaly, 

recruited from neuroendocrine outpatient clinics of Hospital of University of Brasilia. 

They were submitted to venopunction, and blood samples were collected to evaluate 

25OHD (chemiluminescence, Diasorin), Calcium, PTH 1,25 (OH) vitamine D GH 

and IGF-1 (chemiluminescence, Immulite). The data was compared to a control group 

of 200 healthy subjects paired for age and gender. Results: The mean age was 49 + 

12 years, 48.5% were men. Most of patients presented elevated IGF-1 levels, and 

upper limit normal variation was 143.0±86.5 % (36.4-450.5). PTH was 52.5±27.1 

(19.2-137), Calcium 9.2±0.46 (7.7-10.2), 25(OH) vitamine D 22.9±11.7 (8.8-34.6). 

Vitamine D< 30 ng/ml was observed in 82,8% of Acromegalic patients, and 76% 

of healthy subjects. 25(OH) vitamine D < 20ng/ml, was observed in 54.2% of 

Acromegalic patients, compared to 32.1% of control patients (p 30 ng/ml. Discussion and Conclusion: The frequency of 

vitamine D deficiency in Acromegalic patients was high, but no association was found 

with IGF-1 levels and type of treatment. Other studies have to be done to determinate 

the impact of vitamine D deficiency on acromegalic ostheoarthicular disease. 

A-146 

Frequent Vitamin D Test Ordering is Associated with Improvement of 

Vitamin D Status in Deficient Patients Only 

H. Signorelli (Mack) 1 , J. Reedy 2 , T. Urenda 2 , K. Nakatsu 2 , G. S. Bodor 2 . 

1 

University of Colorado, Denver, CO, 2 VA Medical Center, Denver, CO 

Objective: Vitamin D testing volume has increased worldwide but it is unknown 

if frequent 25-hydroxy vitamin D (OHD) testing improves patients’ vitamin status, 

therefore we investigated the relationship of patients’ OHD status and the number of 

OHD test orders over a long period of time. 

Methods: 32 months’ worth of OHD test results, collection date and patients’ 

demographics were obtained from the LIS. Serum 25(OH) vitamin-D2 and -D3 

(OHD2, OHD3, respectively) were measured by an in-house LC-MS/MS assay, 

calibrated to the NIST SRM 2972 standard. Total OHD was reported as the sum of 

OHD2 and OHD3. Assay AMR were 6-200 and 4-200 ng/mL for OHD2 and OHD3, 

respectively. Assay CVs were 1 year later. Slight improvement was seen in 

the OHD status of the patient group initially categorized as insufficient. They received 

2.7 follow up tests (average) during the study period and ~50% of them became OHD 

sufficient 31 days or more after the initial assessment. Initially sufficient patients 

received an average of 3.5 tests following the initial measurement but 39% and 5% of 

them became insufficient and deficient, respectively, regardless. 

Conclusion: Repeat OHD testing does not appear to significantly improve vitamin D 

status in a large population, except, possibly, in those patients who had been found 

insufficient at initial observation. Our data does not support frequently repeated OHD 

testing in the general population. 




A-147 

Performance Evaluation of the ROCHE E 170 for the Determination 

of Total 25 OH Vitamin D: The challenge continues! 

R. Khoury, A. Gandhi, B. P. Salmon, A. Patel, P. Gudaitis, D. Gudaitis. 

Aculabs, Inc., East Brunswick, NJ 

Background: Vitamin D measurement is one of the fastest growing tests in past few 

years with increase in ordering it by more than 100 folds. The increase is due primarily 

to increase in awareness of the relationship between vitamin D levels and cancer, 

diabetes, autoimmune disorders. Measuring vitamin D is becoming a challenge for the 

laboratories with the availability of the assay on many automated analyzers without 

having a universal standard. 

Methodology: The Roche assay is a competitive immunoassay with 27 minutes 

duration; the sample is incubated with pretreatment reagents, bound vitamin D (25- 

OH) is released from the vitamin D binding protein. Pretreated sample is incubated 

with the ruthenium labeled vitamin D binding protein, a complex between the vitamin 

D (25-OH) and the ruthenylated vitamin D binding protein is formed. After addition 

of streptavidin-coated microparticles and vitamin D (25-OH) labeled with biotin, 

unbound ruthenium labeled vitamin D binding proteins become occupied. A complex 

consisting of the ruthenylated vitamin D binding protein and the biotinylated vitamin 

D (25-OH) is formed and becomes bound to the solid phase via interaction of biotin 

and streptavidin. The reaction mixture is aspirated into the measuring cell where the 

microparticles are magnetically captured onto the surface of the electrode. Unbound 

substances are then removed with ProCell/ProCell M. Application of a voltage 

to the electrode then induces chemiluminescent emission which is measured by a 

photomultiplier. Results are determined via a calibration curve which is instrumentspecifically 

generated by 2-point calibration and a master curve provided via the 

reagent barcode. The assay is fully automated. We evaluated the assay sensitivity, 

linearity, precision/accuracy (20 replicates), reportable range, and correlation 

with Centaur XP assay, discordant samples were sent for verification to 3 different 

laboratories using LC/MS-MS method. Statistical analyses were done using Analyseit. 

Results: the sensitivity was 5.0 ng/mL, within assay coefficient variation were 4.1% 

and 4.1% for a concentration of 12.0 ng/mL and 28.0 ng/mL respectively. Analytical 

range was verified from 5-60 ng/mL. Regression analysis between E 170 and Centaur 

XP gave a slope of 1.04 and intercept -4.15 for samples



not use a single-point Vitamin D level. Certainly these issues have contributed to 

discrepancies between the Institute of Medicine’s recommendations for Vitamin D 

supplementation and those of health risk assessment researchers. 

A-152 

Measurement of vitamin K1 (phylloquinone) in human serum by 

liquid chromatography-tandem mass spectrometry 

D. M. Garby, R. DelRosso, L. A. Cheryk. Mayo Medical Laboratories, 

Andover, MA 

Background: Vitamin K1 or phylloquinone is part of a group of similar fat soluble 

vitamins in which the 2-methyl-1,4-naphthoquinone ring is common. Phylloquinone 

is found in high amounts in leafy green vegetables and some fruits (avocado, 

kiwi). It is a required cofactor involved in the gamma-carboxylation of glutamate 

residues of several proteins. Most notably, the inactive forms of the coagulation 

factors prothrombin (factor II), factors VII, IX, and X and protein S and protein 

C are converted to their active forms by the transformation of glutamate residues 

to gamma-carboxyglutamic acid (Gla). Other proteins such as those involved in 

bone metabolism, cell growth and apoptosis also undergo this Gla transformation. 

Measurement of vitamin K1 (phylloquinone) in serum is a strong indicator of dietary 

intake and status. 

Methods: Deuterated stable isotope phylloquinone-d7 (25 μL) is added to a serum 

sample as an internal standard. Protein is precipitated from the mixture by the addition 

of ethanol/0.01% butylated hydroxytoluene. The specimen is then centrifuged for 

15 minutes at 1750xg. Phylloquinone and internal standard are extracted from the 

resulting supernatant by solid phase extraction using a Strata-X 33μm Polymeric 

Reversed Phase 30 mg/3 mL column (Phenomenex, Torrance, CA). Phylloquinone 

and internal standard are then separated by liquid chromatography using a Kinetex 

2.6μm C18 100x4.6mm column (Phenomenex, Torrance, CA) on a TLX4 high 

throughput liquid chromatography (HTLC) system (Thermo Fisher Scientific, 

Waltham, MA), followed by analysis on a tandem mass spectrometer (API 5000, AB 

SCIEX, Foster City, CA) equipped with an electrospray ionization source in positive 

mode. Ion transitions monitored in the multiple reaction monitoring (MRM) mode 

were m/z 451.5 → m/z 187.1 for phylloquinone and m/z 458.5 → m/z 194.2 for 

phylloquinone-d7. Calibrators consisted of six standard solutions ranging from 0 to 

5 ng/mL. 

Results: Method performance was assessed using precision, linearity, recovery, 

accuracy and specimen stability. Pooled human serum was processed neat, diluted 

with phosphate buffered saline (pH=7.4) containing 50 g/L bovine serum albumin 

to achieve low analyte concentrations, or fortified with a phylloquinone solution to 

achieve elevated analyte concentrations. Intra-run precision (N=20) coefficients of 

variation (CVs) ranged from 1.7% to 2.8%. Inter-run precision (N=25) CVs ranged 

from 5.8% to 8.9%. The method demonstrated linearity over the assay range (0.025 

to 5.0 ng/mL), yielding the following equation: observed phylloquinone value = 

1.0064*(expected value) + 0.0052, R 2 = 0.9997. Recovery was demonstrated by 

mixing serum samples containing high and low analyte concentrations and averaged 

99%. Correlations were run (N=60) comparing the phylloquinone HPLC method 

performed at an external reference laboratory (x) with the LC-MS/MS phylloquinone 

method performed at Mayo Medical Laboratories (y). Linear regression of the data 

yielded the following equation: y = 0.9701x + 0.0051 and a correlation coefficient, 

R=0.9980. A stability study demonstrated that specimens are stable at ambient (20ºC 

to 25ºC), refrigerated (2ºC to 8ºC), frozen (-15ºC to -30ºC) and ultra frozen (-65ºC to 

-90ºC) temperatures for up to 14 days. 

Conclusion: This method provides for the reliable analysis of vitamin K1 

(phylloquinone) in human serum. 

A-153 

Measurement of Total 25(OH) Vitamin D using bioMérieux VIDAS : 

development of a new assay. 

E. Moreau, J. Dupret-Carruel, M. Hausmann. Biomérieux, Marcy l’Etoile, 

France 

Background: an assay for total 25-hydroxy vitamin D [25(OH)D] that measures 

both 25(OH)D2 and 25(OH)D3 is being developed by bioMérieux. Vitamin D is a 

fat-soluble steroid pro-hormone which deficiency can be associated with rickets, 

osteoporosis, secondary hyper-parathyroidism, as well as increasing risk of diabetes, 

cardiovascular or autoimmune diseases or various forms of cancer. Vitamin D is 

found mainly in two forms: vitamin D3 (cholecalciferol) synthesized by action of 

solar ultraviolet radiation on the skin and vitamin D2 (ergocalciferol) from exogenous 

origin only. The main storage form of Vitamin D in the body is 25(OH)D (calcidiol), 

found in high concentrations in serum or plasma, which makes 25(OH)D the preferred 

analyte for the determination of vitamin D nutritional status. 

Methods: the VIDAS 25-OH Vitamin D Total Assay design is based on a 2 step 

competitive immunoassay. In a first step, serum or plasma 25(OH)D is dissociated 

from its protein carrier then added to alkaline-phosphatase (ALP) conjugated specific 

antibody. In a second step, unbound ALP-antibody is then exposed to vitamin D 

analog coated-solid phase receptor. Solid phase is then washed and substrate reagent 

added to initiate the fluorescent reaction. An inverse relationship exists between the 

amount of 25(OH) vitamin D in the sample and the amount of relative fluorescence 

units detected by the system. Precision of the VIDAS 25-OH Vitamin D Total Assay 

was determined across the dynamic range using assay controls and serum samples in 

a 5 day protocol according to CLSI EP15-A2. Linearity was performed by diluting a 

high sample with a low sample and a high sample according to CLSI EP6. Method 

comparison to LCMS/MS and other immunoassays was achieved using >100 serum 

specimens spanning the VIDAS calibrated range and DEQAS samples. Serums were 

tested on multiple batches with each method. Recovery of 25(OH)D2 on the VIDAS 

assay was determined using serum with endogenous 25(OH)D2 (no spiking). 

Results: data obtained with the VIDAS 25-OH Vitamin D Total Assay demonstrated 

a limit of detection



6.5-52.9). Furthermore, 85% and 44% of ED arterogenic and 52% and 37% of ED 

non-arteriogenic have levels of vitamin D < 30 ng/mL and < 20 ng/mL, respectively, 

that means an insufficiency and deficiency of vitamin D, respectively. Our study 

shows that, at least in our experimental conditions, the levels of vitamin D are not 

sufficiently different to accurately discern between arteriogenic and non-arteriogenic 

patients and that the deficiency of vitamin D does not characterize only arteriogenic 

ED but all ED patients. It is probable that in conjunction with other risk factors, the 

insufficiency/deficiency of vitamin D may be involved in the mechanism causing ED. 

Conclusion: In conclusion, we hypothesize that a level of vitamin D > 30 ng/mL 

could prevent the effect of the most common risk factors of ED like atherosclerosis, 

vascular calcification and endothelial dysfunction. 


A43


Mass Spectrometry Applications 

A-155 




Absolute traceable protein quantification methods using isotope 

dilution mass spectrometry with three different strategies 

J. Jeong, Y. Yim, J. Yim, I. Yoon, H. Lee, S. Kim, S. Kim, Y. Lee, S. Park. 

Korea Research Institute of Standards and Science, Daejeon, Korea, 


Background: Measurement traceability in protein quantification is required to 

standardize quantification results irrespective of the measurement procedure and 

laboratory. As no analytical method can yet directly quantify whole proteins to the 

desired level of accuracy, proteins are reduced to analyzable entities with certain 

stoichiometric values, and which are then analyzed to deduce the quantity of original 

protein. We described absolute traceable methods in three different strategies 

based on the peptides, amino acids, and specific element as well. All methods used 

isotope dilution mass spectrometry to provide traceability to the Système d’Unitè 

International for quantification of human growth hormone as a candidate of certified 

reference material. 

Methods: Purified recombinant human growth hormone (hGH, 22 kDa) was used as a 

model protein. Sample purity was confirmed using capillary zone electrophoresis and 

HPLC. First, hGH was hydrolyzed by acid hydrolysis with 8 M hydrochloric acid at 

130 ℃ for 48 h for amino acid based quantification. Second, two tryptic peptides from 

hGH were chosen to determine hGH by tryptic digestion. The target peptides and its 

isotope residues were synthesized and value assigned by amino acid analysis. Double 

exact matching ID-HPLC-tandem MS was used for amino acid analysis as well as 

peptide analysis. Third, hGH, which contains seven sulfur-containing amino acid 

residues, was reduced into element level with microwave assisted digestion. Digested 

hGH were determined to total amount of sulfur using ID-inductively coupled plasma/ 

MS. The results from three different methods were evaluated by comparison with 

each other. 

Results: Each method for protein reducing and analytical conditions was optimized. 

The results from four different amino acids showed good agreement within 2% CV, 

and also showed excellent intra-day and inter-day precisions of < 1.5% CV. The results 

from two different peptides agreed with 5% CV with excellent reproducibility (< 2%). 

At last, the results by sulfur content showed excellent reproducibility within 3% CV. 

The hGH contents from three different methods were agreed with 5% bias. Sulfurbased 

result showed a little higher value with smaller uncertainty whereas amino 

acid-based result showed a lower value, and peptide-based result was in between but 

showed a little larger uncertainty (5%). 

Conclusion: The concentration of the hGH was therefore determined based upon 

the concentration of tryptic peptides, and the concentration of hydrolyzate amino 

acids, and the concentration of sulfur as well. Although the results were presented 

small bias, each method is suitable for the accurate quantification of hGH, and could 

satisfactorily serve as a reference analytical procedure for hGH and other similar 

proteins. Moreover, these three different methods provide an alternative method for 

absolute quantification of proteins, especially for pure protein standards. Further 

researches to resolve small discrepancy among them is in progress. 

A-156 

A Sensitive and Rapid Liquid Chromatography-Tandem Mass 

Spectrometry Method for Quantification of Lacosamide and Desmethyl 

Lacosamide using Lacosamide- 13 C,d3 as Internal Standard 

D. A. Payto, S. Wang. Cleveland Clinic, Cleveland, OH 

Background: Lacosamide (LCM) is an antiepileptic drug (AED) approved by the 

FDA in October 2008 for the adjunctive treatment of partial onset seizures. The major 

metabolite in human is O-desmethyl lacosamide (ODL). Monitoring LCM and ODL 

may help physicians to optimize the therapeutic dosing. Though there are published 

methods for the quantification of LCM by either liquid chromatography-ultraviolet 

(HPLC-UV) or liquid chromatography-tandem mass spectrometry (LC-MS/MS) there 

are few that measure both LCM and ODL simultaneously and none uses an isotope 

labeled internal standard (IS) for LC-MS/MS methods. Our objective was to develop 

and validate a simple, sensitive, and rapid LC-MS/MS assay for the quantification of 

LCM and ODL using lacosamide- 13 C,d 3 

as IS. 

Methods: Serum (25μL) and 150μL IS solution (5μg/mL of lacosamide- 13 C,d 3 

in 

methanol) were vortex mixed and centrifuged. Supernatant (10μL) was mixed with 

1000μL of 0.1% formic acid in water and 3μL was analyzed on an Accucore C18 

column in an LC-MS/MS system. Total chromatographic time was 6.5 minutes. A 

quantifier and a qualifier transition were monitored for LCM (quantifier, 251.1→108.0 

and qualifier, 251.1→116.1) and ODL (quantifier, 237.1→108.0 and qualifier, 

237.1→91.1). 

Results: LCM was linear from 0.65 to 44.56 μg/mL with analytical recoveries ranging 

from 89.7 to 104.8%, while ODL was linear from 0.76 to 48.84 μg/mL with analytical 

recoveries of 97.8-122.0%. The total coefficient of variation was



Results: Comparing to acidic mobile phase buffers, alkaline buffers resulted in higher 

mass spectrometry response, increased chromatographic retention, and better peak 

shape for all three analytes. No matrix effects were observed only after turbulent 

flow on-line extraction. The lower limit of quantification was 0.36, 0.32, and 0.38 

ng/mL for nicotine, cotinine, and nornicotine, respectively, while accuracy was 91.6- 

117.1%. No significant carryover was observed up to 550 ng/ml of cotinine, 48 ng/mL 

of nicotine, and 48 ng/mL of nornicotine. Total coefficient of variation was less than 

6.5% for the analytes at three concentration levels tested. Measurement of nicotine 

and cotinine was compared with an LC-MS/MS method offered by an independent 

lab using 21 leftover patient serum specimens and 20 spiked blank serum samples. 

For nicotine, Deming regression showed a slope of 0.914, an intercept of -0.2 ng/ 

mL, and a correlation coefficient of 0.9941 with a mean difference of 8.9%. For 

cotinine, Deming regression rendered a slope of 1.089, an intercept of 1.8 ng/mL, and 

a correlation coefficient of 0.9964 with a mean difference of -6.8%. No comparison 

was performed for nornicotine due to the lack of a commercial test. 

Conclusion: The newly developed LC-MS/MS method was simple, fast, sensitive, 

and accurate. It was validated to measure nicotine, cotinine and nornicotine in serum 

for monitoring tobacco use. 

A-158 

Do Deuterium Labeled Internal Standards Correct for Matrix Effects 

in LC-MS/MS Assays? A Case Study Using Plasma Free Metanephrine 

and Normetanephrine. 

D. R. Bunch 1 , J. Gabler 2 , J. M. El-Khoury 1 , S. Wang 1 . 1 Cleveland Clinic, 

Cleveland, OH, 2 ThermoFisher Scientifi c, Cleveland, OH 

BACKGROUND: Matrix effect is a major issue complicating analytical 

methodologies for biological matrices by liquid chromatography-mass spectrometry 

(LC-MS). It was traditionally believed that deuterium labeled internal standards (d- 

IS) correct for matrix-dependent ion suppression or enhancement. However, new 

evidence has demonstrated that the degrees of matrix effects for the analyte and its 

d-IS may be different. One hypothesis is due to the slight difference in their retention 

times. This renders it challenging to select an appropriate alternate matrix for 

preparation of calibrators, which is particularly important for analyzing endogenous 

analytes. In this report, we studied a case of uncompensated matrix effects using d-IS 

and the means to test for an appropriate alternative matrix. 

METHODS: The matrix effects of plasma free metanephrine and normetanephrine 

using their respective d3-IS were evaluated by a mixing study. The mixing study was 

performed by separately mixing three male and three female plasma samples with an 

alternate matrix in a 1:1 ratio. The alternate matrix, patient samples, and 1:1 mixed 

samples were extracted in triplicate and run by an LC-MS method. The criterion for 

passing is the measured response ratio (analyte/IS) of each 1:1 mixture being within 

20% of the mean response of the patient and the alternate matrix. 

RESULTS: There was no retention time difference between the d-IS and analytes. 

More than 10 total matrices were tested and the results for six representative alternate 

matrices are listed in the table. Most matrices failed the test indicating differential 

matrix effects for the analytes and their d-IS. The final acceptable alternate matrix for 

this assay was 10 mM ammonium phosphate pH 6.5. 

CONCLUSION: Matrix effects are not always compensated for by using a d-IS. 

However, an acceptable alternate matrix can still be determined by performing mixing 

studies of alternative matrices with patient samples. 

Sample 

Alternate Matrix Tested 

10mM 

Ammonium 

Phosphate 

pH 6.5 

Water 0.1% 

Metabisulfite 

5% 

Albumin 

Drug 

1% Metabisulfite 

Free 

Serum 

Metanephrine 1 -1.5 -23.2 12.7 1.0 6.5 4.0 

2 2.7 24.7 22.8 10.7 3.9 43.8 

3 -5.8 -32.2 1.1 447.0 3.6 -9.2 

4 -2.8 N/A 12.4 0.4 3.7 -5.3 

5 2.9 N/A 59.3 -2.4 45.4 -12.8 

6 0.75 N/A 4.6 24.9 46.3 4.7 

Normetanephrine 1 -0.4 -20.7 12.1 1.9 -13.9 -11.8 

2 3.3 23.2 5.5 6.1 -10.8 -13.6 

3 3.1 -30.1 -4.5 6.9 -4.5 -11.0 

4 1.2 N/A -1.5 6.9 -14.8 -12.9 

5 -1.7 N/A -1.5 15.5 -13.2 -11.7 

6 0.9 N/A 17.4 11.4 -10.1 -10.2 

A-159 

A Simple and Fast Liquid Chromatography - Tandem Mass 

Spectrometry Method for the Quantification of Rapamune and 

Everolimus Without the Use of a Column Heater 

D. A. Payto 1 , C. Yuan 1 , J. Gabler 2 , S. Wang 1 . 1 Cleveland Clinic, Cleveland, 

OH, 2 Thermo Fisher Scientifi c, West Palm Beach, FL 

Background: Rapamune and everolimus are immunosuppressant drugs approved 

by Food and Drug Administration for kidney transplantation. Therapeutic drug 

monitoring of these drugs is recommended due to their narrow therapeutic windows 

and large inter-individual variations. Liquid chromatography-mass spectrometry 

(LC-MS) methods offer specific and sensitive results. In most LC-tandem mass 

spectrometry (LC-MS/MS) methods available in literature, only one selected reaction 

transition is monitored. All published LC-MS/MS methods incorporate the use of a 

column heater to ease the elution. The objective of this work was to develop a rapid 

and robust LC-MS/MS for rapamune and everolimus without the use of a column 

heater. 

Methods: Whole blood (100 μL) and an internal standard solution (300μL; 

rapamune-d3 at 5ng/mL and everolimus-d4 at 10ng/mL in acetonitrile/0.1 M zinc 

sulfate solution 70/30) were vortex mixed and centrifuged. The supernatant (75μL) 

was injected for on-line turbulent flow sample clean-up prior to LC-MS/MS analysis 

using a reverse phase column maintained at room temperature. Total chromatographic 

run time was 3.75 minutes per injection. A quantifier (sum of 931.6→882.4 and 

931.6→864.4) and qualifier (931.6→814.4) transition were monitored for rapamune. 

For everolimus, the quantifier was 975.61→908.7 and qualifier was 975.61→926.9. 

Ion ratio confirmation was used for peak identification. 

Results: No ion suppression was observed for either analyte. No carryover was 

observed up to a concentration of 53.8ng/mL for rapamune and 126.0ng/mL for 

everolimus. Analytical measurement range (serial dilution of a spiked patient pool), 

analytical recovery, and CV (based on CLSI EP10-A3 guidelines) are shown in table 

1. Comparison with a previously validated LC-MS/MS method yielded agreeable 

results with mean differences of 11% for rapamune and -3.6% for everolimus. 

Conclusion: This validated LC-MS/MS method offers rapid and robust quantification 

of rapamune and everolimus without the use of a column heater. This assay has been 

validated for clinical use. 

Table 1. Method Validation 

Rapamune 

Everolimus 

Analytical Measurable Range 0.6 - 54.0 ng/mL 0.6 - 60.9 ng/mL 

Analytical Recovery (%) 90.0 - 100.1 94.4 - 102.9 

Total CV (%) 4.4 - 7.3 2.5 - 6.6 

Intra-Assay CV (%) 3.3 - 7.3 2.0 - 6.6 

A-160 

Development of an LC-MS/MS method for the quantitation of serum 

Androsta-4,16,-dien-3-one 

X. Yi, E. K. Leung, D. W. Kern, M. K. McClintock, C. C. Lee, K. T. J. Yeo. 

The University of Chicago, Chicago, IL 

Background: The putative human pheromone androstadienone (androsta-4,16,- 

dien-3-one) has been shown to modulate psychological, physiological, and hormonal 

outcomes including reduced perception of pain, increased attention to emotional 

stimuli, and modulation of cortisol levels, but there is currently no reliable way to 

measure its production. The purpose of this research study is to develop a method 

using liquid chromatography tandem mass spectrometry (LC-MS/MS) for reliably 

detecting minute amounts of androstadienone in human blood, and to utilize such 

a method for future studies to measure individual variation in rates of production of 

androstadienone associated with various emotional stimuli. 

Methods: Androstadienone standard and androsterone-d2 internal standard (IS) were 

purchased from Steraloids, Inc (Newport, RI). 190 μl of androstadienone in charcoalstripped 

serum was combined with 10μl of 200ng/ml IS, and extracted with methyl 

t-butyl ether (MTBE). The organic phase was evaporated and the dried residues 

were derivatized in hydroxylamine hydrochloride (0.7mol/ L, 3:7 methanol/water) 

at 70°C for 15min. Androstadienone and IS were detected by electrospray ionization 

in positive mode with the following transitions: Androstadienone 286>114 and IS 

306>133. LC-MS/MS setup consisted of a Thermo Accela 600 pump interfaced to 

a Thermo TSQ Quantum triple quadrupole mass spectrometer. Chromatographic 

separation was performed using a Phenomenex luna 3μ phenyl hexyl column (2.0mm 

by 150 mm) and a gradient of 0.1 % formic acid and methanol. To evaluate the 


A45



performance of this method, accuracy and precision of this method were measured 

using 4 points (0.1ng/ml, 0.3ng/ml, 4.0 ng/ml and 8.0ng/ml) on each calibration curve 

and the reproducibility was measured for 4 subsequent days. 

Results: The method described displayed good linearity over a concentration range 

of 0.1-10ng/ml with r2 >0.995, and measured CVs for calibration standards were less 

than 15% across the entire concentration. Intra-day and inter-day precision for all 

QC levels showed CVs ≤10.96% and ≤10.21%, respectively; the inter-day accuracy 

(RE%) for QC serum samples were ≤11.0%, all within the acceptable limits of 

precision and accuracy ( ≤ 15%). The method was applied to determine the plasma 

concentration of androstadienone in a relatively healthy population (primary care 

outpatient population) which showed a preliminary reference range of 0.00-1.05 ng/ 

ml (n=20). 

Conclusion: A sensitive LC-MS/MS method was developed for androstadienone in 

human serum. The validation study showed the method is accurate and reproducible 

and can be used for further studies of changes of this pheromone in subjects under 

different emotional states. 

A-161 

High-Throughput determination of 25-OH-Vitamin D2 and D3 in 

plasma in 9 seconds per sample using LDTD-MS/MS with Differential 

Mobility Spectrometer for Isobaric separation 

P. Picard, S. Auger, G. Blachon, J. Lacoursiere, A. Birsan. Phytronix 

Technologies Inc, Quebec, QC, Canada 

Background: The Laser Diode Thermal Desorption (LDTD) ionization source 

has been coupled to a mass spectrometer equipped with SelexION differential ion 

mobility cell, enabling a high throughput capacity for the analysis of 25-OH-vitamin 

D2 and D3 in biological matrix, with sample-to-sample analysis time of 9 seconds. 

The endogenous isobaric compounds 7α-OH-cholesten-2-one and 1-α-OH-D3 are 

known to interfere with similar MS/MS transition as 25-OH-D3. Thermal desorption 

process vaporizes all compounds simultaneously, so isobaric molecules with similar 

structure may potentially interfere. Improvement of the analysis specificity is 

achieved by the action of the Differential Ion Mobility Spectrometry. Desorption of 

individual compounds at the optimized DMS parameters demonstrates specificity 

equivalent to liquid chromatography but at the speed of electronic separation, in 

milliseconds. 

Methods: Preparation of sample consisted of a protein precipitation of human 

plasma by addition of methanol followed by a liquid-liquid extraction with hexane. 

5 μL of the upper layer is deposited in proprietary 96-wells plate and allowed to dry 

prior to analysis. Calibration curve is prepared using multilevel calibrator set from 

Chromsystem. Additional curve levels are prepared by dilution of calibrator with 

stripped serum. The mass-spectrometer operates in MRM mode, with transitions 

413/337 and 401/355 used for quantification of 25-OHD2 and 25-OH-D3 respectively. 

Separation voltage applied to the DMS cell of the SelexION is 4400 Volts, and the 

compensation voltage used to isolates the two compounds from interferences is 10 

Volts 

Results: Quantitation curve ranges from 1-65 ng/mL and 1.5-94 ng/mL for 25-OH- 

VitaminD3 and D2 respectively. Blank levels are less than 20% of the LOQ for both 

compounds. To assess the accuracy and precision, calibration points and QC’s are 

analyzed in triplicate. Reproducibility for n=3 is ranging from 0.6 to 12.3%. Calculated 

concentrations of QC’s are within 15% of reported values. Correlation between LC- 

MS/MS and LDTD-MS/MS samples is expressed by R2 = 0.952. Multiple tests are 

conducted for validation. Matrix effect is evaluated by first measuring the original 

level of 6 different plasma samples and spiking them with a known amount of 25- 

OH-D3. We observe constant difference between pre-spiked and post-spiked results. 

Cross validation of the method is achieved with samples measured by LC-MS/MS 

using an established, and validated, method at the Toronto General Hospital. The 

passing-Bablok regression revealed no significant deviation from linearity (Cusum 

test, P=0.10). Bland and Altman plot shows that the mean bias of the two methods 

was -0.885 and all samples are within the confidence interval of 95%. LDTD-MS/MS 

analysis reproducibility on those measurements is ranging from 1.3 to 13.8% (n=3). 

Conclusion: LDTD ion source coupled to SelexION DMS achieves specific 

analysis of 25-OH vitamin D2 and D3 in the appropriate concentration ranges. 

SelexION DMS increases selectivity and helps in removing isobaric interferences. 

LC-MS/MS and LDTD-MS/MS measured values on real samples correlate within 

95% confidence interval of statistical analysis. LDTD provides the High-Throughput 

analysis of 25-OH vitamin D2 and D3 in 9 seconds sample-to-sample. 

A-162 

Development of A High Performance Liquid Chromatography-Tandem 

Mass Spectrometry Method (HPLC-MS/MS) for Pain Management 

Testing in Urine 

I. Shu, P. Wang. The Methodist Hospital, Houston, TX 

Background: There is currently a growing, deadly epidemic of prescription pain 

killer abuse in the United States. A pain management program is necessary to monitor 

patient compliance. The objective of this project was development of an HPLC-MS/ 

MS assay detecting a total of 21 drugs and metabolites in urine. 

Methods: The HPLC-MS/MS quantitative assay included 5 glucuronide-conjugated 

compounds (morphine-3-glucuronide, morphine-6-glucuronide, oxymorphone-3- 

glucuronide, hydromorphone-3-glucuronide [H3G], and codeine-6-glucuronide 

[C6G]), and 16 drugs and metabolites. Using Bio-Rad Drug Free Urine, the singlepoint 

glucuronide calibrator was prepared at 50ng/mL, and all other drugs (except 

fentanyl) were prepared at five levels in a range of 20-1000 (fentanyl 1-50) ng/ 

mL. The calibrators were further diluted to 1-10ng/mL to determine lower limit of 

quantitation (LLOQ) tested for three days. Quality controls (QC) were prepared 

at levels of 25% below and above cut-off values: 250ng/mL for amphetamine/ 

methamphetamine, 50ng/mL for glucuronides/methadone/EDDP/tramadol, 5ng/mL 

for fentanyl, and 100ng/mL for benzoylecgonine and all other analytes. Accuracy was 

tested by recovering three different known levels of compounds spiked into three 

patient drug-free urine samples with pH range of 5.5-7.0 and presence or absence of 

ketones, protein, leukocyte esterase, and blood as determined by iChem® urinalysis. 

One hundred microliter of urine was diluted by 500 microliter of 0.2% formic acid 

solution containing 19 internal standards (Cerilliant) at 10ng/mL. The 21 analytes 

were separated by Waters XSelect HSS T3 2.1x75mm, 2.5 microm column with a 

binary mobile phase (A: 2 mM ammonium formate, 0.2% formic acid in water; B: 

10mM ammonium acetate, 0.1% formic acid in methanol) within 13.5 minutes at 

a flow rate of 0.3 mL/min, eluting to Waters Quattro Micro mass spectrometer with 

electrospray ionization in a positive mode. Chromatographic peaks of each analyte 

were acquired with quantitating and confirmatory ion transitions at cone voltages and 

collision energies unique to each compound. 

Results: All analytes were linear within their calibration curves (slope 0.97-1.08, 

intercept -1.98-1.89, r 2 >0.950). Coefficient of variations (CV) of QC within-run 

(n=10) and between-run over four days (n=30) were 1.6-14.5%. LLOQ (CV



Objective: The goal of this study was to verify that tryptic peptides could be used to 

quantitate Infliximab and to differentiate the drug from other human immunoglobulins 

in serum. 

Methods: A list of tryptic peptides unique to the heavy and light chain variable 

regions were predicted by in silico digestion of Infliximab variable region sequences 

found in the IMGT database (http://www.imgt.org/3Dstructure-DB). Infliximab 

(RemicadeTM, Janssen Biotech, Inc.) was reconstituted to 10 mg/mL in 50 

mM ammonium bicarbonate, reduced, alkylated and digested with trypsin (1:20 

enzyme:substrate) at 37oC for 4 hours. Digests were analyzed by IDA LC-ESI-Q- 

TOFMS; the most abundant peptides matching the in silico list were chosen for 

subsequent studies. Quantitation of Infliximab was accomplished using standard SRM 

analysis on an ABSciex API 5000 using pooled human serum from healthy controls 

or 50 mM ammonium bicarbonate, each spiked with Infliximab. A 9-point standard 

curve was generated [blank, 0.25, 0.5, 1, 2, 5, 10, 20 and 50 ug/mL]. A known 

concentration of purified horse IgG (200 ug/mL) with a unique non-human constant 

region peptide was added to each sample as a pre-analytical digestion control along 

with stable isotope-labeled peptide internal standards to monitor HPLC retention 

times. Samples were processed to remove non-immunoglobulin proteins using the 

Melon Gel purification kit (Pierce, Rockford, IL), followed by trypsin digestion. 

Peptides were separated on reverse-phase C18 liquid chromatography (Atlantis T3 

3x100 mm) and subjected to MS/MS. 

Results: Tryptic peptides unique to Infliximab were identified for both the heavy 

and light chains and blasted against a human database; no significant cross-matches 

were identified. Heavy and light chain peptides were quantitated in buffer with a 

coefficient of variation (CV) of 11% and 5%, respectively, measured by the analyte/ 

horse IgG peak-area ratio at 20 ug/mL Infliximab. Limit of detection was 0.25ug/ 

mL, with a linear dilution response between 100-0.25 ug/mL (R2>0.99) for both 

heavy and light chain peptides. After spiking Infliximab into the serum matrix, 

CVs of 20% were obtained for the heavy and light chain peptides, with the lowest 

detectable concentration at 5.0ug/mL. The dilution response was linear from 50-2 ug/ 

mL (R2>0.99) for both peptides. 

Conclusions: While sensitivity and precision merit further development and studies 

with samples from patients taking Infliximab are warranted, we have demonstrated the 

ability to quantitate Infliximab using variable region peptides by LC-MS/MS in the 

presence of other human immunoglobulins. This analytical approach has the potential 

to be quickly adaptable to other drugs in this class and to significantly improve patient 

care. 

A-164 

A Liquid Chromatography Tandem Mass Spectrometry Method 

for Measurement of Erythrocyte 6-Mercaptopurine Metabolites in 

Patients on Thiopurine Therapy 

I. Tsilioni, T. Law, J. Dunn, R. W. A. Peake, M. D. Kellogg. Boston 

Children’s Hospital, Boston, MA 

Background: Thiopurine drugs such as 6-mercaptopurine (6-MP) and azathioprine 

are used as immunosuppressive agents for the treatment of inflammatory 

bowel disease (IBD). Measurement of erythrocyte 6-thioguanine (6-TG) and 

6-methylmercaptopurine (6-MMP) concentrations is advocated for the purpose 

of obtaining baseline levels prior to commencement of therapy and for monitoring 

levels in patients receiving treatment. We describe a liquid chromatography tandem 

mass spectrometry (LC-MS/MS) method for measurement of 6-TG and 6-MMP in 

erythrocytes. 

Materials and Methods: 6-thioguanine nucleotides (6-TGNs) and 

6-methylmercaptopurine nucleotides (6-MMPNs) were extracted from 100 uL 

of erythrocytes with perchloric acid and hydrolyzed to form 6-TG and 6-MMP 

respectively. Liquid chromatography was carried out using a Shimadzu SIL20AC 

autosampler with 20AD pumps (Shimadzu Corporation, Tokyo, Japan) utilizing an 

XSelect HSS T3 5μm (3.0 x 100 mm) analytical column (Waters Corporation, 

Milford, MA). Compounds were separated by gradient elution using 0.1% formic acid 

in water and acetonitrile as buffers A and B respectively. A flow rate of 0.5 mL/min 

was used throughout. An API-5000 triple quadropole mass spectrometer (ABSciex, 

Framingham, MA) utilizing atmospheric pressure chemical ionization (APCI) was 

used for analysis. Data was acquired in Multiple Reaction Monitoring mode (MRM) 

and analysis time was 5 minutes. Mass transitions for quantification were monitored 

for 6-TG (m/z 168/107) and 6-MMP (m/z 167/152). Quantitation was carried out 

using the internal standard (IS) ratio method with 8-Bromoadenine. The method was 

evaluated in accordance with standard protocols. Method comparison was carried out 

by comparing analysis of 70 samples from IBD patients receiving thiopurine therapy 

with a reference LC/MS/MS method. 

Results: Optimal assay performance was achieved using a minimum volume of 500 

μL whole blood. Total assay imprecision was determined for 6-TG at 0.97 (RSD = 

13.4%), 3.24 (RSD = 9.3%) and 11.9 (RSD = 9.2%) pmol/0.8 Brbc (where B = 8x10 8 ). 

Imprecision was determined for 6-MMP at 10 (RSD = 14%), 41 (RSD = 10%) and 

109 (RSD = 12%) pmol/0.8 Brbc. LOQ for 6-TG and 6-MMP were 0.05 μmol/L and 

0.5 μmol/L respectively. The correlation between our method and the comparative 

method was favorable for 6-TG (R = 0.95; slope = 0.91; intercept = 30.2 pmol/0.8 

Brbc) and 6-MMP (R = 0.92; slope = 0.91; intercept = 734 pmol/0.8 Brbc). Values 

produced using the reference method were moderately higher for both 6-TG (mean 

bias: 7 pmol/0.8 Brbc; 95% limits of agreement: -77 to 90) and 6-MMP (mean bias: 

412 pmol/0.8 Brbc; 95% limits of agreement: -2031 to 2854). 

Conclusion: We have developed a LC/MS/MS method for measurement of 6-TG 

and 6-MMP using minimal sample volume for pediatric applications. Excellent 

chromatographic separation was achieved within a run time of 5 minutes using a 

modified C18 column exhibiting enhanced retention for the polar thiopurines. Our 

MS method utilizes APCI ionization enabling the detection of the molecular ion 

species at high abundance. Assay performance was acceptable for imprecision and 

bias. Method comparison data from 70 patients undergoing thiopurine therapy showed 

favorable correlation with a reference method. The clinical interpretation of data was 

also consistent between the two methods. 

A-165 

Identification of plasma biomarkers of chronic drug exposure in a rat 

model 

X. Xie 1 , D. Lopez-Ferrer 1 , G. Gil 1 , Y. Karpievitch 1 , B. Nguyen 1 , K. Carr 2 , 

H. Schulman 1 , D. Chelsky 3 , S. Roy 1 . 1 Caprion Proteomics US LLC, Menlo 

Park, CA, 2 New York University, New York, NY, 3 Caprion Proteome Inc., 

Montreal, QC, Canada 

Background: Identifying patients in need of treatment for substance use disorder 

and monitoring their drug use is a necessary step for effective treatment. Previous 

proteomic studies of drug abuse or exposure focus on the analysis of cell lines or 

tissues as the detection of affected plasma proteins is very challenging. The goal of 

this study was to test the feasibility of detecting changes in plasma proteins following 

chronic drug exposure in a rat model. The specific aims were to detect and validate 

proteomic biosignatures that correlate with behavioral and neurochemical sequelae 

in animal models of cocaine, morphine, and nicotine exposure. This initial discovery 

strategy could then be used to identify patients predisposed to repeated drug use and 

thereby facilitate early intervention. 

Methods: Plasma was obtained from rats receiving chronic treatment with cocaine 

or with a methylphenidate challenge following end of cocaine administration, 

or morphine or nicotine. Depletion of abundant proteins was utilized to yield 

low-abundant proteins followed by trypsin digestion and peptide desalting. Peak 

alignment, extraction, and label-free quantitation of isotope group components was 

conducted followed by intensity normalization. Component differential expression 

was obtained by multivariate statistical analysis. After peptide profiling by nano-liquid 

chromatography-mass spectrometry (nano-LC-MS) and sequencing by LC-MS/MS, 

protein differential expression and identification were achieved. Mass spectrometricbased 

multiple reaction monitoring (MRM) assays are being performed in a second set 

of animals to verify these potential biomarker candidates. 

Results: Only 1 μL of crude rat plasma before depletion was sufficient for downstream 

analysis including nano-LC-MS and LC-MS/MS and allowed us to quantify and 

identify differentially expressed rat plasma proteins following chronic cocaine, 

morphine or nicotine administration as compared to saline. In addition, expression 

of plasma proteins evoked by a methylphenidate challenge following end of chronic 

cocaine administration were measured. In total, ~500 rat plasma proteins were 

identified by LC-MS/MS. Among them, more than 50 proteins were differentially 

expressed at 0, 3, 15, and 30 days after termination of 14 consecutive days of chronic 

cocaine administration. We found different patterns of changed proteins including 

consistent change, early change, or late change in the four time points monitored for 

the cocaine cohort compared to saline treated cohort. Some proteins were correlated 

with neuron or brain function in response to drug administration. We also measured 

the altered expression of plasma proteins following administration of morphine and 

nicotine, as well as changes evoked by methylphenidate challenge at 0 and 30 days 

following end of chronic cocaine administration. Targeted MRM assays are being 

conducted in an independent cohort to validate the protein changes. 


A47



Conclusion: Results imply that similar studies in humans may be feasible in the 

near future for monitoring the drug use of patients addicted to such substances. A 

biosignature that reliably reports on drug exposure up to 30 days following last drug 

use, when the drug and its metabolites are no longer detectable, would help to identify 

patients predisposed to repeated drug use and thereby facilitate early intervention. 

A-166 

Quantitative analysis and characterization of 25-Hydroxy-Vitamin 

D3 and D2 and 3-Epi-25-Hydroxy-Vitamin D3 and D2 by Liquid 

Chromatography Triple Quadruple Mass Spectrometry on the Agilent 

Triple Quad 6460 Mass Spectrometer. 

R. M. Doyle. Agilent Technologies, Inc, Wilmington, DE 

Background: Significant levels of the C-3 epimer of 25-Hydroxy-Vitamin D2 and D3 

(C3-Epi-25OHD2 and C3-Epi-25OHD3) have been found to be present in children 

and some adults. Therefore, the C3-Epi-25OHD analyte can be a potential interference 

in the assessment of vitamin D sufficiency and may have some clinical relevance 

to the overall metabolism of Vitamin D which still remains unclear. Therefore, a 

method was developed to resolve and quantify all four of the 25-Hydroxy-Vitamin 

D metabolites (25OHD3, 25OHD2, C3-Epi-25OHD2 and C3-Epi-25OHD3) utilizing 

the same liquid chromatographic and mass spectrometer parameters as for the analysis 

of just 25OHD3 and 25OHD2 alone. 

Methods: An Agilent 6460 tandem mass spectrometer with Jet Stream technology 

in positive Electrospray mode and an Agilent Infinity 1260 HPLC system were 

utilized for this analysis. 150 ml of human serum was used for the analysis of the 

25OHD metabolites and the sample preparation involved liquid-liquid extraction 

(LLE). Various columns were evaluated and an Agilent Pursuit PFP 100 x 3 mm, 

2.7 um with water:methanol containing 0.1% formic acid gradient achieved baseline 

chromatographic separation of the four epimer and non-epimer metabolites in less 

than 6 minute run time. Quantitative analysis was performed using multiple reaction 

monitoring (MRM) transition pairs for each analyte and internal standard in positive 

mode and accuracy of the method was verified using reference materials from NIST 

(SRM 972) and serum adult samples 

Results: Good linearity and reproducibility were obtained with the concentration 

range of 0.5 ng/ml to 500 ng/ml for all the 25OHD metabolites with a coefficient 

of determination >0.99. The lower limits of detection (LLOD) and lower limit of 

Quantitation (LLOQ) were determined to be at least 0.25 ng/ml and 0.5 ng/ml. The 

calculated mean of adult samples for Total 25(OH)D concentration was 27.4 ng/ml and 

C3-Epi-25(OH)D concentration was 0.75 ng/ml respectively. The chromatographic 

separation of 25(OH)D3 from C3-Epi-25(OH)D3 for NIST SRM 972 Level 4 by five 

replicates resulted in mean 33.1 ng/ml and 37.3 ng/ml levels with %CV of 5.83 and 

6.42 respectively. 

Conclusion: A sensitive, simple, specific and accurate liquid chromatographytandem 

mass spectrometry method was developed and validated for the simultaneous 

measurement of 25OHD and C3-Epi-25OHD metabolites in human serum. 

A-167 

Ultra sensitive quantitative analysis of Total and Free Testosterone 

in serum using Liquid Chromatography Triple Quadruple Mass 

Spectrometry with Ion Funnel Technology in Positive Electrospray 

Modes. 

R. M. Doyle 1 , A. Szczesniewski 2 . 1 Agilent Technologies, Wilmington, DE, 

2 

Agilent Technologies, Schaumberg, IL 

Background: Testosterone is the major androgenic hormone that is responsible for 

the development of the male external genitalia and secondary sexual characteristics 

while in females, it is an estrogen precursor. It exerts anabolic effects and influences 

behavior in both genders. Circulating testosterone is bound to sex hormone-binding 

globulin (SHBG) and a fraction is albumin bound and a small proportion exists as free 

hormone. The non-SHBG-bound testosterone is the biologically active component 

since serum albumin bound testosterone can dissociate freely. An ultra sensitive 

quantitative analytical method was developed for Total and Free Testosterone to be 

able to measure its levels in children and women and also to determine how much is 

biologically active and present in males as well. 

Methods: An Agilent 6490 tandem mass spectrometer with Ion Funnel technology 

and an Agilent Infinity 1290 HPLC system were utilized in positive Electrospray 

(ESI) mode. 200 μl of human serum was used for the analysis of Total Testosterone 

and the sample preparation was liquid-liquid extraction. The sensitivity of the assay 

and the instrument was compared using derivatized and underivatized testosterone 

to determine which gave the best response. The derivatives that were investigated 

included hydroxylamine, carboxymethylpyridine, picoloinic acid, etc. 500 μl 

of human serum was used for the analysis of Free Testosterone and the sample 

preparation was dialysis using Harvard Apparatus micro dispo-dialyzers and was also 

compared derivatized and underivatized. A Poroshell 120 EC-C18 column (2.1 x 50 

mm, 2.7 um) was used for one-dimensional separation with a run time of 5 minutes. 

Quantitative analysis was performed using multiple reaction monitoring (MRM) 

transition pairs for each analyte and internal standard in positive mode. 

Results: Good linearity and reproducibility were obtained with the ultra sensitive 

concentration range of 5 pg/ml to 5000 pg/ml for the Total Testosterone and the Free 

Testosterone underivatized. The lower limits of detection (LLOD) were achieved 

for the Total and Free Testosterone at 2.5 pg/ml. The intra- and inter-day CV’s were 

< 8.5% and between 3% to10% respectively for the underivatized Total and Free 

testosterone. For the derivatized testosterone, the initial ultra sensitive concentration 

range of 0.5 pg/ml to 5000 pg/ml was achieved with oxime derivatization of Total 

and Free Testosterone with an LLOD of 0.1 pg/ml being obtained. The methods were 

compared using measurements from Standard reference material (SRM 971) from 

NIST and submitted samples. Further analysis on the derivatives is being carried out 

to determine which derivative gives the best response while at the same time offering 

ease of use. 



measurement of Free and Total Testosterone in human serum. The underivatized and 

derivatized Total and Free testosterone were evaluated and although underivatized 

testosterone gives sensitive results, the oxime derivatized testosterone is giving better 

sensitivity. Further work is being carried out using other derivatives as to which 

reagent gives the best results. 

A-168 

Quantitative analysis of Free Estrogens in serum and the evaluation 

of sample preparation techniques using Liquid Chromatography 

Triple Quadruple Mass Spectrometry with ion Funnel Technology in 

Negative ESI Modes 

R. M. Doyle 1 , A. Szczesniewski 2 . 1 Agilent Technologies, Inc, Wilmington, 

DE, 2 Agilent Technologies, Inc, Schaumberg, IL 

Background: Estrogens are involved in the development and maintenance of 

the female sexual characteristics, germ cell maturation, and pregnancy as well as 

growth, nervous system maturation, bone metabolism/remodeling, and endothelial 

responsiveness. The active estrogens in non-pregnant humans are estrone (E1) and 

estradiol (E2) while estriol (E3) is the main pregnancy estrogen only in women. 

Estrogens are produced primarily in ovaries, testes, the adrenal glands and some 

peripheral tissues. Measurement of serum estrogens are needed in the assessment 

of reproductive function in female and are used to monitor ovulation induction. 

Ultra sensitive Estrogen measurements are required for inborn errors of sex 

steroid metabolism, disorders of puberty, estrogen deficiency in men, fracture risk 

assessment in menopausal women, and increasingly for therapeutic drug monitoring. 

The ultra sensitive measurement of Free Estrogens are required since they a bound 

to sex hormone-binding globulin and albumin with approximately 2.21% free 

and biologically active. In order to address these challenges, a sensitive liquid 

chromatography-tandem mass spectrometry method for the simultaneous analysis 

of Estradiol and eventually Estrone and Estriol in serum samples was developed. 

Sample preparation methods for the detection of Free Estrogens using derivatization 

were developed and evaluated for their suitability for enhanced detection and ease of 

utilization. 


and an Agilent Infinity 1290 HPLC system were utilized in both positive Electrospray 

(ESI) modes. 500 μl of human serum was used for the analysis of Free Estrogens and 

the sample preparation investigated and compared included ultracentrifugation using 

Amicon centrifugal units and equilibrium dialysis using Harvard Apparatus micro 

dispo-dialyzers. The sample was then derivatized with Dansyl Chloirde. A Poroshell 

120 EC-C18 column (2.1 x 150 mm, 2.7 um) was used for one-dimensional separation 

with a run time of 6.5 minutes. Quantitative analysis was performed using multiple 

reaction monitoring (MRM) transition pairs for each analyte and internal standard in 

positive and negative mode. 





range of 0.25 pg/ml to 1000 pg/ml for Free Estradiol while Free Estrone and Estriol 

is still being evaluated. The best lower limits of detection (LLOD) of Free Estradiol 

were achieved at 0.1 pg/ml and comparable between the two sample preparation 

techniques with equilibrium dialysis showing slightly better overall background. The 

intra- and inter-day CV’s for Free Estradiol has been to be



Results: No matrix effect or interference was found. Lower limits of quantifications 

were 9.7, 9.6, and 4.9 ng/mL for buprenorphine, norbuprenorphine and 6-MAM, 

respectively. Within the linear range, analytical recovery was 80.5-113.0% for all 

analytes. Intra-assay and total coefficient of variations were between 0.2% and 10.3%. 

This method demonstrated consistent patient results (n=40) with the independent 

LC-MS/MS methods offered by two other laboratories. Percentage of glucuronide 

conjugation of 6-MAM varied from 0 to 45% in 8 patient urine samples positive for 

6-MAM. 

Conclusion: We have successfully expanded current pain management panel to 

include buprenorphine and heroin with high sensitivity, specificity, and precision. 

A-172 

Difference in 25-hydroxyvitamin D results measured by an LC-MS/MS 

versus an immunoassay resulted in outcome discrepancy of a clinical 

trial supplementing vitamin D in CKD patients 

J. M. El-Khoury, J. Hyland, J. Simon, S. Wang. Cleveland Clinic, 

Cleveland, OH 

Background: Vitamin D deficiency is common in the chronic kidney disease 

(CKD) population and is treated according to the 2003 K/DOQI Clinical Practice 

Guidelines for Bone Metabolism and Disease in CKD. These guidelines recommend 

administration of variable high dose vitamin D 2 

regimens based on the severity of 

vitamin D deficiency. Some studies have shown that these guidelines may not be 

adequate, and that vitamin D 3 

therapy may be more efficient than vitamin D 2 

. In this 

report, our objective was to compare 25-hydroxyvitamin D (25OHD) results measured 

by a chemiluminescent immunoassay (CLIA) to those by a liquid chromatographytandem 

mass spectrometry (LC-MS/MS) assay in a randomized clinical trial with two 

groups of CKD patients receiving vitamin D2 and vitamin D3 treatments, respectively. 

Methods: This was a double blinded study with patient enrollment over the course 

of 10 months. All subjects (n=16) enrolled after consent were adults with stage 3 or 

4 CKD and vitamin D deficiency (25OHD < 30 ng/mL) as determined by the CLIA. 

Subjects were randomized to receive either vitamin D 2 

or vitamin D 3 

(50,000 IU once 

per week for 4 weeks then monthly thereafter for those with 25OHD between 5 and 

15 ng/mL or 50,000 IU once per month for those with 25OHD between 16 and 30 

ng/mL). Subjects were followed for the 6 months of treatment. The two groups were 

balanced (n = 8 in each treatment arm). For every patient, 25OHD was measured 

every 6 weeks by an FDA-approved CLIA (Diasorin Liaison) and the sample was then 

frozen at -80°C and measured at the conclusion of the study by an LC-MS/MS assay 

in two random batches. The primary endpoint was percentage of the subjects reaching 

vitamin D sufficiency (25OHD > 30 ng/mL) after 6 months of treatment. 

Results: Deming regression demonstrated a poor correlation between the two 

methods (n=76, slope=0.837, intercept=1.18, r=0.5386). Furthermore, the CLIA 

results showed that only 50% of subjects in either treatment groups reached 25OHD 

level of > 30 ng/mL, while the LC-MS/MS revealed that 100% of D3 and 50% of D2 

treated groups reached the sufficient level by the end of the study. In addition, the 

LC-MS/MS results of the D2 treated group displayed a significant trend of declining 

25OHD3 levels as the treatment progressed, which explains the modest increase in 

total 25OHD in that group compared to the D3 treated group. 

Conclusion: The CLIA and LC-MS/MS assays showed poor correlation in a 

population of stage 3 or 4 CKD patients treated with either vitamin D2 or D3. 

Importantly, the CLIA underestimated the total amount of 25OHD when compared 

with the LC-MS/MS and may result in falsely classifying patients as vitamin D 

deficient or non-responsive to treatment. Supplementation with vitamin D3 based 

on K/DOQI guidelines successfully addressed the vitamin D deficiency issue in this 

CKD population. It is important to employ an LC-MS/MS method for monitoring 

vitamin D status in the patient population. 

A-173 

Adult African American and Caucasian Reference Intervals for 25-OH 

Vitamin D3. 

Method: The study group consisted of 460 healthy outpatients between the ages of 

20-70 years in whom only serum 25-OH Vitamin D3 (and no D2) was found. 25-OH 

Vitamin D2 was present in less than 5% and they were not included in the study 

group. The group consisted of 175 African Americans (113 females and 62 males) 

and 295 Caucasians (180 females and 115 males). Samples were drawn between 6am 

and 2pm between April and August for the years 2011 and 2012. An API-4000 tandem 

mass spectrometer (Sciex, Concord, Canada) equipped with TurboIonSpray source 

and Agilent 1200 series HPLC system was used to perform the analysis by using 

isotope dilution with deuterium labeled internal standard, d6-25-OH Vitamin D3. 

100 uL of human serum was deproteinized by adding 150 uL of methanol containing 

internal standards. After centrifugation, 150 uL of supernatant was diluted with 250 

uL of distilled de-ionized water and 100 μL aliquot was injected onto Phenomenex 

Luna C8 (50 X 2.0mm, 5um) column. After a 2 min wash, the switching valve was 

activated and the analytes of interest were eluted from the column with a water/ 

methanol gradient at a flow rate of 0.7 mL/min and then introduced into the MS/MS 

system. Quantitation by multiple reaction-monitoring (MRM) analysis was performed 

in the positive mode. The transitions to monitor were selected at mass-to-charge (m/z) 

401.3→365.1 for 25-OH-Vitamin D3 and 407.3 →371.1 for d6-25-OH Vitamin D3. 

Results: The following reference intervals (ng/mL) were found employing the 

percentile approach. Almost identical results were obtained employing the Hoffmann 

approach (Hoffmann RG JAMA;1963:150-9). Percentile 2.5th-97.5th is 9.4-61.6 for 

Caucasians and 4.1-56.2 for African Americans. 

Conclusions: Our finding that African Americans have significantly lower 25-OH 

Vitamin D3 reference intervals than Caucasians confirms previously published data 

for a combination of D3 and D2. However, reference intervals for 25OH Vitamin D3 

vary with season,Summer intervals being slightly higher than those found during the 

Winter months. The intervals quoted above are for the Spring and Summer months. It 

is also important to note that the reference intervals for 25-OH Vitamin D3 are lower 

than the usually recommended optimal clinical concentrations of 32-100 ng/mL. An 

interesting question for future studies revolves around the PTH /25-OH Vitamin D3 

set-point: is it different for these 2 populations? 

A-174 

Non-radioactive Iothalamate Measurement by Liquid 

Chromatography-Tandem Mass Spectrometry for Determination of 

Glomerular Filtration Rate 

J. M. El-Khoury, H. Rolin, D. R. Bunch, E. Poggio, S. Wang. Cleveland 

Clinic, Cleveland, OH 

Introduction: Glomerular filtration rate (GFR) is commonly determined by measuring 

radioactivity in serum/plasma and urine after infusing radioactive iothalamate. Last 

year we presented a novel liquid chromatography-tandem mass spectrometry (LC- 

MS/MS) method for the measurement of non-radioactive iothalamate and showed 

preliminary comparisons with a GFR method with radioactive measurement (n=10). 

In this report, we present here the full comparison of the GFR results by the LC-MS/ 

MS method with those by the radioactive method using the complete set of study 

subjects (n=36). 

Methods: After consent, the subjects (n = 36) received subcutaneous injections with 

radioactive 125 I-sodium iothalamate in one arm and non-radioactive iothalamate 

meglumine in the other at the same time, followed by bracketed collection of blood 

and urine samples. Alternate (quantitative) method comparison was performed using 

EP Evaluator®. 

Results: Comparison of the GFR results measured by LC-MS/MS with those by the 

radioactive iothalamate method showed a mean difference of 4.78 mL/min/1.73m 2 

(7.3%) and the Deming regression showed a slope of 1.085, intercept of -0.749 and R 

of 0.9886 (Figure). The differences between the two methods were greater at the high 

end of the GFR (8% at GFR >60 mL/min/1.73m 2 ) than those at the low end (4.1% at 



method using samples with elevated 25OHD2 concentrations. The assays compared 

more favorably amongst each other, with the Liaison and Architect having the least 

discrepancy. 

Conclusions: The commercial immunoassays under this evaluation did not offer 

reliable quantitation for samples containing elevated levels of 25OHD2 (>15 ng/mL). 

We recommend that patients on vitamin D2 supplements be measured by LC-MS/MS 

for a more accurate assessment. 

Abbott 

LC-MS/MS Diasorin Liaison Siemens Centaur 

Architect 

LC-MS/MS N/A Duplicate data Duplicate data Duplicate data 

n = 157 

Slope = 0.511 

Diasorin Intercept = 2.338 

N/A Duplicate data Duplicate data 

Liaison Bias = -27.12 

Corr. Coef (R): 

0.39 

Siemens 

Centaur 

n = 150 

Slope = 7.420 

Intercept = -388.3 

Bias = -5.87 


0.13 

n = 148 

Slope = 0.384 

Intercept = 4.14 

Abbott Architect 

Bias = -33.61 


0.51 

A-176 

n = 149 

Slope = 2.410 


Bias = 21.33 


0.85 

n = 148 

Slope = 0.736 

Intercept = 3.168 

Bias = -5.61 


0.92 

N/A 

n = 140 

Slope = 4.184 


N/A 

Bias = 26.63 


0.65 

Duplicate data 

LC/MS/MS Analysis of Serum/Plasma Concentrations of Thyroid 

Hormones in Various Preclinical Species 

L. Luo, J. Colangelo. Pfi zer Inc, Groton, CT 

A-175 

Comparison of Three Commercial 25-hydroxyvitamin D Immunoassays 

with a Liquid Chromatography-Tandem Mass Spectrometry Assay 

Using Samples with Elevated 25-hydroxyvitamin D2 

J. M. El-Khoury, C. Gan, M. Gupta, S. Wang. Cleveland Clinic, Cleveland, 

OH 

Background: Vitamin D, the sunshine vitamin, exists in two biologically active forms, 

vitamin D2 and vitamin D3. Measurement of its metabolite, 25-hydroxyvitamin D 

(25OHD) in serum/plasma is useful for the assessment of a patient’s vitamin D status. 

For accurate assessment of a patient’s vitamin D status both 25OHD3 and 25OHD2 

must be measured equally. Multiple commercial immunoassays for the measurement 

of 25OHD are available and have been largely compared to each other and to the 

gold standard methods, liquid chromatography-tandem mass spectrometry (LC-MS/ 

MS). However, these comparison studies mostly included patients with 25OHD3 and 

very few patients with detectable 25OHD2 (15 ng/mL, as determined by our LC-MS/MS method, were stored 

frozen at -70°C. These samples were later thawed once, kept refrigerated and analyzed 

within a week on the Liaison, Centaur and Architect. EP Evaluator® was used for the 

statistical analysis. 

Results: 25OHD2 concentrations ranged from 15.0 to 87.1 ng/mL and 25OHD 

total concentrations from 23.1 to125.3 ng/mL by the LC-MS/MS method. Assay 

comparison characteristics are summarized in the table below. The slopes and 

intercepts provided in the table were based on Deming regression analyses. The 

commercial immunoassays tested here compared poorly with our LC-MS/MS 

Background: Potential new drugs that enhance metabolism or clearance of thyroid 

hormones in animals often trigger a sequence of toxicity events in preclinical 

toxicology studies, so accurate measurements of thyroid hormones, especially total 

triiodothyronine (T3) and total thyroxine (T4), are important. Thyroid hormones 

are essential hormones for regulation of growth and development in humans and 

preclinical species, and the thyroid can be a major target organ of toxicity during 

drug development. Liquid chromatography - tandem mass spectrometry is an 

emerging technique for the measurement of thyroid hormones in the clinical setting 

and is preferred over immunoassay methods. Preclinically, total T3/T4 are typically 

measured by immunoassays on multiple platforms based on species. The objective 

of this study was to develop and validate a simple and sensitive LC/MS/MS method 

to simultaneously quantify T3/T4 in multiple preclinical species and to determine its 

application in drug development studies. 

Methods: Total T3/T4 were quantified by LC/MS/MS on an AB Sciex 5500 QTrap 

interfaced to a Waters Acquity UPLC system in positive ion mode using stable 

labeled internal standards (T3- 13 C6 and T4-d5). A 100uL aliquot of serum/plasma was 

deproteinized on a Waters Ostra plate by adding 400μL of acidic acetonitrile, and 

chromatographic separations were performed by gradient elution on a Restek Ultra 

Biphenyl column (2.1 x 50 mm, 5 μm). Calibration standards ranging from 0.1 to 

200 ng/mL and quality controls at 2, 10, and 50 ng/mL were prepared in charcoal 

stripped serum. Accuracy and precision were evaluated by analyzing quality controls 

on three different days. Application of the assay to various preclinical species was 

conducted by measuring serum/plasma total T3 and total T4 in rat, mouse, dog, rabbit, 

and monkey samples. Method comparison was performed between LC/MS/MS and 

the corresponding platform used for that specific species. For example, T4 levels in 

dog were compared between LC/MS/MS and the Immulite; for human samples, T3/ 

T4 was compared between mass spectrometry and the Centaur. Biological verification 

was evaluated by providing mice either with an iodine deficient diet supplemented 

with 0.1% propylthiouracil (PTU) or a regular diet as a control for 10 days. Serum 

samples were analyzed for T3/T4 by LC/MS/MS and the Meso Scale Discovery 

(MSD) duplex assay, and the data compared. 

Results: The intra-day and inter-day coefficients of variation (CV) for the LC/MS/MS 

assay were between 3%-12% for both analytes for all three quality control standards, 

and accuracy ranged between 84% to 109%. For each species the intra- and inter-day 

precision were within ±15% for both analytes. The correlations between LC/MS/MS 

and Immulite in dog and rabbit were 0.96 and 0.88, respectively. For human serum 


A51



samples, the regression analyses of T3/T4 concentrations by LC/MS/MS and Centaur 

showed significant correlations as well. As expected, T3 and T4 were significantly 

decreased in the PTU treated mice group as compared to the control group. 

Conclusion: A single LC/MC/MS method was successfully optimized, validated, 

and applied to support toxicology studies for drug development in various preclinical 

species. 

A-177 

Measurement of Urine Catecholamines by AB Sciex 3200 Q-Trap 

Tandem Mass Spectrometer 

A. Lou 1 , L. Coffin 1 , H. Vandenberghe 2 , W. Carroll 1 , L. Brown 1 , B. Nassar 1 . 

1 

Capital Health and Dalhousie University, Halifax, NS, Canada, 2 St. 

Michael’s Hospital and University of Toronto, Toronto, ON, Canada 

Background: Analysis of urine catecholamines is important for the clinical 

diagnosis of catecholamine-secreting neuroendocrine tumors: pheochromocytoma 

or neuroblastoma. Our High Performance Liquid Chromatography-Electrochemical 

Detection (HPLC-ECD) method had major disadvantages: tedious sample preparation 

procedures, long instrument analysis time and potential interference from foods and 

drugs. The current study aimed to develop and validate a fast, accurate and specific 

liquid chromatography tandem mass spectrometry (LC/MS/MS) assay for quantitation 

of urine catecholamines (CATs). 

Methods: Norepinephrine (NE), epinephrine (E) and dopamine (D) were extracted 

from 200 uL of urine by liquid-liquid extraction after the three isotope-labeled 

internal standards, namely deuterated (d)6-NE, d6-E and d4-D were added. CATs 

were separated on an Agilent 1200 LC system with a Kinetex 2.6 micron PFP column 

(100 mm x 3 mm) in a 5-minute isocratic run at a flow rate of 0.4 mL/min. The 

mobile phase consisted of 95% deionized water and 5% methanol with 0.2% formic 

acid. AB Sciex 3200 Q trap tandem mass spectrometer, interfaced with the turbo ion 

spray source, operated in positive mode and controlled by analyst 1.5.1 software, was 

used for characterization and quantitation of CATs by multiple reaction monitoring 

(MRM). The turbo ion source was optimized for CATs using pure compounds 

(Sigma-Aldrich). MRM transitions monitored were m/z 170.2→107.2 for NE 

and 176.2→112.2 for d6-NE, 184.2→107.2 for E and 190.2→112.2 for d6-E and 

154.2→91.1 for D and 158.2→95.2 for d4-D. Standard materials (BioRad) were used 

to determine linearity. Imprecision was calculated by analyzing two levels of BioRad 

quality controls in duplicate for 23 days. Limit of quantitation was determined using 

progressively lower concentrations of diluted BioRad controls. Analysis of CATs was 

performed 20 times over 2 days and the limit was based on coefficient of variation 

(CV) 0.9993). The intra-assay CVs were 7.3% and 5.8% 

for NE at target concentrations of 253 and 1257 nmol/L, 7.0% and 7.1% for E at 

70 and 477 nmol/L and 3.9% and 7.9% for D at 387 and 3461 nmol/L. The limit of 

quantitation was lower than 53.1, 14.8, and 37.9 nmol/L for NE, E and D, respectively. 

Comparison of LC/MS/MS (y) to HPLC-ECD assay (x) gave the Passing-Bablok 

linear regression of y = 1.12x + 0.21 for NE (range of 20-870 nmol/L), y = 1.13x 

+ 2.13 for E (range of 4.0-288 nmol/L) and y = 0.88x + 54.5 for D (range of 102- 

3951 nmol/L). The time for sample preparation was reduced by approximately 40%, 

while the elution time was decreased from 10 to 5 minutes (50%), thus significantly 

impacting analysis time. 

Conclusion: The LC/MS/MS assay for determination of urine CATs is robust, rapid 

and offers improved analytical performance in routine laboratory practice. 

A-178 

Integrated Targeted Quantitation Method for Insulin and its 

Therapeutic Analogs 

E. E. Niederkofler 1 , T. Schroeder 2 , D. Nedelkov 1 , U. A. Kiernan 1 , D. A. 

Phillips 1 , K. A. Tubbs 1 , S. Peterman 2 , B. Krastins 2 , A. Prakash 2 , M. Lopez 2 . 

1 

Thermo Fisher Scientifi c, Tempe, AZ, 2 Thermo Fisher Scientifi c BRIMS, 

Cambridge, MA 

Background: The need to detect and quantify insulin and its analogs has become 

paramount for both medical and sports doping applications. Insulin levels are typically 

present at sub ng/mL levels and are generally in the presence of low molecular weight 

background material requiring extraction/enrichment to increase the concentration 

prior to detection/quantitation. In addition, slight sequence variations are used to 

change the bioavailability further complicating high-throughput quantitation. To 

date, researchers have utilized generic enrichment methods such as SPE to decrease 

background matrix effects. We have developed a pan-insulin antibody capture method 

coupled to LC-SRM for high-throughput quantification for human insulin and 

variants. 

Methods: A series of samples were prepared neat and in serum using human 

insulin and five additional variants. The different insulin analogs were prepared 

independently and mixed at different levels to test the selectivity and sensitivity of the 

enrichment method employed. Target enrichment was performed using custom MSIA 

D.A.R.T.’S derivatized with a pan-anti insulin antibody. All detection and quantitation 

experiments were performed using LC-SRM on a newly released triple quadrupole 

mass spectrometer. SRM transitions unique to each analog were optimized for the 

intact insulin molecules as well as for the corresponding beta chains. Both sets were 

tested using a 15 minute experimental methods. 

Results : The primary limitations to routine, high-throughput targeted quantitation of 

insulin and its various analogs have been limited by inefficient extraction/enrichment 

protocols. The incorporation of custom MSIA D.A.R.T.’S loaded with the pan-insulin 

Ab facilitated capture for all variants from the samples while significantly decreasing 

the background matrix. The increased capture efficiency permitted the development 

of an 8 minute method. The pan-Ab has been shown to recognize a common epitope 

region in the beta chain that is conserved across all variants. A unique set of SRM 

transitions were developed for each variant, intact as well as the beta chains and all 

transitions were included in a single, multiplexed method to identify presence/absence 

of each variant and relative/absolute quantitative determination. The initial results 

demonstrated LOQ values



Note: MS screen involved retention time and precursor ion exact mass. MS E screen involved 

retention time, precursor and fragment ions exact mass. $ NF - no fragment ion exact match 

was found, *N - negative: no precursor or fragment ion match found. Cod: Codeine, EDDP: 

2-ethylidene-1,5-dimethyl-3,3-diphenylpyrrolidine, Fen: Fentanyl, Norf: Norfentanyl, 

HC: Hydrocodone, HM: Hydromorphone, Met: Methadone, Mor: Morphine, 6-AM: 

6-Monoacetylmorphine, OC: Oxycodone, OM: Oxymorphone 

A-181 

Subtyping of Amyloidosis Using a High Resolution Benchtop Orbitrap 

Mass Spectrometer 

C. Yuan, C. V. Cotta, E. D. Hsi, S. Wang. Cleveland Clinic, Cleveland, OH 

A-180 

Time of Flight (TOF) Screening: Use of Low Energy (Precursor Ion) 

and High Energy (Fragment Ion) Scans to Eliminate False Positive 

Result 

N. Chindarkar 1 , M. Wakefield 2 , R. Fitzgerald 1 . 1 University of California- 

San Diego, San Diego, CA, 2 Waters Corporation, Pleasanton, CA 

Background & Objectives: Drug screening by liquid chromatography-TOF relies on 

exact mass of protonated analyte. Screening with single high resolution mass analyzer 

can provide false positive result. Recent development (MS E functionality) in the TOF 

technology provides the ability to acquire both low energy (precursor ion) and high 

energy (fragment ion) data in a single rapid screening run using collision induced 

dissociation. We demonstrate: 1) the influence of confirmation criteria including the 

presence of a fragment ion on number of positive hits 2) that the precursor ion and 

fragment ion spectra obtained in a single run can help with unambiguous identification 

of analyte 3) that our method is accurate, precise and linear over a clinically useful 

range. 

Experimental: Waters Acquity UPLC/Xevo G2 TOF, (positive ESI), UPLC BEH 

C18 column. Mobile phase A and B were 5mM ammonium formate (pH 3) and 0.1% 

formic acid in Acetonitrile respectively (flow 0.4mL/min). 450μL of deionized water 

was added to each 2mL vial followed by addition of 50μL IS solution (prepared in 

synthetic urine) and 200μL sample/standard/QC. 300μL of β-Glucuronide (5000U/ 

mL) solution was added; vials were capped and mixed by inversion followed by 

incubation at 50ºC for 90 minutes. The samples were centrifuged (3500rpm) for 20 

min and loaded in the auto-sampler for analysis. 10μL sample was injected. 

Results and Conclusion: Table 1 shows that when compared to LC-MS/MS results 

(174 positives); TOF MS screening without fragment ion confirmation gave false 

positives. Addition of fragment ion information (TOF MS E screening) eliminated 24 

false positives. MS E screening failed to obtain information about fragment ion when 

analyte concentration was low (17 no fragment ions found, 1 negative- no precursor 

or fragment ions found), there was severe ion suppression or the analyte did not 

fragment well (e. g. Morphine, Oxymorphone, Oxycodone). Our method was linear 

over clinically useful range. 

Table 1: Comparison of LC-MS/MS (Tandem Quadrupoles) and LC-TOF Screening Results 

(Positive Hits) 

LC/MS/MS 

TOF 

MS screen 

TOF 

MS E Screen 

Cod 13 13 13 - 

EDDP 23 23 23 - 

Fen 3 3 2 (1NF $ ) - 

Norf 3 3 2 (1NF) - 

HC 19 19 17 (2NF) - 

HM 20 20 20 - 

Met 23 23 23 - 

Mor 33 32 25 (7NF) (1N*) - 

6-AM 10 13 7(3NF) 3 

OC 14 25 13 (1NF) 11 

OM 13 23 11 (2NF) 10 

Total 174 197 156 (17NF) (1N) 24 

False Positives 

Eliminated 

Background: Amyloidosis is a rare condition characterized by deposits of insoluble 

proteins in the form of beta pleated sheets that interfere with the normal structure and 

function of varying tissues. Correct identification of amyloid subtypes is critical as 

the treatment and prognosis can be very different. Over 28 amyloidogenic proteins 

have been identified and subtyping using immunohistochemistry techniques can 

be misleading due to loss of epitopes, nonspecific staining, and presence of nonamyloid 

serum proteins. A mass spectrometry based method has been developed for 

accurate amyloidosis subtyping. However, the analytical method was long (> 1 hour 

per sample) and the MS instrument is expensive and impractical for most clinical 

laboratories. The goal of the current study was to develop a simplified amyloidosis 

subtyping method using formalin-fixed, paraffin-embedded (FFPE) tissues and a high 

resolution benchtop mass spectrometer. 

Method: Amyloid deposits were excised from hematoxylin-eosin stained sections of 

FFPE tissues using a laser micro-dissection system (Leica LCM, Buffalo Grove, IL). 

The collected sample was subjected to protein extraction and trypsin digestion. The 

resulting peptides were separated by microflow liquid chromatography (EASY-nLC 

1000, ThermoFisher Scientific) and analyzed by Q-Exactive, a bench top Orbitrap 

mass spectrometer (ThermoFisher Scientific). Mobile phase A was water with 0.1% 

formic acid, and mobile phase B was acetonitrile with 0.1% formic acid. The elution 

gradient was from 5% to 20% B in 20 min at a flow rate of 2 μL/min. The cycle time 

per injection was ~35 min. The mass spectrometer (MS) was operated in the positive 

electrospray mode, and 10 MS2 scans (resolution=17500) were performed after each 

full MS scan (resolution=35000). Retention time and molecular weight of known 

amyloidal peptides (n=118) were included for targeted analysis. The resulting MS raw 

data were searched against human IPI database using the Protein Discoverer software 

(Version 1.3, ThermoFisher Scientific). Tolerance window was set at 10 ppm for the 

precursors and 20 ppm for the fragments. Oxidation of methionine and methylation 

of lysine were used as variable modifications. All positively identified proteins were 

sorted by the number of matched peptide spectra, and used in the final reviewing 

process along with imaging data and clinical presentation. 

Results: A total o:f 12 amyloid samples and 18 non-amyloid samples were analyzed. 

As expected, serum amyloid P (SAP) and at least one apolipoprotein (ApoA-I, ApoA- 

IV, and ApoE) were found in all amyloid samples, and none was present in the nonamyloidal 

samples. SAP and ApoA-IV were the most common encountered proteins, 

followed by ApoA-I and ApoE. Based on MS data, in 7 samples the amyloidogenic 

protein was the lambda immunoglobulin light chain, in 3 samples the kappa light 

chains were identified as the main component, while transthyretin was identified 

in 2 samples. Our MS results were confirmed by either immunohistochemistry 

staining, serum protein electrophoresis, molecular analysis for mutations involving 

transthyretin or an independed MS method. 

Conclusion: Rapid proteomic amyloid subtyping from FFPE is feasible on a benchtop 

MS in the clinical laboratory setting. 

A-183 

Use of Coupled Mass Spectrometric Immunoassay-Selective Reaction 

Monitoring (MSIA-SRM) to measure PTH and variants during 

Intraoperative Parathyroidectomy. 

E. K. Leung 1 , B. Krastins 2 , M. F. Lopez 2 , X. Yi 1 , C. C. Lee 1 , R. H. Grogan 1 , 

P. Angelos 1 , E. L. Kaplan 1 , K. T. J. Yeo 1 . 1 The University of Chicago, 

Chicago, IL, 2 ThermoFisher Scientifi c BRIMS, Cambridge, MA 

Background: Intra-operative monitoring of parathyroid hormone (IOPTH) 

concentrations is important because it allows surgeons to perform minimally invasive 

parathyroid surgery with real-time assessment. The successful removal of abnormal 

hyper-secreting parathyroid gland causes circulating PTH to fall rapidly from preexcision 

concentrations in circumstances involving single adenomas. We have 


A53



previously observed a slower PTH decline in the Elecsys versus the Immulite assay 

(Lee et al. Clin Chem, 2010;56 (6):A161) and wanted to determine if this may be due 

to the capture and labeled antibodies used in the Elecsys PTH assay cross-reacting 

with the mid-molecular and/or C-terminal PTH fragment. 

Methods: Leftover serial EDTA plasma samples were collected from 31 patients 

undergoing routine single-gland parathyroidectomy procedures that were monitored 

using the standard-of-care Siemens Immulite Turbo® PTH assay. Aliquots were 

treated immediately with SigmaFAST protease inhibitor cocktail and frozen at 

-80°C until determination of PTH and its variants using the previously described 

ThermoFisher MSIA-SRM method (Lopez et al. Clin Chem. 2010 56:281-90) and the 

Roche Elecsys® PTH STAT assay. 

Results: Using MSIA-SRM we quantitated 7 tryptic PTH peptides [aa1-13, aa14-20, 

aa28-44, aa34-44, aa35-44, aa73-80, and aa14-20(phosphorylated aa17)] and their 

respective declines were compared with Immulite and Elecsys PTH methods. The 

mean time-to-decline to 50% below baseline PTH (T50) values were statistically 

different between Immulite vs Elecsys (6.3 min vs 10.2 min, p



A-187 

Assessment of Hypercortisolism in Cushing’s Syndrome and Major 

Depressive Disorder Patients by Urinary Free Cortisol Measurement 

With A New LC-MS/MS Method 

O. Baykan 1 , H. Baykan 2 , M. Arpa 1 , F. Gerin 1 , T. Seyrekel 1 , O. Sirikci 1 , 

G. Haklar 1 . 1 Marmara University School of Medicine Department of 

Biochemistry, Istanbul, Turkey, 2 Umraniye Research and Training Hospital, 

Psychiatry Clinic, Istanbul, Turkey 

Background: Measurements of 24-h urinary free cortisol (UFC) concentration is 

one of the first-line tests for the diagnosis of hypercortisolism states like Cushing’s 

syndrome (CS). Hypothalamus-pituitary-adrenal (HPA) axis has been also found to 

be effected in different psychiatric disorders. Immunoassays for UFC determination 

which require extraction steps are susceptible to interferences and harder to 

standardize. Our aim was to validate a sensitive and rapid LC-MS/MS method 

without extraction for measurement of UFC and test its effectiveness in CS and major 

depressive disorder (MDD) patients. 

Methods: Seven CS patients, 15 MDD patients and 13 healthy volunteers were 

enrolled. MDD patients were assessed using the SCID-I (a structured diagnostic 

interview based on DSM-VI) and the Beck Depression Inventory was used to exclude 

depression in healthy controls (cutoff value



ng/ml. Accuracy was slope=1.0, intercept= -0.02; n=40, r2=0.99 compared to 

immunoassay (Architect, Abbott Diagnostics, Abbott Park IL), and slope=0.90, 

intercept=0.3; n=55, r2=0.94 compared to conventional LC-MS/MS method. 

Conclusion: PS/MSMS provides accurate mass spectrometry results for tacrolimus 

with rapid turnaround time amenable to random access testing protocols. 

A-191 

Cross validation between LDTD-MS/MS and LC-MS/MS for the 

determination of 4 Immunosuppressant drugs in whole blood in 9 

seconds per samples 

G. Blachon 1 , P. Picard 1 , S. Auger 1 , A. Birsan 1 , J. Lacoursière 1 , K. L. 

Johnson-Davis 2 . 1 Phytronix Technologies, Quebec, QC, Canada, 2 ARUP 

Laboratories, Salt Lake City, UT 

A-190 

Rapid Identification of Bacteria and Yeast by MALDI TOF Mass 

Spectrometry Analysis with MYLA Data-base in a Brazilian Clinical 

Microbiology Laboratory 

J. Monteiro, M. B. Amaral, A. P. T. Lobo, J. S. Werneck, F. Boaretti, S. 

Tufik. Associação Fundo de Incentivo a Pesquisa (AFIP), São Paulo, 

Brazil 

Background: Matrix assisted laser desorption/ionization time-of-flight (MALDI- 

TOF) mass spectrometry (MS) has become a powerful tool for identification of 

pathogens in microbiology laboratories. This technology has been reported to be a 

simple, fast and reliable method with a low per-sample cost. The objective of this 

study was to compare bacteria and yeast identification results obtained by the Vitek- 

MS System (bioMerieux) to the results obtained by the Vitek 2 System (bioMerieux). 

Methods: We analyzed 373 clinical isolates collected mostly from blood, respiratory 

tract, urine, wound, and fluid cultures. Clinical samples were cultivated first in 

Tryptcase Soy Agar with 5% of sheep blood, MacConckey and Chocolate Agar plates, 

and then incubated at 35°C overnight. All the isolates were identified by MALDI-TOF 

mass spectrometry using the Vitek-MS System which contains the MYLA database, 

and by phenotypic tests using the Vitek 2 System, according to the manufacture’s 

recommendations. 

Results: A total of 373 clinical isolates, including 354 bacteria (223 Gram-negative 

and 131 Gram-positive) and 19 yeast (17 Candida species and two Cryptococcus 

neoformans) were tested. Out of these 373 isolates tested, 370 (99.1%) presented the 

same identifications when results from both systems were compared. However, 48 

(21.5%) Gram-negative and 21 (16%) Gram-positive bacteria had to be re-tested by 

the Vitek-MS to obtain satisfactory results. In the end, only three isolates of Shigella 

sonnei species were misidentified as Escherichia coli by the Vitek-MS. Conclusion: 

Our study demonstrated excellent correlations between the Vitek-MS with MYLA 

data-base and the Vitek 2 Systems for the identification of bacteria and yeasts clinical 

isolates. Most likely, the need for re-test some samples was due to an inoculation 

failure, which was corrected in a second inoculation attempt. The misidentification of 

S. sonnei was probably associated to the close relatedness between this specie with 

E.coli. Though, improvements of the MALDI-TOF MS data-base should increase the 

sensitivity and specificity of the identification of closely related bacteria. Based in 

these results and in the recently Brazilian Health Department approval, we should be 

able to incorporate the Vitek-MS system into Brazilian clinical laboratories routines, 

in a near future. 

Background: Over the last decade, immunosuppressant drugs measurement 

techniques in whole blood have been subject to improvement of analytical methods to 

optimize cost, time, and accuracy of analysis results. The transfer of immunoassays to 

LC-MS/MS has significantly improved all these three performance criteria but has not 

reduced the analytical run time below a minute. The Laser Diode Thermal Desorption 

(LDTD) represents a technological breakthrough that removes the chromatographic 

step and significantly increases the analytical throughput for the quantitation of 

Tacrolimus, Sirolimus, Everolimus and Cyclosporin A. With this technique, all these 

four immunosuppressants can be quantified simultaneously in 9 seconds from sample 

to sample after an easy and quick whole blood extraction. 

Methods: 25 μL of whole blood samples were treated with 62,5 μL of a precipitation 

reagent including deuterated IS. After vortex and centrifugation, 50 μL of water and 

125 μL of MTBE were added to the vial. A gentle vortex was applied for 30 seconds 

and phase separation occurred in 1 minute. 90 μL of the supernatant was mixed with 

10 μL of EDTA solution (200 μg/mL in H 2 

O:MeOH:NH 4 

OH (20:75:5)). 2 μL of the 

mix was deposited on a Lazwell plate and allowed to dry. Immunosuppressant drugs 

were analyzed by thermal desorption followed by positive APCI ionization. Multiple 

reactions monitoring was used to quantify the analytes. The method is validated and a 

direct comparison with established LC-MS/MS method is demonstrated. 

Results: The laser power pattern was optimized to control the kinetic and the 

temperature of thermal desorption which provides optimal signal for analysis. The 

laser power is ramped from 0 to 65% in 3 seconds, and maintained for 2 seconds. 

The APCI parameter settings are a positive corona discharge current of 3 μA, a 

carrier gas temperature of 30 o C and an air flow rate of 3 L/min. Through the LDTD 

analysis, no thermal fragmentation of the parent compounds was observed, allowing 

us to use proper and reproducible [M + NH 4 

] + precursor ions. The QTrap system 

was operated in MRM mode, monitoring all 4 compounds and their specific IS in 

a single experiment with a 200 ms dwell time. The analysis time was achieved in 

only 9 seconds from sample to sample with no traces of carry over.The extraction 

procedure yields high recovery (88-92%) and low RSD (8,9%, n=6). Lower Limit 

of quantitation (LLOQ) was fixed at the first level of calibration reagent kit from 

Chromsystem ranging from 2-50 ng/mL for Sirolimus, Tacrolimus and Everolimus, 

and from 25-1870 ng/mL for Cyclosporine A. Over these ranges, linearity coefficients 

of r= 0.994 to 0.999 were obtained. The method shows no cross-talk interference 

between the compounds themselves. A set of whole blood samples containing all 4 

drugs was run for comparison with LC-MS/MS method. Concordance correlation 

coefficients between the two instrumental methods are between 0.966 to 0.997. The 

Passing-Bablok regression revealed no significant deviation from linearity (Cusum 

test, P=0.11). Bland-Altman plot showed that the mean bias of the two methods was 

+0.9 (1.96 SD, -19.7 to 21.6) ng/mL. 

A-192 

Direct Identification of Bacteria in Positive Blood Culture Bottles by 

MALDI-TOF/MS Using in-house Sample Preparation Method 

J. Monteiro, F. Boaretti, M. B. Amaral, J. S. Werneck, A. P. T. Lobo, S. 

Tufik. Associação Fundo de Incentivo a Pesquisa (AFIP), São Paulo, 

Brazil 

Background: Blood cultures (BC) remain the gold-standard method for the 

microbiology diagnostic of bloodstream infections. A rapid bacterial identification by 

matrix-assisted laser desorption/ionization time-of-flight mass spectrometry method 

(MALDI-TOF/MS) directly from positive BC bottles could be helpful to clinicians in 

the timely targeting of empirical antimicrobial therapy. The objective of this study was 

to evaluate the performance of the Vitek-MS system (bioMerieux) to identify bacteria 

isolates directly from BC bottles. 

Methods: We analyzed 100 aerobic BC reported as positive by the Bactec 9240 

automated system (BD). An aliquot of each positive BC was used to prepare a Gram 

stain, as well as to inoculate in two culture mediums: tryptcase soy agar with 5% of 

sheep blood and chocolate agar. After inoculation, these agar plates were incubated 

in aerobic and anaerobic atmospheres for 24-48h. Sample preparation to the Vitek- 




MS was performed using an in house protocol based on a centrifugation-wash (CW) 

method. In parallel with the Vitek-MS direct identification, all the BC samples 

subcultured on agar plates were also identified using the Vitek 2 System, according to 

the manufacture’s recommendations. 

Results: One-hundred positive BC bottles were evaluated. Out of these, 47 were 

identified as Gram-negative and 45 as Gram-positive bacteria. Eight of them were 

negative by both, Gram stain and subculture. Among the 92 confirmed-positive blood 

cultures, 82 (89.1%) were correctly identified to the species level by the Vitek-MS, 

4 (4.3%) had an incorrect ID by the Vitek-MS and 6 (6.5%) had no ID at all. Among 

the six not identified and the four misidentified samples by the Vitek-MS, six were 

identified as coagulase-negative Staphylococci (CNS), one as S. pneumoniae, two as 

E. faecium and one as S. aureus by the Vitek 2 System. 

Conclusion: The results of this study showed that both CW method and Vitek-MS 

technology used together were able to accurately identify all of the Gram negative 

strains evaluated. However, some failures were observed on the Gram positive cocci 

identification using these both methods together. The Vitek-MS, thus, provides a 

rapid result (< 30 minutes) for bacterial identification directly from BC that can be 

useful in clinical practices. So, future studies should address the Gram-positive cocci 

identification failures in order to improve the sensibility of this test. 

A-193 

A Rapid and Selective MS/MS Method for the Measurement of 

Testosterone in Human Serum in 10 Seconds, Using Laser Diode 

Thermal Desorption (LDTD) Ionization 

M. J. Y. Jarvis 1 , P. Picard 2 , S. Auger 2 , G. Blachon 2 , E. McClure 1 . 1 AB SCIEX, 

Concord, ON, Canada, 2 Phytronix Technologies Inc., Quebec, QC, Canada 

Background: For Research Use Only. Not For Use In Diagnostic Procedures. It has 

been well established that liquid chromatography-tandem mass spectrometry (LC- 

MS/MS) provides excellent accuracy, precision and sensitivity for measurements 

of steroids in biological matrices compared to traditional techniques such as 

immunoassays, which may suffer from cross-reactivity. However, a limitation of LC- 

MS/MS for steroid research is the comparatively low throughput of the measurements, 

due to the need for chromatographic separations. 

Methods: In this work we present a rapid method for the measurement of testosterone 

in human serum using a combination of Laser Diode Thermal Desorption (LDTD) 

ionization, differential ion mobility spectrometry, and tandem mass spectrometry. 

LDTD ionization enables rapid sample analysis of less than 10 seconds per sample. 

The use of the SelexION differential ion mobility spectrometry (DMS) device 

filters out potential interferences prior to detection by tandem mass spectrometry, 

ensuring that the presence of isobaric interferences in the sample will not result in 

overestimation of testosterone levels, and therefore eliminating the need for liquid 

chromatography separation. 

Sample preparation consisted of a simple liquid-liquid extraction of serum or plasma, 

followed by dry-down and reconstitution of the sample in a mixture of methanol and 

water. 5uL of the final sample extract was spotted and dried in a 96-well LazWell plate 

prior to analysis by LDTD-DMS-MS/MS. 

Results: To confirm the validity of the method, a comparison study was performed 

by analysing a set of 24 anonymized serum samples (i) by LC-MS/MS, and (ii) 

by LDTD-DMS-MS/MS. The measured concentrations varied by less than 10% 

(accuracies ranged from 90-110%) for the two methods across the entire sample set. 

The method exhibited a linear response over the concentration range from 0.1 ng/mL 

to 100 ng/mL of testosterone, with %CV




range of 1 pg/ml to 1000 ng/ml for the Total Thyroids and 1 pg/ml to 2000 pg/ml 

for the Free Thyroids. The best lower limits of detection (LLOD) were achieved in 

positive mode for LLE and SPE extraction for the total thyroids at 1pg/ml for T4, 0.5 

pg/ml for T3 and 2.5 pg/ml for rT3 and T2 respectively while the LLOD for the free 

thyroids were comparable at 2.5 pg/ml for T4, 1 pg/ml for T3 and 5 pg/ml for rT3 and 

T2 with equilibrium dialysis showing slightly better overall background. The intraand 

inter-day CV’s were < 7% and between 2% to 8% respectively for all analytes for 

the best extraction techniques. The methods were compared using measurements from 

Standard reference material (SRM 971) from NIST and submitted samples. 



measurement of Free and Total Thyroid hormones in human serum. The best sample 

preparation techniques were LLE and SPE for the Total Thyroid and equilibrium 

dialysis for Free Thyroid analysis since they gave the best sensitivity and ease of use. 

Positive ESI mode gave better results by a factor of 5 to 10 fold in both Free and Total 

Thyroids depending on the analyte. 

A-196 

Use of Maldi-TOF in a Brazilian Clinical Laboratory: Comparison 

of Bacterial Identification TAT with Conventional Automated 

Methodology 

C. Garcia, R. J. Marani, D. M. Cassiano, M. L. Campos, D. L. O. Santos, 

C. F. A. Pereira, C. F. Teixeira. DASA, Barueri, Brazil 

Introduction: Currently, most clinical laboratories have automated systems used to 

identify microorganisms in general. One of the most used is the Vitek II (Biomerieux), 

which performs automated identification and susceptibility testing by colorimetric 

technology. Vitek MS, on the other hand, uses the Maldi-TOF (Matrix Assisted 

Laser Disorption/Ionization Time-of-Flight Mass Spectrometry) methodology and 

it is recognized as a great innovation in microorganisms identification. The mass 

spectrometry can very quickly identify profiles of bacterial proteins, thus enabling 

the characterization of most clinical significant bacteria. The reduction in the time 

to identification of pathogenic bacteria can contribute to a better prognosis of the 

patients and also to decrease the total cost of the treatment, mainly in hospital acquired 

infections. 

Objective: The objective of this study was to compare the TAT until identification of 

the new Vitek MS against the Vitek II automated system. 

Methodology: The purity of the samples was confirmed after cultivation in CPS 

chromogenic medium, (bioMerieux). After 24 hours of incubation, samples were 

identified in the Vitek II equipment which uses the colorimetric method, and in the 

Vitek MS, which utilizes mass spectrometry (MALDI-TOF). The Vitek II system was 

evaluated after inoculation of the samples using the Vitek ID GN and GP cards, and 

we followed the manufacturer’s instructions concerning the inoculum preparation, 

incubation, reading and interpretation. We evaluated 100 bacterial species: Escherichia 

coli, Enterobacteriaceae (Klebsiella pneumoniae, Klebsiella oxytoca, Enterobacter 

aerogenes, Enterobacter cloacae, Citrobacter koseri, Citrobacter freundii, Serratia 

marcescens, Proteus mirabilis, Morganella morganii), non-fermenters (Pseudomonas 

aeruginosa, Pseudomonas fluorescens, Acinetobacter baumannii, Stenotrophomonas 

maltophilia, Burkolderia cepacia, Acinetobacter lwoffii), Staphylococcus aureus, 

Staphylococcus epidermidis, Coagulase-Negative Staphylococcus, Enterococcus 

faecalis and Enterococcus faecium. We captured data from the beginning of the 

sample preparation to the final identification of the organism in both methodologies. 

Results: Both methods showed high agreement in the final identification result. In 

Vitek MS the average time of identification was 51 min compared to 266 min obtained 

in Vitek II, being the Maldi-TOF 82.13% quicker. For different groups of bacteria, we 

found the following results favoring Vitek MS: Escherichia coli, 83.03% gain in time 

of identification. Enterobacteria, 71.97%, non-fermenters, 85.76%, Staphylococcus 

spp. 86.40% and Enterococcus spp. 80.95% 

Conclusion: As expected, it was found that the new method used in our laboratory 

routine, Vitek MS, allowed a rapid and cost-effective diagnosis when compared with 

the cards of Vitek II. Doctors may have access to results more quickly and initiate or 

modify the antibiotic therapy more effectively. Patients can benefit also from better 

prognosis and shorter hospital stays. It is interesting to say that the Vitek II already 

represented a great improvement over other automated or manual methodologies, 

making the gains obtained with the new Vitek MS even more impressive. The 

possibility of using the Vitek MS directly from positive blood culture will accentuate 

much more this advantage. 

A-197 

VALIDATION OF VITEK MS MALDI-TOF IN A ROUTINE 

MICROBIOLOGY LABORATORY IN BRAZIL 

C. Garcia, A. P. d. Takushi, A. M. R. Santos, M. L. Campos, W. Schiavo, 

C. F. Teixeira, C. A. G. Dias, N. Z. Maluf, C. F. d. Pereira. DASA, Barueri, 

Brazil 

Background: The introduction of matrix-assisted laser desorption ionization-time of 

flight mass spectroscopy (MALDI-TOF) in clinical laboratories for identification of 

bacteria and yeast is recent and promising (Khot & Fischer, 2012). The system is 

based on proteomic; proteins are ionized by the laser, resulting in a characteristic mass 

spectral profile. Each bacterial isolate produces a profile that is compared to those of a 

database of species-specific reference proteins. Evaluations by different investigators 

show that MALDI-TOF is highly accurate when growth from colonies developed in 

solid media are tested, with concordance rates varying from 80% to 95%, depending 

on the set of species studied (Bille 2011, Bizzini 2010, Cherkaoui 2010, Dubois 2012, 

Neville 2011, Seng 2009, van Veen, 2010). 

OBJECTIVE: To evaluate and validate the MALDI-TOF for use in a routine 

microbiology lab. 

Methods: We compared the Maldi-TOF identification of 1063 Isolates from the 

routine laboratory, including enterobacteria and Non-fermentative gram-negative 

bacilli, Staphylococci, Streptococci, Enterococci, Yeasts and Other fastidius bacteria 

with Conventional procedures and Vitek 2 identification. 

Results: Overall, agreement between conventional and Vitek MS identification was 

95.8% (992/1063), with some differences among groups of microorganisms: 96.1% 

(494/514) for enterobacteria, 98.2% (56/57) for non-fermentative gram-negative bacilli 

(NFGNB), 92.2% (106/115) for staphylococci, 96.7% (234/242) for streptococci/ 

enterococci, 95.0% (96/101) for yeasts, and 85.7% (6/7) for other species. After the 

repetition process included in our protocol, agreement was 98.1% (1016/1036), being 

98.2% (505/514), 100% (57/57), 96.5% (111/115), 98.3% (238/242), 98.0% (99/101), 

and 85.5% (6/7) for enterobacteria, NFGNB, staphylococci, streptococci/enterococci, 

yeasts, and other species, respectively. A total of 44 isolates showed discrepant results 

between conventional systems and Vitek MS. Overall, agreement was obtained after 

the repetition step in 24 isolates, and in other 14 samples the Vitek MS were consistent 

after the process of repetition. After the repetition step, discrepant results were verified 

in 20/1036 (1.93%) isolates, and were distributed in the different group of organisms 

as follows: enterobacteria n=9, staphylococci n=4, streptococci/enterococci n=4, 

yeasts n=2, and other organisms n=1. 

Conclusion: The agreement between conventional system and Vitek MS in our study 

was 95.8% and is similar to those observed in other studies. It is also important to 

consider that our protocol included a repetition step when a discrepancy was detected 

between conventional system and Vitek MS. Among 44 discrepancies originally 

observed, mere repetition provided agreement in 24 isolates and Vitek MS results 

were the same in 14 of these. Some of the discrepancies in the group of staphylococci 

and streptococci/enterococci were due to a preliminary identification based on 

chromogenic media that was not confirmed by use of an automated system (Vitek2). 

After this repetition step in the process, discrepancies were limited to only 20/1036 

(1.93%) of the isolates. In summary, and in consonance with previous studies, we 

show that Vitek MS is a simple, easy to perform and accurate system for the bacterial 

identification, with a high potential to replace conventional phenotypic methods in the 

clinical microbiology laboratory. 

A-198 

Ultra sensitive quantitative analysis and comparison of 5alpha- 

Dihydrotestosterone in serum un-derivatized and derivatized using 

Liquid Chromatography Triple Quadruple Mass Spectrometry with 

ion Funnel Technology in Positive ESI Modes. 

R. M. Doyle 1 , A. Szczesniewski 2 . 1 Agilent Technologies, Inc, Wilmington, 

DE, 2 Agilent Technologies, Inc, Schaumberg, IL 

Background: Dihydrotestosterone (DHT) is an androgenic sex hormone that is 

responsible for the development of the male external genitalia and secondary sexual 

characteristics particularly in the prostrate and in hair follicles. DHT has been shown 

to be involved in male pattern baldness in males while in females, DHT can cause 

the development of androgynous male secondary sexual characteristics. DHT also 

plays a role in prostratic cancer. An ultra sensitive quantitative analytical method was 

developed for Dihydrotestosteronein human serum to be able to measure its levels in 

men, children and women. 





and an Agilent Infinity 1290 HPLC system were utilized in positive Electrospray 

(ESI) mode. 500 μl of human serum was used for the analysis of DHT and the sample 

preparation was liquid-liquid extraction. The sensitivity of the assay and the instrument 

was compared using derivatized and underivatized DHT to determine which gave 

the best response. The derivatives that were investigated included hydroxylamine, 

carboxymethylpyridine, picoloinic acid, etc. A Poroshell 120 EC-C18 column (2.1 

x 50 mm, 2.7 um) was used for one-dimensional separation with a run time of 5 

minutes. Quantitative analysis was performed using multiple reaction monitoring 

(MRM) transition pairs for each analyte and internal standard in positive mode. 

Results: Good linearity and reproducibility were obtained with the ultra sensitive 

concentration range of 10 pg/ml to 5000 pg/ml for the DHT underivatized. The 

lower limits of detection (LLOD) were achieved for the DHT at 5 pg/ml. The intraand 

inter-day CV’s were < 10% respectively for the underivatized DHT For the 

derivatized DHT, the initial ultra sensitive concentration range of 1 pg/ml to 5000 

pg/ml was achieved with oxime derivatization of DHT with an LLOD of 0.5 pg/ml 

being obtained. The methods were compared using measurements from Standard 

reference material (SRM 971) from NIST and submitted samples. Further analysis 

on the derivatives is being carried out to determine which derivative gives the best 

response while at the same time offering ease of use. 


mass spectrometry method was developed and validated for the measurement 

of DHT in human serum. The underivatized and derivatized DHT were evaluated and 

although underivatized DHT gives sensitive results, the oxime derivatized DHT is 

giving better sensitivity. Further work is being carried out using other derivatives as to 

which reagent gives the best results. 

A-199 

Determination of urinary vanillylmandelic acid, homovanillic acid and 

5-hydroxyindoleacetic acid by LC-MS/MS for clinical research 

L. Cote 1 , R. Doyle 2 , K. McCann 3 . 1 Agilent Technologies, St-Laurent, QC, 

Canada, 2 Agilent Technologies, Wilmington, DE, 3 Agilent Technologies, 

Santa Clara, CA 

Background: Liquid chromatography triple quadrupole mass spectrometry (LC- 

MS/MS) is ideally suited for the rapid analysis of multiple analytes. A highly 

sensitive and specific LC/MS/MS method has been developed for the quantitation of 

vanillylmandelic acid (VMA), homovanillic acid (HVA) and 5-hydroxyindoleacetic 

acid (5-HIAA) in urine. The level of creatinine in urine can also be quantified at the 

same time. 

Methods: A simple sample preparation procedure involving only a dilution is used 

for the simultaneous determination of VMA, HVA, 5-HIAA and creatinine in urine. 

Calibrators were created by spiking clean urine with various concentrations of each 

analyte. The chromatographic system consists of a pentafluorophenyl column and a 

mobile phase comprised of methanol and water containing 0.2% formic acid. Quantifier 

and qualifier MRM transitions were monitored and deuterated internal standards were 

included for each analyte to ensure accurate and reproducible quantitation. 

Results: Chromatographic separation of all analytes is achieved in less than four 

minutes through the use of a pentafluorophenyl column. The described method 

achieves the required functional sensitivity and is capable of quantitating analytes 

over a sufficiently wide dynamic range with a single injection. All analytes displayed 

excellent linearity from 0.1 to 100 mg/L. All calibration curves displayed an R2 > 

0.999. Back calculated accuracies for all calibrators ranged from 92% to 115% and 

showed intra- and inter- day CVs below 6%. 

Commercially available quality control materials were used to test the accuracy and 

reproducibility of this method. Measurements were repeated on three separate days to 

assess interday reproducibility and CVs were found to be below 10%. 

Conclusion: A robust method for quantifying vanillylmandelic acid (VMA), 

homovanillic acid (HVA) and 5-hydroxyindoleacetic acid (5-HIAA) in urine with 

excellent reproducibility and accuracy has been developed. 

A-200 

Determination of plasma methanephrines and 3-methoxytyramine by 

LC-MS/MS for clinical research 

L. Cote 1 , C. Deckers 1 , K. McCann 2 . 1 Agilent Technologies, St-Laurent, QC, 

Canada, 2 Agilent Technologies, Santa Clara, CA 

Background: Liquid chromatography triple quadrupole mass spectrometry (LC-MS/ 

MS) is ideally suited for the rapid analysis of multiple analytes. A highly sensitive and 

specific LC/MS/MS method has been developed for the quantitation of metanephrine, 

normetanephrine and 3-methoxytyramine in plasma. This method uses a solid phase 

extraction procedure for efficient sample preparation. 

Methods: An efficient solid phase extraction (SPE) sample preparation procedure 

was developed for the simultaneous extraction of metanephrine, normetanephrine 

and 3-methoxytyramine in plasma. Calibrators were created by spiking clean plasma 

with various concentrations of each analyte. The chromatographic system consists 

of a pentafluorophenyl column and a mobile phase comprised of methanol and 

water containing 0.2% formic acid. Quantifier and qualifier MRM transitions were 

monitored and deuterated internal standards were included for each analyte to ensure 

accurate and reproducible quantitation. 

Results: Chromatographic separation of all analytes is achieved in less than four 

minutes through the use of a pentafluorophenyl column. The separation of epinephrine/ 

normetanephrine and metanephrine/3-methoxytyramine are especially critical since 

these compounds share common fragments. Without proper separation by retention 

time, fragmentation of these compounds can cause interferences with one another and 

lead to inaccurate quantitation. 

The described method achieves the required functional sensitivity and is capable of 

quantitating analytes over a sufficiently wide dynamic range with a single injection. 

All analytes displayed excellent linearity from 15 to 10000 pg/ml (0.1-50 nmol/L). 

All calibration curves displayed an R2 > 0.999. Back calculated accuracies for all 

calibrators ranged from 91% to 118% and showed intra- and inter- day CVs below 

6%. Commercially available quality control material was used to test the accuracy and 

reproducibility of this method. Measurements were repeated on three separate days to 

assess interday reproducibility and CVs were found to be below 10%. 

Conclusion: A robust method for quantifying metanephrine, normetanephrine and 

3-methoxytyramine in plasma with excellent reproducibility and accuracy has been 

developed. 

A-201 

LC/MS quantitation without the use of full, batch-wise calibration sets 

G. S. Rule 1 , T. L. Ohman 1 , H. J. Carlisle 1 , A. Wilson 1 , A. L. Rockwood 2 . 

1 

ARUP Laboratories, Salt Lake City, UT, 2 ARUP Laboratories- U Utah 

School of Medicine, Salt Lake City, UT 

Background: We, and others, have been evaluating new approaches to calibration 

used for analyte quantitation by mass spectrometry. Moves continue toward improved 

efficiency, with accurate, precise and reliable quantitation. Cost reduction is also a 

major driver, particularly in the clinical healthcare setting. The objective of this study 

was to evaluate alternatives in achieving these goals by eliminating use of regular, 

batch-wise, full calibration sets while, at the same time, continuing to monitor both 

method and MS instrument stability (systematic and random variability). We have 

explored this approach for three androgen analytes in human serum using HPLC 

tandem mass spectrometry. Historical calibration information is used to reduce the 

number of calibration samples and to eliminate the use of full calibration curves. 

Instead, a single point calibration verifier is used to ascertain if a response factor is 

within acceptable limits. If within acceptable limits, this calibrator is factored into a 

running average response factor which is then used for the quantitation. 

Methods: We compare concentrations calculated using the alternative calibration 

strategy with those calculated by traditional, full, batch-wise calibration. To validate 

the approach, patient samples were compared using the two strategies. Control charts 

constructed using the two strategies were also compared. 

Results: Use of an average response factor determined across nine analytical runs and 

over six days is shown to provide excellent correlation with results obtained from use 

of a calibration set prepared with each analytical batch (Figure). Variations on this 

approach are discussed. 

Conclusion: In this proof of principle study, the alternative calibration strategy 

showed excellent correlation for patient samples when compared to the traditional 


A59



calibration method. Comparisons of control sample concentrations using the two 

calibration methods also showed excellent correlation. Comparison between control 

charts constructed using the two calibration methods support the validity of using this 

alternative calibration strategy. 

Conclusion: A rapid, accurate, and sensitive LC-MS/MS method for the detection and 

quantification of felbamate in human serum samples was validated. Sample extraction 

using protein precipitation is fast, requires less hands-on time than HPLC, and is 

easily automatable. The LC-MS/MS assay shows very good assay performance for 

monitoring FBM in serum, with a rapid runtime of 0.8 min per sample when using a 

multiplexed LC system with two channels. 

A-203 

LC-MS-MS Assay for the Rapid Quantitation of Bath Salts and 

Metabolites in Urine 

K. Thomassian, L. G. Jambor. Quest Diagnostics/Valencia, Valencia, CA 

A-202 

Felbamate Detection and Quantitation in Human Serum Using LC- 

MS/MS 

B. Boyadzhyan, K. Thomassian, L. G. Jambor. Quest Diagnostics, 

Valencia, CA 

Background: Felbamate (FBM; Felbatol ® ) is a broad-spectrum anti-epileptic 

drug (AED) that is used to treat refractory partial seizures in adults and partial and 

generalized seizures associated with Lennox-Gastaut syndrome in children. The rare 

but severe adverse effects of FBM; its interactions with other AEDs such as phenytoin, 

valproic acid and carbamazepine; and its variable metabolism and clearance suggest 

that therapeutic drug monitoring (TDM) may be important for optimal felbamate 

therapy. Traditionally, FBM levels have been monitored using HPLC methods. An 

LC-MS/MS method could offer several advantages over HPLC, including better 

specificity, sensitivity, higher throughput, and better turnaround time. 

Methods: Sample extraction was performed using simple protein precipitation with 

0.050 mL sample and 0.940 mL of precipitating reagent (10.6:89.4 water:methanol 

ratio [volume:volume]) as well as felbamate-d 4 

as an internal standard. The analytical 

HPLC system was validated using 2 different columns: a Waters XBridge BEH 

Phenyl 2.5 mcm, 4.6 x 50 mm column and a Phenomenex Gemini C6-Phenyl 3 mcm, 

4.6 x 50 mm column. The binary, aqueous mobile phase consisted of water and formic 

acid and the organic phase consisted of acetonitrile and formic acid. Detection was 

performed using an AB Sciex API 4000 LC-MS/MS system with ESI interface, with 

positive ion electrospray and multiple reaction monitoring (MRM) mode. A gradient 

time program was used and two FBM m/z transitions were monitored to ensure 

component identity: m/z 239>178 and 239>117; the 243>182 m/z transition was 

monitored for the felbamate-d 4 

internal standard. Runtime was 2.2 min/injection, with 

a detection window of 0.8 min/sample. Data analysis was performed using Analyst 

1.5.2 software. Performance of the LC-MS/MS method for detecting FBM in 40 

samples was compared with that of an HPLC method. The HPLC assay used 0.2 mL 

sample and liquid-liquid extraction, followed by 12 min HPLC detection. 

Results: The LC-MS/MS assay for felbamate was linear over the analytical range 

5-200 mcg/mL, with a correlation coefficient (r 2 ) of 0.997 compared to the HPLC 

method linearity of 10-200 mcg/mL. The LC-MS/MS method intra-assay and interassay 

imprecision (% CV) was



interest increases. The method of acquisition is generic and non-targeted, collecting 

MS/MS data for all compounds in a given sample throughout the entire LC run, 

whether known or unknown. 

A-206 

Colon Cancer Screening using an Automated, Flow Injection Tandem 

MS System. 

D. Goodenowe, W. Jin, A. Mochizuki, W. Liu, Y. Jiang, J. Hannah, Q. 

Zheng. Phenomenome Discoveries Inc, Saskatoon, SK, Canada 

Conclusion: This novel HPLC method will be a powerful tool for amino acid LC- 

MS(/MS) analysis in many different biochemistry applications. 

A-205 

Comprehensive toxicological screening using generic MS/MSALL acquisition on 

a Q-TOF Tandem Mass Spectrometer 

M. Jarvis 1 , J. Seegmiller 2 , J. Moshin 2 , A. M. Taylor 1 . 1 AB SCIEX, Concord, 

ON, Canada, 2 AB SCIEX, Foster City, CA 

For research use only, not for use in diagnostic procedures. Objective: Investigate the 

use of a novel mass spectrometric acquisition for the comprehensive detection of both 

known and unknown compounds. 

Advances in Time-of-Flight (TOF) instrumentation have yielded analytical systems 

with the speed, sensitivity and dynamic range to be useful for rapid toxicology 

screening when coupled to liquid chromatography (LC). Q-TOF tandem mass 

spectrometer functionality enables a more selective analysis of compounds, by 

leveraging the enhanced specificity of LC-TOF-MS/MS measurements. Compounds 

of interest must be pre-selected for isolation and fragmented by MS/MS, therefore, 

this targeted approach does not allow performing retrospective MS/MS data analysis 

to identify previously unknown compounds. We present here, the application of a 

novel experimental technique employing MS/MSALL with sequential windowed 

acquisition for the comprehensive toxicological screening of urine samples, using a 

Q-TOF instrument. 

Methods:The Q-TOF data was collected 1) using a TOF-MS survey scan with IDAtriggering 

of up to 20 product ion scans 2) Dedicated, looped MS/MS and 3) MS/ 

MSALL with sequential windowed acquisition. The third procedure involved each 

MS/MS experiment using a Q1 isolation window of 12 amu resulting in 24 MS/ 

MS experiments to cover a mass range of 400 amu. High-resolution extracted ion 

chromatograms were monitored for the characteristic MS/MS fragment ions of all 

compounds of interest. 

Results:A comparison of MS/MSALL with sequential windowed acquisition versus 

(i) LC-TOF-MS, and (ii) targeted LC-TOF-MS/MS was performed. Using only TOF- 

MS, even with a small extraction window (0.010 Da), there is still a possibility of 

observing interferences. In spiked urine, 4 out of 15 compounds displayed interferences 

in the retention time window. Chromatographic separation is absolutely essential if 

TOF-MS alone is being used. Using TOF-MS/MS all interferences were removed 

from the spectra of the 4 compounds. For unambiguous identification MS/MS is 

required, through MS/MS extracted ion chromatograms or through library searching. 

We show in this example the advantage that TOF-MS/MS provides over TOF-MS. 

We set out therefore to show that using MS/MSALL with sequential windowed 

acquisition we could collect an MS and MS/MS spectrum at high resolution on every 

analyte in the sample. Using a Q1 isolation window of 25 Da potentially reduces 

the specificity gains of using high resolution mass spectrometry. In this example for 

opiate analysis, hydrocodone was seen to have interference from oxycodone, codeine 

and oxymorphone. However with the ability to adjust the Q1 isolation window in 

SWATH and use a narrower range, we have the ability to remove these interferences 

and only extract from the data peaks that correspond to hydrocodone and codeine 

compounds. 

Conclusion:.The major advantages of this technique include: enhanced selectivity, 

with a reduced occurrence of false positives; the possibility of both retrospective 

TOF-MS and TOF-MS/MS data analysis to identify previously unknown compounds 

and no resultant increase in experimental cycle time as the number of compounds of 

Background: Depleted serum levels of a novel hydroxyl polyunsaturated long-chain 

fatty acid (GTA-446) are present in up to 90% of colorectal cancer (CRC) subjects and 

the negative predictive value of normal levels is 99.95%. As such, the measurement 

of this analyte is now being introduced worldwide for the screening of CRC risk 

and subsequent early detection and monitoring follow-up. Currently, flow injection 

tandem mass spectrometry (FI-MS/MS) is the only validated analytical platform for 

measuring GTA-446 in serum. Due to the volume and distribution requirements of 

a CRC screening test, a semi-automated system that is capable of processing >1000 

samples per day and which can be operated by a skilled laboratory technician is needed 

Methods: A FI-MS/MS system comprised of 5 components: 1) A kit containing 

standards, quality control samples, pre-coded sample and injection vials, and a 

96-well mixing plate; 2) A customized Gilson Pipetmax sample prep station; 3) A 

customized Gilson GX-271 autosampler and liquid delivery system; 4) An Ionics 3Q 

mass spectrometer; 5) Integrated software, was developed and used to perform a full 

method validation. 

Results: The average %CV of the standards was under 5%. The intra-day precision of 

the QC samples (GTA-446 in serum) was 5.6% (low, 0.600ug/ml), 5.9% (med, 1.100 

ug/ml), and 5.5% (high 8.000 ug/ml). Total error of the system was 11.3%. One 96- 

well plate is comprised of 2 MS control samples, 3 GTA-446 QC samples, 6 standard 

curve samples, one blank, and up to 84 patient samples. The Pipetmax could prepare 

one plate per hour. The GX-271 had an injection frequency of



CDG defects were used to characterize and establish glycan profiles with incomplete 

glycosylation. The overall profile of each CDG sample was compared to the glycan 

profile obtained from normal serum and the glycan structures were determined based 

on their ion spectra. 

Conclusions: The technique obviates the need for purification of specific glycoproteins 

from serum. The purification is simple, inexpensive and requires instrumentation 

commonly available in the clinical laboratory. Microflow HPLC and positive ion 

mode ESI-MS maximize robustness and reproducibility. The method is applicable to 

the study of large cohorts of CDG patients 

A-208 

Design of experiments: a powerful technique for developing LC/MS methods 

M. P. Eastwood, L. J. Calton. Waters Corporation, Greater Manchester, 

United Kingdom 

Background: Traditional method development usually involves changing one 

parameter at a time while holding everything else constant. This can be a laborious, 

time consuming process that often relies on luck or tenacity to discover the optimal 

conditions. Here we discuss the use of Design of Experiments, a statistical technique 

for planning, conducting and analysing experimental data, for LC/MS method 

development. 

Methods: Statistical analysis of data generated using Design of Experiments is used to 

establish the relationship between the response being optimized and the experimental 

parameters being studied. These parameters may have simple, individual effects on 

the response or may have multiple effects that are inter-dependent on each other. 

Since each experiment is designed mathematically, there is statistical confidence in 

the results obtained and the conclusions drawn from the experiments can be clearly 

defined. There are three phases to developing an LC/MS method using Design of 

Experiments. The first stage is screening the experimental parameters to identify 

those that affect the response to be optimized. Typically, two-level fractional factorial 

designs are used at this stage allowing the individual effects of parameters and any 

interactions between parameters to be identified. Fractional factorial designs offer a 

reduction in number of samples required without losing much information. 

The second stage of method development is to optimize the parameters shown to have 

an effect on the final response. This is achieved using response surface methodology 

to construct a mathematical model describing the effect of each parameter on the 

response being optimized. From this model the optimal level for each parameter can 

then be estimated. Models can also be combined to determine the best overall set 

of conditions for multiple compounds, making it easier to optimize methods that 

multiplex multiple analytes. The final stage is to assess the robustness of the optimized 

method. This can be evaluated using a two-level Plackett Burman experimental 

design, with high and low levels spanning the final optimized conditions. An assay 

that is considered robust will be resistant to changes to the parameters so will give 

similar results across the experimental design. Where a lack of robustness exists, it 

can be identified statistically and a tolerance range for the parameter determined. 

Conclusion: Design of Experiments allows LC/MS assays to be quickly and 

efficiently developed and optimized, producing higher quality methods in less time. 

A-210 

Sensitive LC-MS/MS Quantitation of Thyroid Hormones (T3 and T4) in Serum 

C. hao, H. Qiao, C. Jolliffe, S. Ye. Ionics, Bolton, ON, Canada 

Introduction: Thyroid hormones play an important role in many biological processes 

including growth and development, carbohydrate metabolism, oxygen consumption, 

and protein synthesis. LC-MS/MS of thyroid hormones, Triiodothyronine (T3) and 

Thyroxine (T4), at low concentration levels, has shown to be superior to immunoassay 

and is becoming the method of choice for measurement of free T3 and T4 due to its 

high selectivity and sensitivity. This measurement is critical for diagnosis of thyroid 

disorders such as hyperthyroidism and hypothyroidism. In some cases the lack of 

specificity of immunoassays provide inaccurate results leading to poor correlation 

of thyroid level with thyroid disorder. In this paper, a simple LC-MS/MS method is 

reported for sensitive T3 and T4 quantitation in serum. 

Experiments: Triiodothyronine and Thyroxine were purchased from Sigma and 

T3-13C6 and T4-13C6 from Cerilliant. LC-MS/MS analysis was performed on 

an IONICS 3Q Series 320 triple quadrupole mass spectrometer with a Shimadzu 

UFLCxr LC system. A 10 uL sample was loaded on a Kinetex C18 Phenyl-hexyl 

column (50x2.1mm, 2.6μ) at 40 °C with a gradient method at 500 uL/min: solvent B 

(acetonitrile with 0.1% formic acid and 5 mM NH4OAc) was kept at 5 % until 0.5 

min and increased to 95% at 1.6 min, washed, followed by 1.5 min post separation 

equilibrium. The LC cycle time was 5.0 min. The solvent A was water with 0.1% 

formic acid and 5 mM NH4OAc. All the solvents used are HPLC grade. 

Preliminary results: Results are presented for very sensitive detection of T3 and 

T4 in serum using negative ion mode LC-MS/MS, monitoring the MRM transitions 

of 650/127 and 776/127, respectively. This method takes advantage of enhanced ion 

sampling and ion transfer efficiency of a new triple quadrupole mass spectrometer, to 

yield significant advances in the limit of detection. Results show sub-pg/mL detection 

limits of T3 and T4 and a concentration linearity for T3 and T4 up to 700 pg/mL. 

Comprehensive LC-MS/MS results for the T3, T4 LOD, LOQ, linear dynamic range, 

accuracy and matrix effect will be discussed. 

A-211 

Use of Maldi-TOF for Identification of Anaerobic Microorganisms in a 

Brazilian Clinical Laboratory 

V. N. J. Egi, C. Garcia, C. F. A. Pereira, M. L. Campos, D. M. Cassiano, R. 

J. Marani, C. F. Teixeira, G. O. Reis. DASA, Barueri, Brazil 

Introduction: A new method for bacterial identification has recently been introduced 

as a complement to conventional methods to aid diagnosis, with special focus in 

rapidity and precision. The Maldi-TOF is an important innovation for the study of 

macromolecules and this method performs analysis of microbial proteins generating 

a profile that is both reproducible and stable for each bacterial species. Anaerobic 

bacteria are defined as microorganisms which can survive and multiply in the absence 

of oxygen. Anaerobic infections are usually of endogenous origin. 

However, despite the variety of different genera and species of the normal anaerobic 

microbiota, anaerobic infections are mainly caused by Bacteroides fragilis group, 

Peptostreptococcus 

spp., Pigmented Gram-Negative (Prevotella spp.) and Fusobacteria. 

Objective: Our goal was to evaluate Maldi-TOF - Vitek MS - as a reference resource 

for the identification of anaerobic bacteria in the microbiology laboratory. 

Methodology: Forty-nine isolates from various clinical specimens were characterized 

as anaerobes during the period of study. These samples were collected into 

Thioglycolate, plated on supplemented blood agar for anaerobic microorganisms and 

incubated in an anaerobic jar with an anaerobiosis generator at 37 degrees for 48 

hours. The obtained microorganisms, suspected of being anaerobes, were plated again 

on blood agar and on chocolate agar with incubation at 37 degrees for 24 hours in 

regular atmosphere and CO 2 

jars, respectively, for evidence of colonies that could 

grow aerobically. Only the strains that developed exclusively on supplemented blood 

agar plates were considered for this study. Subsequently, staining was performed by 

the Gram method for evaluation of bacterial morphology. This review could identify 

the genus. All 49 isolates were identified using Maldi-TOF methodology and the 

results are compared. 

Results: The following identification was obtained with Maldi-TOF. There was 100% 

concordance with the genus identification by the conventional methodology. 

Bacteroides fragilis - 26 isolates 

Bacteroides vulgatus - 3 isolates 

Bacteroides ovatus - 3 isolates 

Bacteroides stercoris - 2 isolates 

Bacteroides uniformis - 2 isolates 

Bacteroides thetaiotaomicron - 5 isolates 

Fusobacterium nucleatum - 1 isolate 

Prevotella spp - 2 isolates 

Peptostreptococcus anaerobius - 3 isolates 

Clostridium spp. - 1 isolate 

Conclusion: Maldi-TOF methodology showed 100% concordance with the 

conventional identification at the genus level. It is not possible to assure that the 

species identification of these 49 strains is precise. However, Maldi-TOF is a valuable 

tool for quick bacteria and fungi identification, and as the literature and our data shows, 

it can be used to accelerate in more than 24h the anaerobic identification, contributing 

additionally with the species identification, that have important correlation with 

resistance expression. 




A-212 

Comparison of Diagnostic Methods for fungi Identification. 

K. H. Kuriki, M. L. Campos, C. Garcia, D. M. Cassiano, C. F. A. Pereira, 

R. Marani, M. A. Santana. DASA, Barueri, Brazil 

Background: Invasive infections caused by Candida spp. are important causes of 

morbidity and mortality. Among the species of fungi related to clinical manifestations, 

the gender Candida spp. is the main responsible for them. Despite being the most 

commonly isolated species in superficial and invasive infections, the incidence 

of infections caused by non-albicans Candida is not growing in relation to its 

pathogenicity. Successful treatment of infections depends on identifying the type and 

sensitivity pattern to antifungal agents. Therefore, the rapid and specific diagnosis is 

critical to the early introduction of the correct therapy. 

Objective: The objective of this study was to evaluate the fastest and best diagnostic 

method considering the clinical importance, epidemiological and laboratory infections 

caused by Candida spp. 

Material and methods: Samples with suspected infection were sent to the laboratory 

for confirmation of diagnosis. After growth, the characterization was confirmed 

by the Gram method. All cultures were isolated from Chromogenic Candida Agar 

medium and incubated at 37 degrees for 24 hours for isolation and differentiation 

of the larger species of Candida spp. Afterwards, confirmation was performed 

by the identification method API 20 AUX, (Biomerieux), used as a diagnostic 

test and confirmed by MALDI-TOF mass spectrometry to complete the study. We 

evaluated 119 samples of Candida spp., 2 Cryptococcus spp. and 2 Trichosporon spp. 

Results: Through the chromogenic method we identified 110 species of Candida 

spp., and 9 non-albicans. Through API 20 AUX and MALDI-TOF, we identified the 

following non-albicans Candida: 

Candida parapsilosis - 52 specimens 

Candida tropicalis - 27 specimens 

Candida glabrata - 18 specimens 

Candida guilhermondii - 5 specimens 

Candida polished - 1 specimens 

Candida haemuloni - 1 specimens 

Candida krusei - 5 specimens 

Candida pelliculosa - 1 specimens 

And: 

Cryptococcus 

neoformans - 2 isolates 

Trichosporon 

asahi - 1 isolated 

Trichosporon 

inkin - 1 isolated 

The Candida albicans specimens were also identified by API 20 AUX and MALDI-TOF. 

Conclusions: The chromogenic method presented good efficiency to identify both 

albicans and non-albicans Candida. The methods used to identify non-albicans 

Candida (API 20 AUX and MALDI-TOF) presented similar results on these 

identifications. However, the MALDI-TOF methodology identification was faster 

when compared to API 20 AUX. 

A-214 

ANALYSIS OF MERCURY IN BLOOD BY ICP-MS IN A BRAZILIAN 

LABORATORY 

P. C. Souza, L. M. Hanhoerster, C. F. A. Pereira. DASA, Rio de Janeiro, 

Brazil 

INTRODUCTION: Mercury is toxic to humans in both inorganic and organic 

compounds. The steam exists in monatomic state in elemental form (Hg0), has a 

high vapor pressure, is soluble in lipids and when inhaled is distributed mainly to 

the alveolar bed. The inorganic mercury is produced in various industrial processes. 

Organic compounds form salts with organic and inorganic acids and react with 

various organic compounds. The most used method for mercury dosage is the cold 

vapor generation coupled with atomic absorption spectrophotometry equipment. This 

methodology requires a prior preparation of the sample (digestion) and, depending on 

the technique used, it takes a long time to obtain test results because of the three steps 

involved: “digestion”, steam generation and equipment reading. 

OBJECTIVES: The aim of this work is to validate the ICP-MS methodology for the 

analysis of mercury in blood. 

MATERIALS / EQUIPMENT: Standard: CertiPUR ® ICP multi-element standard 

solution VI, Merck PN: 1.10580.0100, Lot.: HC002032Internal Standard: PCI 

standard YtriumCertiPUR ®, Merck PN: 1.70368.0100, lot: HC116058Lyphocheck 

® Whole Blood Metals Control, BIORAD, Level 1, Lot: 36741Lyphocheck ® Whole 

Blood Metals Control, BIORAD, Level 2, Lot: 36732Blood samples Laboratory 

DASA - Lot routine: MESA220612 and PBSA220612Equipment ICP-MS, Agilent 

7700 

RESULTS: Test reproducibility: 20 dosages of heparin whole blood tube of the same 

patient. 

__________________________________________________________________ 

| Sample: Pacient 8900202059 | Average = 5,0 ug/L | SD = 0,2 | CV = 3,1 % | n = 20 | 

¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯ 

Test with a population of 191 samples collected in different tubes: EDTA and 

heparin. 

___________________________________________________________________ 

| Samples: Population | Average = 1,6 ug/L | SD = 0,9 | CV = 57,9 % | n = 191 | 

¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯ 

Internal controls: 

| BR-L1, range: 6,61 a 9,91 ug/L | Average = 7,0 ug/L | SD = 0,8 | CV = 12,0 % | n = 4 | 

¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯ 

| BR-L2, range: 15,3 a 31,2 ug/L | Average = 17,6 ug/L | SD = 1,5 | CV = 8,3 % | n = 4 | 

¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯¯ 

CONCLUSION: ICP-MS method proved adequate for analysis of mercury in whole 

blood. The test reproducibility was within a safe range, with CV of 3.1%. Controls, 

both lower and higher, comparing to the the reference range, scored within the limits 

set by the manufacturer (± 2 SD). The results for a random population of 191 patients 

had an average of 1.6 ug / L, mostly within the limits established by the literature – up 

to 10.0 ug / L. The analysis time of ICP-MS is shorter than atomic absorption because 

there is no need to execute the initial steps of digestion and steam generation. 

A-215 

Quantification of Testosterone from Dried Blood Spots using Liquid 

Chromatography Tandem Mass Spectrometry 

R. Mathieu, C. Riley, C. Wiley. PAML, Spokane, WA 

Introduction: The use of the Dried Blood Spot (DBS) card as a screening method 

for various endogenous compounds is not a new concept in laboratory medicine; it 

has been used for a number of years in various capacities for a number of tests. With 

the advent of and improved sensitivities of LC-MS/MS technology these instruments 

provide the sensitivity required to perform testing on steroids extracted from DBS 

cards. The goal of this study was to create a simple extraction method that could 

be easily integrated into the current serum LC-MS/MS method without sacrificing 

sensitivity or specificity. 

Methods: Advance D x100 

Technology (ADX) cards were selected as a result of 

their ability separate the cellular material from the serum component of whole 

blood in cellulose matrix. The cards were inoculated with 200μl of patient sample 

and processed by adding a 230μl modified 0.1% BSA to a test tube followed by the 

addition of the 3/8” (14.8mm) square punched from the card to the tube. Samples 

were allowed to sit at room temperature for 12 -24 hours. Following incubation the 

samples were processed in the same manner as the serum testosterone samples, with 

the addition of 20 μL of 5ng/mL a deuterated internal standard, and the addition of 500 

μl of an extraction reagent containing 90% Hexane, 10% MTBE. 

Preliminary Data: In our study we used 108 previously tested patient samples, 

105 male, 3 female samples; no distinction was made as to condition or age of the 

patient. The DBS samples were tested against the known serum value and the data 

analyzed using Microsoft Excel. Samples were extracted, prepped and injected onto 

a Shimadzu 20AD, Prominence HPLC system coupled to an AB SCIEX Triple Quad 

5500 mass spectrometer. MRM chromatograms were acquired in positive ion mode 

under the following conditions: declustering voltage 180V, dry temperature of 300°C, 

curtain gas 10 psi and a dwell time of 150 msec. DBS samples were run against the 

same curved used to quantify serum testosterone. The standard curve consists of 7 

points (5.1, 12, 39, 296, 444, 666 & 1000 ng/ml). Our stated criteria for acceptability 

for the calibration curve is >0.997. Preliminary data demonstrated that the lower limit 

of quantification for testosterone from dried blood spots was 25.0 ng/dL. Correlation 

between the DBS and serum samples was found to have r 2 values of 0.95, 0.93 and 


A63



0.91 across three separate studies over 3 successive days. Within run precision was 

carried out using 5 unique samples in replicates of n=9 ranging from 17 - 91 ng/ml the 

greatest CV% observed was 8.3%. The results were found to be linear when evaluated 

using EP Evaluator Accuracy and Linearity module. The DBS samples had a linear 

regression of y=0.906x+3.496. 

Conclusion: Preliminary validation studies have demonstrated that it is possible to 

accurately quantify testosterone from DBS specimens. 

A-216 

Maximizing Triple Quadrupole Mass Spectrometry Productivity 

Through the Automated Use of an Expanded Dual-Channel HPLC 

System with Online Sample Cleanup 

K. McCann, S. Nene, D. McIntyre, E. Neo, D. Nagtalon. Agilent, Santa 

Clara, CA 

Background:Liquid chromatography triple quadrupole mass spectrometry (LC/MS/ 

MS) is ideally suited for the direct, rapid analysis of prepared biological samples. 

However, a user is often interested in only a portion of the total data collected by 

an LC/MS/MS system typically analyzed serially. This work explores the ability to 

increase mass spectrometer productivity through the automated use of an expanded 

dual channel high performance liquid chromatography (HPLC) system with an online 

sample cleanup option. New system control software is capable of orchestrating the 

timing of all HPLC components and coordinating the analytical utilization of the mass 

spectrometer. 

Methods:The complete, integrated LC/MS/MS system is comprised of a triple 

quadrupole mass spectrometer coupled to a configurable HPLC system, all controlled 

by a single software application. For the purposes of this work, the expanded HPLC 

system consists of a high-capacity autosampler, four binary pumps, four HPLC 

columns, two temperature-controlled column compartments and three switching 

valves. To operate the system, a standard data file collected by LC/MS/MS is loaded 

into the software. The data analysis method is extracted from the data file and a 

window of interest is specified using the data file’s chromatogram. Based on that 

information, the software automatically coordinates all timing related to running the 

HPLC system. 

Results:The analysis of 25-hydroxy vitamin D2 and D3 (25-OH D) is a common 

clinical research application analyzed by LC/MS/MS where sample throughput is a 

major concern. A previously developed LC/MS/MS method for the analysis of these 

analytes was used for testing the capabilities of this new instrument. The standard 

method uses an autosampler, two binary pumps, two HPLC columns, one temperaturecontrolled 

column compartment and one switching valve to perform online sample 

cleanup during the analysis. With a runtime of 5 minutes, the analytes of interest reach 

the mass spectrometer between approximately 2 minutes to 4 minutes. Hence, more 

than 50% of the data collected by the mass spectrometer is of no interest. 

The standard method utilizes what is considered a single HPLC stream. The expanded 

HPLC system mirrors certain components of this single stream system to provide 

a second stream, operating in parallel to the first stream. By loading the standard 

method and window of interest into the automation software, the software is able 

to determine the most efficient method of injecting and analyzing a list of 25-OH D 

samples without any user configuration necessary. By staggering injections on parallel 

streams and switching between the two streams at the appropriate time, throughput of 

the integrated expanded system can double the throughput achieved with the standard 

method. 

Conclusion:Fully automated software controlling a completely integrated LC/ 

MS/MS system with expanded dual-channel HPLC capable of online cleanup for 

increased throughput has been developed. 

Vitamin E (Alpha-, Delta-, Gamma-Tocopherol) and vitamin K (Phylloquinone) 

are essential nutrients required for normal body functioning that either cannot be 

synthesized by the body at all or in significant amounts. These vitamins are acquired 

from the diet. However, these compounds can also be toxic in large doses. Therefore, 

a simple and accurate quantitative analytical method was developed to quantitatively 

measure these water and fat soluble vitamins in human serum. 

Methods: An Agilent 6460 tandem mass spectrometer with Jet Stream technology in 

positive Electrospray mode and an Agilent Infinity 1260 HPLC system were utilized 

for this analysis. 100 ml of human serum was used for the analysis of the Fat and 

Water Soluble vitamins and the sample preparation involved liquid-liquid extraction 

(LLE) with MTBE for the Fat Soluble Vitamins and a simple protein crash for the 

Water Soluble vitamins in buffer. An Agilent Poroshell 120 SB-Aq, 100 x 2 mm, 

2.7 um with water:methanol containing 0.1% formic acid gradient achieved baseline 

chromatographic separation of the water soluble vitamins. An Agilent Poroshell 120 

EC-C18, 100 x 2 mm 2.7 um water:methanol containing 0.1% formic acid gradient 

achieved baseline chromatographic separation of the fat soluble vitamins. Quantitative 

analysis was performed using multiple reaction monitoring (MRM) transition pairs 

for each analyte and internal standard in positive mode and accuracy of the method 

was verified using reference materials from Recipe and UTAK and serum and blood 

adult samples. 

Results: Good linearity and reproducibility were obtained with the all the vitamins 

across their respective ranges. The lower limits of detection (LLOD) were achieved at 

well below their respective clinical ranges. The intra- and inter-day CV’s were < 10% 

respectively for all the vitamins. 


mass spectrometry method was developed and validated for the measurement 

of water and fat soluble vitamins in serum and blood. The sample preparation is quick 

and easily applied for high throughput analysis. 

A-218 

Reducing the Hematocrit Effect for Dried Blood Spot Analysis 

J. Wright, I. Valmont, J. Hill, J. Hill. Spot On Sciences, Austin, TX 

Background: Dried blood spot (DBS) sampling methods are increasingly used due 

to many advantages over conventional venipuncture collection including reduced 

sample processing and infrastructure needs, ambient temperature shipment with no 

cold chain requirement and improved sample stability. Hematocrit levels in human 

blood vary due to gender, disease state, age and medications and can impact the spread 

and size of the blood spot, which causes discordance in analytical quantitation. 

Methods: Hematocrit levels of 25, 35, 45, 55 and 65% were prepared by adding 

or removing plasma in fresh human whole blood. These samples were spiked with 

common drugs tolbutamide, nefedipine and ramipril and 80μL was spotted on TFN 

filter paper (Munktell) and on HemaForm fan-shaped filter paper forms (Figure 

1). After air drying overnight, punches (4 mm) were removed from the TFN spots. A 

blade was removed from the HemaForm sample.Each sample (n=3) was extracted in 

MeOH:H2O containing deuterated internal standards for 30 minutes with sonication 

and analyzed by LC-MS/MS. 

Results: With traditional blood spots, a trend was observed with increased drug levels 

recovered from higher hematocrit levels; this is likely due to decreased overall spot 

size from more viscous samples at higher hematocrit levels. HemaForm samples 

showed a more consistent recovery from all hematocrit levels. Additionally, variability 

between replicates (%CV) was reduced with HemaForm samples as compared to 

traditional spots. 

Conclusion: HemaForm fan-shaped filter paper can reduce analytical variability due 

to hematocrit effects for dried blood spot samples. 

A-217 

Quantitative analysis of the major Water and Fat soluble Vitamins 

in serum using Liquid Chromatography Triple Quadruple Mass 

Spectrometry 

R. M. Doyle. Agilent Technologies, Inc, Wilmington, DE 

Background: The major water vitamins such as Vitamin B1 (Thiamine), Vitamin B2 

(Riboflavin), Vitamin B3 (Nicotinic acid and Nicotinamide), Vitamin B5 (Pantothenic 

Acid), Vitamin B6 (Pyridoxal Phosphate, Pryidoxine), Vitamin B7 (Biotin), Folic Acid, 

Vitamin B12 (Cobalamin), and the fat soluble vitamins such as Vitamin A (Retinol) 




Figure 1: 

HemaForm and Traditional Blood Spot 

A-219 

Quantitative analysis of Prostaglandin F2-Alpha and its metabolites 

in urine using Liquid Chromatography Triple Quadruple Mass 

Spectrometry 

R. M. Doyle. Agilent Technologies, Wilmington, DE 

Background: Prostaglandin F2-Alpha (PGF-2a) is involved in the induction of 

labor and its metabolites are an indicator of lipid peroxidation from free radical 

generation. It’s metabolites are also biomarkers for the quantitation of endometriosisassociated 

oxidative stress, oxidative damage and antioxidant deficiency. The 

quantitation of PGF-2A and its metabolites require specific chromatography to 

separate all the clinically relevant analytes as well as sensitive enough to achieve the 

low concentrations associated with biological samples. Therefore, we developed a 

sensitive and specific method for the separation and detection of PGF-2a, 8-Iso-PGF- 

2a, 15-(R)-PGF-2a, 11-beta-PGF-2a, 13, 14-Dihydro-15-Keto-PGF-2A and other 

metabolites in human urine to be able to measure the analytes accurately. 

Methods: An Agilent 6460 tandem mass spectrometer with Jet Stream technology in 

positive Electrospray mode and an Agilent Infinity 1260 HPLC system were utilized 

for this analysis. 200 ul of human urine was used for the analysis of PGF-2a and 

its metabolites and the sample preparation involved liquid-liquid extraction (LLE) 

with prior acidification. Various columns were evaluated for maximum separation 

to achieve baseline chromatographic separation of all the metabolites in less than 

6 minute run time. Quantitative analysis was performed using multiple reaction 

monitoring (MRM) transition pairs for each analyte and internal standard in negative 

mode and accuracy of the method was verified using in house controls and urine adult 

samples. 


range of 0.1 ng/ml to 500 ng/ml for all the analytes with a coefficient of determination 

>0.99. The lower limits of detection (LLOD) and lower limit of Quantitation (LLOQ) 

were determined to be at least 0.05 ng/ml. 



measurement of PGF-2a and its metabolites in urine. 

A-220 

DOSAGE OF METALS IN URINE BY ICP-MS: PERFORMANCE 

EVALUATION 

P. C. Souza, L. M. Hanhoerster, C. F. A. Pereira. DASA, Rio de Janeiro, 

Brazil 

INTRODUCTION: The dosage of metals has been widely discussed by many 

scientific studies. In recent decades, dosage of metals such as Al, Cr, Mn, Ni, Co, 

Cu, Zn, Cd, Sn, Hg and Pb in biological fluids has gained a lot of strength because 

ofoccupational exposure in several industries). These markers can provide information 

for effective control of exposure, use of individual protection devices and improving 

the work environment. 

Classically, Atomic Absorption Spectrometry (AAS) has been shown to be widely 

used, due to the large number of studies carried out, reflecting the high accuracy and 

sensitivity of the methodology. 

AAS turned into a very slow solution because the process requires the dosage to be 

done one element at a time. In contrast, the dosage of metals by Inductively Coupled 

Plasma Mass Spectrometer (ICP-MS) becomes very attractive. In a single dosage 

all the elements of interest can be quantified, without modifiers and without prior 

digestion of the samples. Besides the rapid detection, this method delivers a much 

higher sensitivity comparing with AAS, reaching easily amounts in parts per trillion 

(ng/L), aiming for a new clinical interest - Orthomolecular medicine. 

OBJECTIVES: The aim of this work is to validate the ICP-MS methodology for the 

analysis of 11 simultaneous elements in urine. A simple dilution of samples with a 

simple standard linear curve permit the analyses of a large number of urine samples 

with 11 simultaneous elements (Cr, Mn, Ni, Co, Cu, Zn,Ar, Cd, Sn, Pb, Hg ). The 

analytical run for each sample is also very short - one and half minutes. 

MATERIALS / EQUIPMENT: Standard: CertiPUR ® ICP multi-element standard 

solution VI, Merck PN: 1.10580.0100, Lot.: HC002032Internal Standard: PCI 

standard YtriumCertiPUR ®, Merck PN: 1.70368.0100, lot: HC116058Lyphocheck 

® Urine Metals Control, BIORAD, Level 1, Lot: 69151Lyphocheck ® Urine Metals 

Control, BIORAD, Level 2, Lot: 69152Urine samples Laboratory DASA - Lot 

routine: METU 080213Equipment ICP-MS, Agilent 7700RESULTS: 

Routine analysis of metals in urine from 228 patients by the methodology of ICP-MS 

Element ………..| Cr | Mn | Ni | Co | Cu | Zn | As | Cd | Sn | Hg | Pb | 

Average (ug/L) |2,17 |1,70|3,57|0,48|15,56|557,25|16,57|0,36|0,58|1,12|3,39| 

ControlLevel1..| 1,27|8,42|3,5|7,46|12,9|437|52,4|10,0| CQI*|38,8|11,3| 

ControlLevel2..| 23,7|21,0|25,2|22,7|42,6|943|160,6|17,9| CQI*|101,4|55,5 

IQC = Internal Quality Control ,Sn not available inLyphocheck Urine Metals BIORAD 

CONCLUSION: From the data above, we can easily demonstrate the superiority of 

ICP-MS. With only one machine, 2,500 tests can be processed in just 5 hours and 47 

minutes. The dosage of this number oftestswith AAS methodology would demand 

more than 10 simultaneous devices, with 

many different reagents. It is evident the superiority of ICP-MS, faster, more efficient 

and sensitive, offering a remarkable performanceand earning its place in the dosage 

of metals in biological samples. 

A-221 

Validation of a multiplex proteomic mass spectrometry method for 

identification of cerebrospinal fluid 

J. W. Meeusen, D. Barnidge, P. Ladwig, R. Karras, J. Katzmann, M. Snyder, 

D. Murray. Mayo Clinic, Rochester, MN 

Background: Detection of cerebrospinal fluid (CSF) in clinical specimens is the most 

sensitive method for diagnosis of central nervous system fistulas. The current methods 

rely on detection of a single marker for CSF and have limitations in the presence of 

serum contamination. 

Objectives: (1) To establish a mass spectrometry method to identify CSF and serum 

protein biomarkers in samples of undetermined origin. (2) To compare ß2-transferrin 

(ß2-Tf) detection by electrophoretic immunofixation to multiplexed proteomic mass 

spectrometry for the identification of CSF in clinical samples. 

Methods: A LC-MS/MS multiplex assay for the detection of CSF (ß-trace protein) 

and serum (α2-macroglobulin, complement C3) specific markers in trypsin 

digested samples was developed based on selective reaction monitoring of unique 

peptides. The LC-MS/MS method was analytically validated by comparison with 

nephelometric quantitation of ß-trace, α2-macroglobulin and complement C3 in CSF/ 

serum mixtures. CSF detection by the ß2-Tf immunofixation and multiplexed mass 

spectrometry methods were compared using both CSF/serum mixtures and clinical 

specimens. 

Results: Serial dilutions of pooled CSF (total protein



dL), and 21.8% for complement C3 (147mg/dL). Method comparison between LC- 

MS/MS, nephelometry and ß2-Tf was performed in 16 otolaryngological secretions 

with sufficient volume for all tests. All ß2-Tf results were unequivocal; seven 

samples were found to be positive with a mean ß trace of 23.2mg/L by nephelometry 

(4.2x105cps; range 7.8x104 3.0x105cps [LC-MS/MS]), The mean ß trace was 

0.7mg/L (6.9x103cps; 6.4x102 1.8x104cps [LC-MS/MS]) for the nine ß2-Tf negative 

samples. Serum protein biomarkers were undetectable in the ß-trace/ß2-Tf positive 

samples. Finally, samples for CSF determination by ß2-Tf immunofixation with 

known clinical histories were analyzed blindly by LC-MS/MS. Discordant results 

were followed up with the clinical history. 

Conclusions: The semi-quantitative identification of CSF by multiplex mass 

spectrometry agreed with nephelometric quantitation and was capable of detecting 

20% CSF in serum which is a significant improvement over ß2-Tf immunofixation. 

Serum contamination can lead to equivocal ß2 Tf immunofixation results. The ability 

to evaluate the amount of serum in the sample expands the clinical utility of the LC- 

MS/MS method. 

A-222 

Method validation of 1-hydroxypyrene in urine by liquid 

chromatography/tandem mass spectrometry 

C. Lin, Y. Huang, Y. Huang, T. Wu, H. Ning, J. Lu. Chang-Gung Memorial 

Hospital, Taoyuan, Taiwan 

Background: Polycyclic aromatic hydrocarbons (PAHs) are ubiquitous and formed 

from incomplete burning of coal, oil, gas, wood, tobacco or charcoal broiled meat. 

Most of general population is exposed to PAHs from different sources. PAHs are own 

to be cytotoxic; however the dose-response relationship for adverse health effects 

due to the exposure is not known. 1-Hydroxypyrene (1-OHP) is the major metabolite 

of polycyclic aromatic hydrocarbons. It is useful to monitor the 1-OHP in urine to 

evaluate individual exposure. The purpose for this study was to develop a method by 

liquid chromatography-tandem mass spectrometry (LC-MS/MS) to determine 1-OHP 

in urine specimens. 

Methods: The 1-OHP standard was obtained by AccuStandard and prepared in 

methanol. The internal standard 1-OHP-D9 was obtained from Toronto Research 

Chemicals. Urine specimens and controls are hydrolyzed with beta-glucuronidase 

enzyme solution at pH 4.5 for 1 hour at 37 o C to convert the1-OHP to their free forms 

and increase sensitivity. Deuterated analogs of the 1-hydroxypyrene are added as 

internal standards (IS) to the enzyme treated patient urine, controls, and standards. 

1-OHP was separated from the biological fluid using solid phase extraction (SPE). 

The elution solvent was injected into a LC-MS/MS (Thermo Fisher Scientific TSQ 

VANTAGE). The concentration of analyte(s)was calculated from the calibration curve 

and ion ratios between the analyte(s) and the internal standards. 

Results:The calibration curves obtained with human urine were linear with a 

correlation coefficient of over 0.98 in the range of 0- 2000 pg/mL. The coefficient 

variation for inter- and intra-day precision was within 15% at two different 

concentrations: 100, and 400 pg/mL. There was no carryover observed in this assay, 

with the high concentration of 2000 pg/mL. To evaluate accuracy, drug-free urine 

was pooled and used a matrix to spike 6 samples with 1-OHP. The recovery is 95%. 

Conclusion: Urine 1-OHP testing can be a useful approach in evaluating individual 

exposure to PAHs. We provide an option to quantify the 1-OHP concentration in urine 

by LC-MS/MS. 


Immunology 


A-223 



Immunology 

Clinical Evaluation of Total and High Avidity Anti-dsDNA Antibody 

EIA for the Diagnosis of Systemic Lupus Erythematosis 

P. Wan 1 , S. Zhou 2 , H. Cao 1 , W. Li 1 , T. Prestigiacomo 2 , J. Zheng 1 . 1 Shanghai 

Jiaotong University, Shanghai, China, 2 Bio-Rad Laboratories, Hercules, 

CA 

Background: Anti-dsDNA antibodies have been well recognized as a diagnostic 

marker of systemic lupus erythematosus (SLE). The clinical utility of anti-dsDNA 

antibody avidity in disease management has been evaluated in previous studies, with 

conflicting results. This study is to investigate the clinical utility of total (high and low 

avidity) and high avidity anti-dsDNA antibodies in an enzyme-linked immunosorbent 

assay (EIA). 

Methods: 221 sera from SLE patients, 51 sera from patients with various other 

autoimmune diseases including Sjögren’s syndrome, dermatomyositis, scleroderma 

and rheumatoid arthritis, and 159 sera from healthy subjects were collected. Modified 

SLE disease activity index (M-SLEDAI) was calculated for SLE patients at the time 

of serum collection. Clinical data were obtained independently of the laboratory 

analyses and later related to the anti-dsDNA antibody test findings. All 431 sera 

were measured using five different formats of anti-dsDNA EIA kits. Two kits are 

commercially available at Bio-Rad Laboratories and the other three are research use 

only kits. The different formats of assay kits are characterized by different antigen 

sources and assay conditions: two kits were designed for detecting total (high and 

low avidity) anti-dsDNA IgG antibodies, two kits for measuring high avidity antidsDNA 

IgG antibodies and one for detecting anti-dsDNA antibodies of both IgG 

and IgM isotypes. The diagnostic sensitivity and specificity, positive and negative 

likelihood ratio (LR+, LR-), and positive and negative predictive values (PPV and 

NPV) were calculated for each assay format. The agreements and linear regression 

between different formats of anti-dsDNA EIA tests were calculated and the correlation 

of anti-dsDNA antibody levels with disease activity and clinical manifestations were 

analyzed. Statistic analysis was performed using Analyse-it ® software. 

Results: High avidity EIA tests have fewer false positives, especially in other 

autoimmune disease control group (8/51 vs 1/51 and 6/51 vs 2/51). The overall 

agreement and linear regression (R 2 ) between the different assay formats ranged 

from 83.3% to 94.0% and from 0.42 to 0.96, respectively, depending mainly on 

the antibody avidity and immunoglobulin classes. The total and high avidity antidsDNA 

antibody levels have significant correlation with disease activity (M-SLEDAI, 

spearman analysis, P4 or with active 

kidney damage (t-test, P


Immunology 

first. ASO-PCR with the CDR3-JH primer set generated approximately 90 bp 

PCR products that were detected by agarose gel electrophoresis, fragment analysis 

and quantitative real time PCR. Similar experiments were performed using bone 

marrow cells from patients with multiple myeloma with M-components of various 

immunoglobulin isotypes. 

Results: The detection limit of clonal B cells by each technique was determined 

by serial dilutions and mixing of the B cell line or bone marrow cells from patients 

with multiple myeloma with normal human peripheral blood mononuclear cells; and 

B cell or myeloma cDNA serial dilutions and mixing with human placental DNA. 

Methods with consensus primers had a detection limit of 10 -3 for tumor cells both with 

agarose gel electrophoresis and Genescan detection, while the sensitivity of ASO-RT- 

PCR was 10 -4 with both detection methods. ASO-RT-PCR was able to detect IgMproducing 

clonal B cells or multiple myeloma cells at a limit of 10 -6 . The specificity 

of ASO primers was tested on human mononuclear cells from healthy controls and 

multiple myeloma patients. The lack of PCR products in these controls indicated the 

specific annealing of the primers, indicating high specificity. 

Conclusion: ASO-RT-PCR is a more sensitive molecular method for the detection of 

minimal residual disease than techniques using consensus primers only. The optimized 

ASO-RT-PCR personalized medicine test has potential as a tool for the detection and 

monitoring of minimal residual disease in patients with multiple myeloma. 

Acknowledgement: This study was supported by the Robert E. Wise, M.D. Research 

and Education Institute. 

A-227 

Evidence for hybrid light chain IgG4 molecules in normal human 

serum. 

E. Young, E. Lock, A. Cook, G. Wallis. The Binding Site Group Ltd, 

Birmingham, United Kingdom 

Background: Human IgG4 molecules are dynamic and have been shown to exchange 

half molecules to become bi-specific antibodies in a process termed Fab-arm 

exchange. Bi-specific molecules cannot cross-link antigen nor elicit lymphoid cell 

activation. It has been proposed that this mechanism may dampen-down unnecessary 

inflammatory responses. Here we show that polyclonal IgG4 antibodies with kappa or 

lambda light chains can similarly exchange resulting in hybrid asymmetrical IgG4κ/λ 

antibodies. 

Methods and Results: Polyclonal IgG4 was purified from a pooled human plasma 

source (Bio 

Products Ltd) by affinity chromatography on IgG4 Select and sequentially fractionated 

into either IgG4κ or IgG4λ. It was found that a substantial portion of purified IgG4 

(approx. 40%) possessed both kappa and lambda light chains and could not be 

fractionated by light chain specificity. Size exclusion chromatography 

showed that this material was composed of principally immunoglobulin monomers 

(150 kDa) and a much lower level of aggregates of higher molecular weight. The 

monomers were collected and analysed by ELISA and SDS-PAGE immunoblotting. 

Analytical antibodies different to those used during the purification process were 

employed to rule out idiotypic false positives. The results clearly indicated that 

IgG4 proteins containing different light chains on the same molecule were present. 

Based on the molecular weight these molecules were formed of 2 IgG4 heavy chains 

(non-identical?) plus 1 kappa and 1 lambda light chain. Polyclonal IgG depleted 

of IgG4 (mainly IgG1 and 2) was purified using Mabselect SuRe and similarly 

fractionated according to light-chain specificity. No evidence of hybrid IgG κ/λ 

antibodies was observed. This would rule out the possibility that the hybrid lightchain 

immunoglobulins had been generated by in vitro processing, and suggests that 

they are restricted to IgG4 subclass molecules. The analytical extraction procedure 

was repeated on normal serum from multiple individual donors. Hybrid IgG4κ/λ 

antibodies were found to be present in all of them. 

Conclusions: These results have unambiguously demonstrated that hybrid 

asymmetrical IgG4κ/λ antibodies are present in normal (non-immunised) human 

serum. This is a logical outcome from the process of ‘Fab-arm’ exchange in vivo. The 

clinical significance of this has yet to be determined, however assays that measure 

IgG kappa and lambda serum levels and ratios are likely to produce discordant results. 

This possibility should be considered when interpreting these assay results. 

A-228 

In vitro Allergy Testing: Correlating IgE levels Among All Allergens 

J. S. Kaptein, C. E. Lin, B. J. Goldberg. Southern California Permanente 

Medical Group, Los Angeles, CA 

Background: Allergic reactions are believed to be mediated by IgE. Clinical in vitro 

testing is available for IgE against about 500 allergens comprising grass, weed, and 

tree pollens, animal and insect products, molds, foods, and others. It is impractical 

to test for all of these. Moreover, the result for one test may be related to the result 

of another test. This report delineates the relationships between IgE levels to various 

allergen pairs. 

Methods: Patient data from in vitro testing using ImmunoCAP® technology in a 

major Southern California medical organization were extracted from instrument log 

files. Approximately 2.5 million test results were examined covering a 4.5 year span. 

Allergens were paired in all combinations, with all patient samples tested for any 

given pair being compiled, and results analyzed to determine whether there was a 

relationship between the results for the two allergens selected. Parameters investigated 

include (1) the frequency of positive/negative results for the second allergen when the 

first is positive/negative; (2) whether a positive/negative result for the second allergen 

occurs more frequently than chance when the first allergen is positive/negative; (3) 

slope, intercept, correlation, and symmetry when IgE levels specific for the two 

allergens are compared. 

Results: We have sufficient sample size to provide meaningful data for 10,000 pairs 

of allergens of the 250,000 possible pairs. Many of these show little or no relationship 

between levels of IgE for the two allergens. However, at least two types of interesting 

relationships were revealed. 

The first type represents cases where levels of IgE against one allergen closely 

correlate to levels against the second (e.g. walnut/pecan, cockroach/shrimp/lobster/ 

crab, carrot/celery, .....). 

The second type represents cases where levels of IgE against one allergen are similar 

to, or higher, but not less than, the levels against the second - e.g. patients with IgE 

against oranges have IgE directed against peanut, sesame, soybean, apple, peach and 

oat at least at the level to which they have IgE directed against orange, but not all 

patients with IgE to these other foods have IgE against orange. We interpret this as the 

allergenic component(s) of oranges being present in these other foods, but the other 

foods having additional allergenic component(s) not found in oranges. 

Additionally, we find combinations of these two types. IgE levels against carrot and 

celery correlate, however the allergenic component(s) in these are subsets of those in 

birch pollen. 

Conclusion: This study correlates results of in vitro specific IgE tests among various 

allergens with results for 10,000 pairs of allergens now available. Pairs of related 

allergens and allergens whose components are subsets of other allergens are presented. 

Knowing these patterns may help elicit the cause of some allergies - e.g. shrimp 

allergy without any prior exposure, due to cockroach or dust mite exposure. It also 

helps patients know which other allergens to avoid when known to be reactive to a 

specific allergen. Additionally, it points out redundancies in clinical testing (especially 

among the grass pollens) which has cost-savings implications. 

A-229 

Multi-center Evaluation of New Free Light Chain Methods 

W. K. Gentzer 1 , T. B. Ledue 2 , V. Luzzi 3 , R. H. Christenson 4 . 1 Siemens 

Healthcare Marburg, Marburg, Germany, 2 Foundation for Blood Research, 

Scarborough, ME, 3 Henry Ford Hospital, Detroit, MI, 4 University of 

Maryland School of Medicine, Baltimore, MD 

Background: The International Myeloma Working Group has provided consensus 

guidelines for the use of immunoglobulin free light chain (FLC) determinations in the 

diagnosis and management of clonal plasma cell disorders. We describe preliminary 

repeatability, linearity, reference range, and method comparison data for two new 

immunoassays designed for the detection of free Ig light chains type kappa and 

lambda in serum and plasma. In addition, we investigated samples from patients with 

kidney impairment for their FLC content. 

Methods: Latex-enhanced mouse monoclonal antibody reagents from Siemens for 

free Ig light chain type kappa (N Latex FLC kappa)* and free Ig light chain type 

lambda (N Latex FLC lambda)* were assayed on three BN II Systems and three BN 

ProSpec ® Systems using serum samples. Precision studies were carried out according 

to CLSI guideline EP5A-2 to estimate repeatability performance of three sample 


Immunology 


pools and two controls each for kappa and lambda, using up to three independent 

reagent and calibrator lots at the four test sites. Linearity was evaluated by calculating 

the recovery of repetitions performed at higher or lower dilutions compared to the 

results obtained with the default dilutions. Reference ranges were conducted using 

397 clinical samples from apparently healthy adults (aged 16-89 years). Qualitative 

method comparison studies using 314 samples from patients with diagnoses of 

multiple myeloma, amyloidosis, Waldenström’s macroglobulinemia, monoclonal 

gammopathy of undetermined significance, polyclonal immunoglobulin stimulation, 

or renal disease were performed at two U.S. sites against commercially available FLC 

methods for the BN II system. Statistical analysis used concordance tables and the 

kappa statistic. 

Results: ANOVA studies for between-site, between-lot, and total precision for kappa 

on BN II system were 1.1-2.1%; 2.0-3.1%; and 3.7-5.2%, respectively. On the BN 

ProSpec system, the corresponding kappa results were 2.6-5.2%; 2.4-4.8%; and 3.6- 

6.9%. Lambda results on the BN II system were 0.4-3.7%; 3.5-7.8%; and 6.2-9.1%; 

on the BN ProSpec system, lambda results were 1.8-2.5%; 1.2-5.6%; and 4.3-7.7%. 

In terms of linearity, there were 78 kappa and 117 lambda data sets available for 

analysis. For kappa 89% and for lambda 97% of the repeats recovered within ±20% 

of the initial value. Reference range studies resulted in κ/λ ratios of 0.19/0.87/1.74 

(min/median/max). Method comparison studies resulted in the following: Site 1 

analyzed 139 samples and revealed concordance rates of 89.9% for kappa, 77.0% for 

lambda, and 91.4% for the κ/λ ratio. The results at Site 2 based on 175 samples were 

88.6%, 81.7%, and 89.1%, respectively. Combining the data revealed concordance 

rates of 89.2%, 79.6%, and 90.1%. N Latex FLC results for 57 patients with kidney 

impairments ranged from 14.1-208 mg/L for kappa and 15.1-228 mg/L for lambda, 

respectively, and resulted in a κ/λ ratio distribution of 0.43/0.78/1.46 (min/median/ 

max). 

Conclusion: The new FLC methods performed well under routine laboratory 

conditions on both BN platforms. 

* Not available for sale in the U.S. 

A-230 

Analysis of factors associated with indeterminate results of whole 

blood interferon-γ release assay during routine hospital use 

O. Lee 1 , S. Kee 1 , H. Choi 1 , M. Shin 1 , J. Shin 1 , B. Park 2 , S. P. Suh 1 , D. 

Ryang 1 . 1 

Department of Laboratory Medicine, Chonnam National 

University Hospital and Medical School, Gwangju, Korea, Republic of, 

2 

Mokpo National University, Muan, Korea, Republic of 

Background: Interferon gamma release assay (IGRA) is an in vitro diagnostic assay, 

which is an alternative to replace in vivo tuberculin skin test for detection of latent 

tuberculosis infection and tuberculosis. However, higher rates of indeterminate 

results can limit the performance of the IGRA in a variety of immunosuppressive 

conditions. The aim of this study was to determine which factors were associated with 

indeterminate results of whole blood IGRA in a large cohort of patients. 

Methods: A retrospective cross-sectional study was performed on patients with 

determinate results versus patients with indeterminate results. We recruited 4,442 

patients consecutively submitted to QuantiFERON-TB Gold-In Tube assay (Cellestis, 

Australia) during routine practice from March 2009 to October 2012 at the Chonnam 

National University Hospital. Clinical and laboratory information of the patients was 

collected. 

Results: Of 4,442 patients tested for QuantiFERON-TB Gold-In Tube assay, 4,024 

(90.6%) were determinate and 418 (9.4%) indeterminate. In univariate analysis, 

younger age (


Immunology 

Results: Combylite and summated Freelite showed equivalence in both CKD 

(PB slope y=0.95x - 1.35mg/L, n=515) and CVD (y=0.97x + 3.19mg/L, n=300) 

populations. The assay showed good agreement with summated Freelite in identifying 

patients with elevated cFLC (>43.3mg/L) in CKD (PPV:97% NPV:67%) and CVD 

(PPV:93% NPV:92%) populations. The precision of the Combylite assay at a 

concentration close to the upper limit of the normal range (53.98mg/L) was: total CV 

5.5%; within run 2.1%; between run 2.9%; and between day 4.2%. In a second CKD 

population (n=1275), CVD mortality was significantly associated with elevated cFLC 

(hazard ratio (HR) =3.10, p

Immunology 


The lower detection limit for KL-6 was 12 U/mL, and the upper quantitation limit was 

5000 U/mL. No prozone effect was observed in KL-6 samples of concentrations from 

5000 through 16000 U/mL. The within-run C.V. (n=10) at 380 U/mL, 850 U/mL, and 

2100 U/mL was 0.5%, 0.7%, and 0.4%, respectively. The between-run C.V. (n=10) 

at 380 U/mL, 850 U/mL, and 2100 U/mL was 0.4%, 1.4%, and 1.9%, respectively. 

Interference studies showed no effect of bilirubin, hemoglobin, rheumatoid factor 

(RF), formazin turbidity at concentrations of 20 mg/dL, 500 mg/dL, 500 IU/dL, and 

2000 respectively. 

Comparison of our assay kit with the approved IVD reagent, the principle of which 

is enzyme immunoassay, yielded a correlation coefficient of 0.981 and an equation 

of Y (present method) = 0.99X (the ELISA kit) - 5.88 (n = 109 serum specimens). 

Also, good correlation was obtained between serum and plasma (r:0.999 ; 

slope:0.96;intercept:-6.2). 

We concluded that this assay reagent provides an accurate, precise, and simple method 

for routine measurement of KL-6 levels in serum and plasma samples. 

A-238 

Activation and Regulation of TLR1, TLR2 and TLR6 of PBMC in 

patients with ovarian cancer 

Y. Wen, S. Pan, J. Xu, B. Gu, M. Zhang, W. Zhao, Y. Jiang, L. Huang, R. 

Sun, F. Wang. the First Affi liated Hospital of Nanjing Medical University, 

Nanjing, China 

Background: Recent studies implicated inflammation in the initiation and progression 

of cancer, though the potential mechanisms of this effect were still not clear. The Tolllike 

receptors (TLRs), and their intracellular pathway were not only associated with 

the inflammatory process, but also key regulators in cancer progression. The abnormal 

expression of TLRs could promote chronic inflammation and cancer cells survival 

in the tumor microenvironment. We hypothesized that cancer cells could affect the 

inflammatory microenvironment providing further support for cancer progression, 

which may be mediated by abnormal TLRs expression in infiltrating immune cells. 

Methods: We analyzed TLR1-9 mRNA expression of human peripheral blood 

mononuclear cells (PBMCs) using quantitative real-time PCR. Assessment of 

expression levels for TLR1, TLR2 and TLR6 in PBMCs by flow cytometry. Cytokine 

bead array kit was used to quantitatively measure cytokine in the culture supernatant 

collected from cells treated with TLR1, TLR2 or TLR6 ligands. Furthermore, PBMC, 

SK-OV-3 co-culture system and anti-TLR1, anti-TLR2, anti-TLR6 mAb blocking 

experiment were used to explore the relationship between TLR1, TLR2 or TLR6 

signaling and inflammation in ovarian cancer. MyD88, TRAF6, TANK, NF-κB and 

P-NFκB were observed by western blot. 

Results: Here we sought to characterize the expression profile of TLRs in PBMCs 

from ovarian cancer patients, benign disease controls and healthy normal controls. 

TLR1~9 were all expressed in PBMCs from the three groups, and the expression 

levels of TLR2, TLR6 mRNA in patients with ovarian cancer were higher than 

the healthy controls. Ovarian cancer patients aslo showed increased TLR2 levels 

compared to benign diseases group. We found that protein expression of TLR1, 

TLR2, and TLR6 were elevated in monocytes from ovarian cancer patients compared 

to controls subiects. In concordance with the above results, there was an observable 

increased induction of inflammatory cytokine interleukin interleukin-1β(IL-1β) and 

tumour-necrosis factor-a (TNF-α) from PBMCs upon differential stimulation by 

Pam3CSK4 (TLR1/2 ligand), HKLM (TLR2 ligand) and FSL-1 (TLR6 ligand) in 

ovarian cancer patients compared to control subjects. In the PBMCs and SK-OV-3 

co-culture system, we found the activation of TLRs signaling pathways, including 

MyD88, TRAF6, TANK, NF-κB and P-NF-κB in PBMCs, and production of IL-1β, 

interleukin-6 (IL-6) and TNF-a. Treatment of PBMCs with anti-TLR1, anti-TLR2 

or -TLR6 mAb could inhibite inflammatory cytokine production and activation of 

MyD88, TRAF6, TANK, NF-γB and P-NF-γB. 

Conclusion: We provided new evidence that links TLR1, TLR2 and TLR6 signaling 

to inflammation in ovarian cancer. These results explained how advanced cancer cells 

usurp components of the host innate immune system, to generate an inflammatory 

microenvironment hospitable for metastatic malignancy growth. 

A-239 

Antinuclear antibodies screening: evaluation of the diagnostic accuracy 

of indirect immunofluorescence, ELISA and chemiluminescence 

immunoassays considering the clinical diagnosis as the gold-standard. 

F. A. Brito 1 , S. M. E. Santos 2 , G. A. Ferreira 2 , W. Pedrosa 1 , J. Gradisse 1 , 

L. C. Costa 1 , S. P. F. Neves 2 . 1 Hermes Pardini, Belo Horizonte, Brazil, 

2 

Universidade Federal de Minas Gerais, Belo Horizonte, Brazil 

Background: Detection of antinuclear antibodies (ANA) plays an important role in 

the diagnosis of systemic autoimmune rheumatic diseases (ARD). Different methods 

such as indirect immunofluorescence assay on HEp-2 cells (IFA HEp-2), ELISA, 

chemiluminescence and multiplex bead-based immunoassays (MBI) can be used for 

ANA screening. Recently the American College of Rheumatology issued a position 

statement emphasizing that IFA HEp-2 should remain as the gold standard for ANA 

screening and that clinical laboratories using ELISA or MBI must guarantee that these 

assays present similar or improved sensibility and specificity as IFA HEp-2. 

Methods: In this study we evaluated the diagnostic accuracy of three commercially 

available ELISA kits (ORGENTEC ANA Detect, QUANTA Lite ANA Elisa, IMTEC 

ANA Screen) and one chemiluminescent assay (LIAISON ANA Screen) for ANA 

detection. Clinical diagnostic was considered the gold-standard. We evaluated 143 

patients with established diagnosis of ARD (G1), 166 patients with infectious diseases 

and other rheumatic diseases for which ANA test is not useful in diagnosis (G2), 89 

outpatients with suspicion of ARD (G3) and 134 healthy subjects (G4). All assays 

were performed as recommended by the manufactures, except that indeterminate 

results were considered positive. Samples were classified as IFA HEp-2 positive if a 

well-defined IFA pattern was identified at 1:80 dilution by two observers. 

Results: The sensitivity, calculated in G1, was 87.4% for IFA HEp-2 and varied 

between 62.9% and 90.0% for other tests. The specificity, calculated in G2, was 72.3% 

for IFA HEp-2 and varied between 45.2% and 90.4% for other tests. 

The agreement of the tests with the IFA HEp-2 ranged from regular to moderate 

(kappa 0,395 to 0,581). No significant differences in areas under the ROC curve 

(0,895 for IFA and 0,807 and 0,897 for other tests) were found among the different 

assays. The diagnostic odds ratio was 18.5 for IFA HEp-2, and varied from 9.8 and 

31.0 for other tests. Of 18 IFA HEp-2 negative samples in G1, from 66.7% to 77.8% 

were positive in the most sensitive ELISA. Moreover, the antibody concentrations 

of these samples were associated with positive likelihood ratios > 5 for ARD. The 

frequency of positive results of IFAH Ep-2 in G4 was 13.5%, and 6.0% to 36.0% 

for other tests. The sensitivity and specificity of IFA HEp-2 in G3 was 92.0% and 

57.8%, while for other tests ranged between 76.0% and 100% and 26.6% and 89.1%, 

respectively. The negative predictive value was 92.5% for IFA and varied between 

89.3% and 100% for other tests. 

Conclusion: Some ELISA kits have comparable or superior diagnostic sensitivity to 

IFA HEp-2 and could be used as an alternative method for ANA screening, especially 

for large-scale ANA testing general laboratories in which the majority of ANA results 

are negative, therefore allowing the immediate report of the results with fewer false 

negatives than IFA HEp-2. Owing to the lower specificity, ELISA positive samples 

should be submitted to IFA HEp-2 for confirmation of results, determination of the 

title and the fluorescence pattern. 

A-240 

Analytical and Clinical Comparison of Two Fully Automated 

Immunoassay Systems for the Diagnosis of Celiac Disease 

G. Lakos 1 , G. L. Norman 1 , P. Martis 1 , D. Santora 2 , A. Fasano 3 . 1 INOVA 

Diagnostics, Inc., San Diego, CA, 2 University of Maryland, Baltimore, MD, 

3 

Center for Celiac Research, Massachusetts Hospital for Children, Boston, 

MA 

Background: QUANTA-Flash® h-tTG IgA and IgG, and DGP IgA and IgG are 

new, fully automated, microparticle chemiluminescent immunoassays (INOVA 

Diagnostics, Inc.) for the measurement of celiac disease (CD) antibodies. The EliA 

Celikey® tTG IgA and IgG, and DGP IgA and IgG assays are single well based, 

automated fluoroenzyme immunoassays from Thermo Fisher Scientific (formerly 

Phadia). Our goal was to assess and compare some of the analytical and clinical 

performance characteristics of the two automated systems. 

Methods: A total of 229 samples were tested in the study. After excluding CD patients 

on gluten-free diet and samples with insufficient quantity to run all tests, the cohort 


A71


Immunology 

included 75 biopsy-proven CD patients (2 with selective IgA deficiency), and 139 

controls, including age and sex matched healthy controls, and patients with food 

allergy, inflammatory bowel disease and rheumatoid arthritis. 

Results: Clinical sensitivity and specificity of the individual antibody assays were 

the following (* equivocal considered positive; ** equivocal considered negative): 

Assay Sensitivity, % Specificity, 

% 

QUANTA 

Flash h-tTG IgA 93.2 99.3 

EliA 

Celikey tTG IgA* 93.2 99.3 

EliA 

Celikey tTG IgA** 78.1 99.3 

QUANTA 

Flash h-tTG IgG 33.3 99.3 

EliA 

Celikey tTG IgG* 36.0 100.0 

EliA 

Celikey tTG IgG** 28.0 100.0 

QUANTA 

Flash DGP IgA 72.6 98.6 

EliA 

Celikey DGP IgA* 63.0 97.1 

EliA 

Celikey DGP IgG** 54.8 97.1 

QUANTA 

Flash DGP IgG 74.7 96.4 

EliA 

Celikey DGP IgG* 72.0 97.8 

EliA 

Celikey DGP IgG** 57.3 97.8 

Eight tTG 

Ig 

A result were above the analytical measuring range (AMR) with the Celikey assay, 

and three with QUANTA Flash. Auto-rerun of samples with results above the AMR 

is automatic with the QUANTA Flash assay, but manual dilution and second run is 

required with the Celikey for accurate quantitation. Thirty-four (50.0%) out of the 

68 tTG IgA positive results with the QUANTA Flash assay were higher then 10 

times of the upper limit on normal (ULN) that is the suggested threshold according 

the new ESPGHAN Guideleines for potentially avoiding biopsy for the diagnosis. 

Only 13 out of the 57 positive Celikey tTG IgA results (22.8%) were higher then 

10 times of the ULN. Seventy-four (98.7%) out of all biopsy-proven CD patients 

were correctly identified with the QUANTA Flash tTG IgA + DGP IgG combination, 

while 65 (86.7%) and 71 (94.7%) (depending on how equivocals are considered) were 

identified with the same combination of Celikey assays. 

Conclusions: The wider AMR and higher resolution of results make the QUANTA 

Flash test analytically more useful for accurate quantitation of tTG IgA antibodies 

than its Celikey counterpart. All QUANTA Flash CD assays showed same or superior 

diagnostic performance compared to the EliA Celikey assays. 

A-241 

Risk factors for bone loss after renal transplantation 

L. Luo 1 , Y. shi 2 , B. Cai 1 , Y. Bai 1 , Y. Zou 1 , L. wang 1 . 1 Department of Clinical 

Immunological Laboratory, West China Hospital, Sichuan University, chengdu, 

China, 2 Department of Nephrology, West China Hospital, Sichuan University, 

chengdu, China 

Background: Bone loss is a common clinical problem after renal transplantation. 

In light of greatly improved long-term patient and graft survival, improving other 

clinical outcomes after renal transplantation such as risk of fracture is of paramount 

importance. However, the parameters influencing bone health in Chinese patients have 

not been well defined in its pathogenesis. So this study was performed to investigate 

the prevalence and risk factors of bone loss in renal transplant recipients. 

Methods: Dual-energy X-ray absorptiometry (DEXA) was performed to measure 

BMD. All patients were divided into two groups according to BMD results: group 

1 with normal bone mineral density (T score above -1.5), group 2 with low bone 

mineral density (T score below -1.5). Clinical information such as sex, age, types of 

immunosuppressive drug and time since transplantation were included. Laboratory 

tests for parameters included serum blood urea nitrogen(BUN),creatinine(CREA),uric 

acid(URIC),calcium(Ca),phosphorus(PO4),parathyroid hormone(PTH),25-hydroxy 

vitamin D(25-OHVD),bone-specific alkaline phosphatase (b-ALP), tartrate-resistant 

acid phosphatase-5b (TRAP-5b) levels and the concentration of tacrolimus. Statistical 

analyses were performed using non-conditional logistic regression analysis to assess 

the effects of the different parameters to find possible risk factors and main factors. 

This study included a total of one hundred and twenty-four recipients who underwent 

living-related donor kidney transplantation between 2007 and 2011 at West China 

Hospital of Sichuan University. All patients received a triple immunosuppressive 

therapy consisting of steroids plus tacrolimus plus Mycophenolate Mofetil. The 

exclusion criteria were as follows: age

Immunology 


A-243 

Performance characteristics of an anti-PCP IgA and an anti-PCP IgM 

ELISA 

J. Harley, C. Budd, E. Harley, R. Budd. The Binding Site Ltd, Birmingham, 


Objective: To investigate performance characteristics of the VaccZyme TM anti-PCP 

IgA and anti-PCP IgM EIA. 

Background: Vaccine response is a useful method of assessing functional 

immunoglobulin production. Measurement of specific anti-pneumococcal capsular 

polysaccharide IgG antibodies, following pneumococcal vaccination, has been used 

to aid diagnosis in cases of immunodeficiency. Measurement of anti-PCP IgA and IgM 

antibody may provide additional information. 

Method: Anti-PCP IgA and IgM antibodies were determined using the VaccZyme 

Anti-PCP IgA EIA and IgM EIA kits (The Binding Site, UK). The concentration was 

assessed in 145 serum samples post pneumococcal vaccine immunisation. Precision 

testing was completed on three kit lots; intra-assay reproducibility was determined on 

six samples (20 replicates) and inter-assay precision was tested on eight samples in 

duplicate, on six separate occasions. Linearity was demonstrated on all three kit lots 

using a pool of high titre sera. 

Results: The incidence of anti-PCP IgA and anti-PCP IgM antibodies in 145 normal 

blood donors was shown to not follow a normal distribution (Anderson Darling 

A 2 p175 and >112 ng/mL for serum and urine, respectively) were found 

in 39% (range 6-2455 ng/mL) and 42% (range 2-1900 ng/mL) of sSLE patients 

compared to 4% (range 28-401 ng/mL) and 4% (range 1-211 ng/mL) in healthy 

Fig. 1 Absolute percent difference in sIgE concentration between the 1 st and 15 th day 

of testing. The black column represents storage at -20°C, the grey represents storage 

at 4°C, and the white column represents storage at 25°C. 


A73


Immunology 

A-246 

Incidence of antinuclear antibodies in patients treated with TNFinhibitors 

W. Klotz, J. Eibl, M. Herold. Innsbruck Medical University, Innsbruck, 

Austria 

Background: Since 1990 TNF-inhibitors have been used to treat inflammatory 

rheumatic diseases like rheumatoid arthritis (RA), spondyloarthritis (SpA) and 

psoriatic arthritis (PsA). Induction of antinuclear antibodies (ANAs) during treatment 

with TNF-inhibitors was known from the very beginning (Charles PJ et al. Arthritis 

Rheum 2000;43:2383-90), in some cases induction of drug induced lupus was seen 

(Williams EL et al. Rheumatology 2009;48:716-20). ANA screening prior to and 

during anti-TNF therapy has been recommended. We evaluated the number of patients 

who induced ANA during treatment with different TNF-inhibitors. 

Methods: In this retrospective case-control-study 124 patients were selected, all of 

whom had received anti-TNF-therapy for at least 6 months. ANA titers were measured 

by indirect immunofluorescence using HEp-2 cells. Patients were included with a 

clinical diagnosis of RA (n=87), SpA (n=28) and PsA (n=8). 

Results: 24 patients were found with ANA titers >1:100 before anti-TNF treatment 

was started and were excluded from further testing. This occurred primarily in 

patients diagnosed with RA (n=22) and one patient each in PsA and SpA. Among 

the remaining 100 patients, 33 showed a rise in ANA titer (either from negative 

to titer >1:100 or at least two titer steps) during anti-TNF treatment, 20 of them 

diagnosed with RA (23.0%), 3 with PsA (37.5%) and 10 with SpA (35.7%). HEp-2 

patterns were classified as homogenous (n=21, 63.6%), mixed homogenous & fine 

speckled (n=8, 24.2%), fine speckled (n=3, 9.1%) and nucleolar (n=1, 3.0%). Median 

time between start of treatment and occurrence of ANA titers was 33 weeks with a 

minimum of 4 and a maximum of 308 weeks. All TNF-inhibitors available in Austria 

were used (Adalimumab, n=43; Etanercept, n=32; Inflixmab, n=31; Golimumab, 

n=8; Certolizumab, n=1), some patients received two or even 3 TNF-inhibitors 

sequentially. ANA were induced in 16 patients treated with Infliximab (51.6 %), 

13 with Adalimumab (30.2 %), two with Etanercept (6.3 %), one with Golimumab 

(12.5 %) and the single patient treated with Certolizumab. Additionally, one patient 

examined developed positive ANA titers during treatment with Anakinra, an IL-1 

receptor antagonist, who retained positive ANA titers after switching to an anti-TNF 

treatment. In 13 times patients with positive ANA titers were switched to another 

anti-rheumatic biological drug, 10 times of which the p atients retained ANA titers. 

One patient showed decreasing titers after changing the drug, but increased again after 

some time, and two patients showed decreasing ANA titers. 

Conclusion: Incidence and increase of ANA titers during anti-TNF treatment is 

similar in patients with different diagnoses, but seems to differ among different 

types of TNF-inhibitors with the lowest rate under treatment with etanercept, a TNF 

receptor, compared to drugs based on monoclonal anti-TNF antibodies. 

A-247 

Role of Antiphospholipid Score and Anti-β2-glycoprotein I Domain I 

autoantibodies in the Antiphospholipid Syndrome diagnosis. 

R. Mondéjar-García 1 , C. González-Rodríguez 1 , F. J. Toyos-Sáenz de 

Miera 1 , E. Melguizo-Madrid 1 , M. Mahler 2 , I. Romero Losquiño 1 , F. 

Fabiani 1 . 1 Virgen Macarena University Hospital, Seville, Spain, 2 Innova 

Diagnostics Inc., San Diego, CA 

Background: Antiphospholipid Syndrome (APS) is characterized by the presence of 

circulating antiphospholipid antibodies (aPL) in patients with thrombosis or pregnancy 

morbidity. Recently it has been shown that multiple positive results define a higher 

risk of clinical manifestation in APS patients. However, utilizing combined results 

generate challenges for physician. Therefore, the Antiphospholipid Score (APL-S), 

a new variable that encompasses all aPL assays, has been described. We analyze 

clinical performance of different APL-S based on ELISA or chemiluminescent (CIA) 

immunoassays. 

Methods: A total of 87 patients (27 primary APS; 12 secondary APS, 30 early onset 

rheumatoid arthritis; and 18 with other rheumatological diseases) and 30 healthy 

control were included in this study. All patients were tested for Lupus Anticoagulant 

(LAC). In addition, IgM/IgG anticardiolipin (aCL) and anti-β2-glycoprotein I 

autoantibodies (aβ2GPI) were tested by QUANTA Lite ELISA and QUANTA Flash 

CIA (QUANTA Lite®, INOVA Diagnostics). Anti-aβ2GPI Domain 1 (D1) antibodies 

were tested by QUANTA Flash CIA. Three aPL-S were calculated (ELISA, CIA and 

with D1 instead of β2GPI) using the Otomo equation: aPL-S=5 x exp([OR]-5)/4. The 

upper limit of each aPL-S was determined as 20. Statistical analysis was performed 

with SPSS v15 for Windows. 

Results: IgG assays showed a good (aCL: rho=0.611, kappa=0.662; B2GPI: 

rho=0.604, kappa=0.643) while IgM assays showed moderate correlation (aCL: 

rho=0.595, kappa=0.482; B2GPI: rho=0.684, kappa=0.402). The relative risk of 

having clinical manifestation of APS (approximated by odds ratios [OR]) was 

calculated for each aPL test. The ORs for clinical manifestations of APS for aβ2GPI 

IgG and aβ2GPI-D1 by CIA were 9.1 (95% confidence interval [95% CI] 3.0-27.5) 

and 17.4 (95% CI 3.4-89.5), respectively. All three aPL-S were higher in individuals 

with thrombosis or pregnancy morbidity than in those without APS manifestations 

(p

Immunology 


curves from a single serum based calibrator fluid producing a measuring range of 

0.06 - 0.4 g/L at the standard 1/5 sample dilution, with a sensitivity of 0.06g/L. High 

samples are re-measured at a dilution of 1/10 with an upper measuring range of 

0.12 - 0.8 g/L. Intra-run precision was assessed by measurement of ten replicates of 

samples at 0.108g/L (0.85% CV) and 0.343g/L (0.59% CV). Furthermore, precision 

was assessed at the clinically relevant decision point of 0.169g/L (0.98%). Linearity 

was assessed by assaying a serially-diluted patient sample pool across the width of 

the measuring range and comparing expected versus observed results. The assay was 

shown to be linear over the range of 0.068 - 0.338g/L; y = 0.9526x + 0.01795 (R 2 

= 0.9961). Correlation to the Binding Site C1 Inactivator assay for the SPA PLUS 

was performed using 28 samples (range 0.081 - 0.406g/L). Good agreement was 

demonstrated when the data was analysed by Passing-Bablok regression; y=0.94x + 

0.01. We conclude that the C1 Inactivator assay for the Binding Site next generation 

protein analyser is reliable, accurate and precise and shows good agreement with 

existing assays. 

A-250 

Evaluation of a Beta-2-Microglobulin assay for use on the Binding Site 

Next Generation Protein Analyser 

C. N. Rowe, D. J. Matters, F. Murphy, S. J. Harding, P. J. Showell. The 

Binding Site Ltd, Birmingham, United Kingdom 

Beta-2-microglobulin (B2M) is a low molecular weight protein that is routinely 

measured in serum in the assessment of patients with renal disease, rheumatoid 

arthritis and multiple myeloma and in urine as a marker of tubular-interstitial disorder. 

Here we evaluate the performance of a B2M assay for use on the Binding Site’s next 

generation protein analyser. The instrument is a random-access bench top turbidimetric 

analyser capable of a wide range of on-board sample dilutions (up to 1/10,000) and 

throughput of up to 120 tests per hour. Precision is promoted by single-use cuvettes 

which are automatically loaded and disposed of. Assay time was 12 minutes to first 

result, and the results were measured at end point. The instrument automatically 

diluted a single serum based calibrator to produce a measuring range from 0.312mg/L 

– 40mg/L when using a 1/20 on board sample dilution. Samples reporting outside of 

the measuring range were automatically remeasured at dilutions of 1/10 and 1/40 as 

appropriate. Intra assay precision was assessed by measuring twenty replicates on 

a single calibration curve at serum samples with concentrations of 1.21mg/L (2.8% 

CV) and 20.57mg/L (1.2% CV). To assess linearity, serum sample was serially diluted 

over a measuring range of 2.27mg/L – 23.0mg/L and observed results were compared 

to expected values. Acceptable linearity was observed when results were analysed by 

linear regression; y=0.9832x + 0.2404, R 2 =0.999. Interference was tested by spiking 

haemoglobin (5000mg/L), bilirubin (200mg/L) and chyle (1500 FTU) into a serum 

sample containing 2.1mg/L B2M which was analysed at a dilution of 1/10, with no 

significant interference (within ±10%) being observed. Finally, comparison to the 

Binding Site SPA PLUS B2M assay was performed by running 25 serum samples with 

a range of 0.89-36.1mg/L. There was good agreement when the data was analysed 

by linear regression analysis; y=1.0708x – 0.0825, R 2 =0.9968. We conclude that the 

B2M assay for the Binding Site next generation protein analyser is reliable, accurate 

and precise and shows good agreement with existing assays. 

(5000mg/L) or chyle (1500 FTU = formazine turbidity units) to samples with 0.045 

g/L prealbumin concentrations, measured at a 1/1 dilution. Linearity was assessed 

by serially diluting a normal serum sample across the width of the calibration curve 

and comparing observed results with expected values. The assay showed acceptable 

linearity by linear regression; y = 0.9864x + 0.0002 g/L, R 2 = 0.9971. Comparison 

was made to the Binding Site prealbumin assay for the SPA PLUS by measuring 26 

samples from 10 normal (range 0.2-0.426g/L) and 16 clinical patients (range 0.042- 

0.196g/L). Good agreement was demonstrated by Passing and Bablok regression: y 

= 0.9642x + 0.006 g/L, R 2 = 0.9965. We conclude that the prealbumin assay for the 

Binding Site next generation protein analyser is accurate, rapid and precise and may 

be of use in laboratories where a large instrument may not be appropriate. 

A-252 

Evaluation of an Albumin assay for use on the Binding Site Next 

Generation Protein Analyser 

H. Johnson, F. Murphy, H. J. Sharrod-Cole, S. J. Harding, P. J. Showell. 

The Binding Site Ltd., Birmingham, United Kingdom 

Albumin measurement is routinely performed for the diagnosis of kidney and liver 

disease and for use in staging multiple myeloma patients. Here we describe the 

evaluation of a serum albumin assay for the Binding Site’s next generation protein 

analyser. The instrument is a random-access bench top turbidimetric analyser capable 

of a wide range of on-board sample dilutions (up to 1/10,000) and throughput of 

up to 120 tests per hour. Precision is promoted by single-use cuvettes which are 

automatically loaded and disposed of. The assay is programmed to automatically 

create a 5-point calibration curve from a single serum based calibrator. The main assay 

characteristics are summarised in the table below: 

Assay 

Serum 

Initial sample dilution 1/70 

Initial range 

3.1-93.17g/L 

Maximum sample dilution 1/121 

Maximum range 

5.4-161.05g/L 

Sensitivity 

3.105g/L 

Assay time (mins) 10.5 

Acceptable intra-assay precision was observed when analysing known serum samples 

of 3.6 (1.6% CV) and 89.3g/L (2.2% CV) twenty times against a single calibration 

curve. Linearity was assessed using a pool of normal serum samples spiked with 

purified human albumin to a final concentration of X g/L. The fluid was serially 

diluted and results were compared to expected values. The assay showed acceptable 

linearity when results were analysed by linear regression; y=1.016x-0.9581, 

R 2 =0.999. No significant interference (within ±10%) was observed when a sample 

of known albumin concentration was spiked with bilirubin (200mg/L), haemoglobin 

(5000mg/L) or Chyle (1500 FTU’s). Comparison was made to the serum albumin 

assay for use on the Binding Site SPAPLUS analyser by comparing 33 samples from 

17 normal (range 38.8-69.0g/L) and 16 clinical patients (range 20.8-37.5g/L). Good 

agreement was observed when the data was analysed by linear regression analysis; 

y=0.959X + 2.1156, R 2 =0.968. We conclude that the serum albumin assay for the 

Binding Site next generation protein analyser is reliable, accurate and precise and 

shows good agreement with existing albumin assays. 

A-251 

Evaluation of a Prealbumin assay for use on the Binding Site’s Next 


S. Kausar, F. Murphy, S. J. Harding, P. J. Showell. The Binding Site Ltd, 


Prealbumin is a 50kDa glycoprotein, which is routinely measured to assess nutritional 

status in critically ill patients. Here we describe the development of a prealbumin 

assay for use in serum on the Binding Site’s next generation protein analyser. The 

instrument is a random-access bench top turbidimetric analyser capable of a wide range 

of on-board sample dilutions (up to 1/10,000) and throughput of up to 120 tests per 

hour. Precision is promoted by single-use cuvettes which are automatically loaded and 

disposed of The instrument automatically dilutes a single calibrator fluid to produce 

a measuring range of 0.06 - 0.66 g/L at the initial 1/10 sample dilution. Low samples 

are re-measured at a dilution of 1/1, producing a sensitivity of 0.006g/L. The assay 

is read at end point with an assay time of 12mins. Acceptable intra-assay precision 

produced analysing serum samples at concentrations of 0.11 (2.4% CV) and 0.49g/L 

(1.2% CV) twenty times against a single calibration curve. No significant interference 

(within ±10%) was observed upon addition of bilirubin (200mg/L), haemoglobin 

A-253 

Inter-batch Variation and Within Batch Precision of The Binding Site 

Freelite Light Chain Assays 

D. J. Matters 1 , P. J. Showell 1 , S. J. Harding 1 , H. D. Carr-Smith 2 , L. J. Smith 1 . 

1 

The Binding Site, Birmingham, United Kingdom, 2 The Binding Site Ltd, 


International guidelines for the assessment of serum free light chains are based on 

the Freelite assay and recommend their measurement to identify and monitor patients 

with B cell disorders. Since the development of these assays, multiple myeloma (MM) 

patient outcomes have improved dramatically, highlighting the need for reproducible 

tests to monitor these patients over considerable periods of time. Here we present a 

study comparing batch to batch variation of the Freelite assay on the Siemens BNII 

and The Binding Site SPAPLUS platforms. Briefly, for each analyser 3 consecutive 

batches of reagents (comprising of latex bound antisera, supplementary, calibrators 

and controls) were used to compare a minimum of 119 samples, of which at least 

76 fell within the published normal range and at least 43 pathological samples from 

patients with MM, SLE or AL amyloidosis. All results were compared to the first 

of the consecutive batches using Passing Bablok analysis performed with Analyze-It 


A75


Immunology 

software. Further information was provided by comparing results from healthy adults 

with the manufacturers 95 th percentile reference normal ranges of 3.3-19.4mg/L for 

kappa free and 5.71-26.3mg/L for lambda free light chains using Analyse-it. Within 

batch precision was assessed by testing five replicates of the kit low control against 

five separate calibration curves and calculating the overall CV for all 25 results. 

Number of 

samples 

Batch 3 vs batch 1 regression Slope (Y=) 

Precision (%CV) and 

assigned value (mg/L) 

Number of 

samples 

Batch 1 

Batch 2 

Batch 3 

Kappa Kappa 

SPAPLUS BNII 

Batch 2 vs batch 1 regression Slope (Y=) 1.02x+0.06 0.97x- 

Lambda Lambda 

SPAPLUS BNII 

0.96x- 

0.98x+0.00 

0.01 

0.68 

119 134 122 136 

1.09x-0.03 

0.94x- 

0.15 

1.11x-0.09 

0.96x- 

0.80 

119 134 122 136 

3.60% 5.26% 

1.93% (27.2) 3.74% 

(15.3) (19.0) 

(30.4) 

5.30% 5.69% 

2.91% (28.7) 4.49% 

(14.7) (16.6) 

(28.5) 

2.57% 3.11% 

1.59% (28.3) 3.56% 

(17.9) (16.1) 

(26.3) 

Normals outside 95% range Batch 1 0.0% 1.5% 1.7% 0.0% 

Batch 2 0.0% 7.7% 3.4% 0.0% 

Batch 3 0.0% 7.7% 0.0% 0.0% 

Inter-batch agreement for the last 3 batches produced was within acceptable limits. 

Furthermore, reference range comparison showed that there was no significant 

difference between the results returned. The value of the low control was within 25% 

of the top end of the normal range and showed good precision at this medical decision 

point (19.4mg/L kappa, 26.3mg/L lambda). These results confirm the suitability of the 

Freelite assays for FLC measurements in identification and prolonged monitoring of 

patients with B cell disorders across batches of reagent. 

A-254 

Elucidating the relationship between SPE “nephrotic” pattern 

and proteinuria, and its utility in the investigation of monoclonal 

gammopathies 

H. Li 1 , P. Chan 2 . 1 University of Toronto, Toronto, ON, Canada, 2 Sunnybrook 

Health Sciences Centre & University of Toronto, Toronto, ON, Canada 

Background: Serum Protein Electrophoresis (SPE) is used to detect and quantify 

monoclonal immunoglobulins (M-proteins). In the absence of an M-protein, certain 

electrophoretic patterns, such as the so-called “nephrotic” pattern, are believed to 

reflect pathologic protein changes that may be related to monoclonal gammopathy, 

and thus are the basis for further investigations. However, vigorous validation of these 

patterns has been lacking. Objective: Our goal is to elucidate the relationship between 

SPE “nephrotic” pattern and proteinuria, and to determine its utility in detecting 

M-proteins. 

Methods: SPE was performed on the Sebia Capillarys II TM and immunofixation 

electrophoresis (IFE) on the Phoresis TM systems respectively. 203 consecutive cases 

with an SPE “nephrotic” pattern characterized by decreased albumin ([alb] 9 g/L; RI: 4-9) from the past 2 years 

were examined for levels of proteinuria and presence of M-proteins (confirmed by 

IFE). A separate cohort of 435 patients with clinical proteinuria (>500 mg/L) was 

examined for specific SPE patterns, if any, and positive rate for M-proteins. 

Results: For the 203 patients with “nephrotic” pattern, 34% had normal level of 

proteinuria, and only 12% had nephrotic level of proteinuria (>3.5 g/day for 24-h 

urine or 3.5 g/L for random). Varying the criteria for this “nephrotic” pattern i.e. [alb] 

10, [β1]

Immunology 


electrochemiluminescence immunoassay (ECLIA) tests are widely used due to good 

processing speed, reliability and price, but even new generations of HCV assay kits, 

have lower specificity than immunoblot tests. 

Objective: The goal of this study was to evaluate the CMIA Abbott® Anti-HCV test 

results against RIBA immunoblot results, and verify the need for determining a grayzone 

index, not provided in the package insert of CMIA Anti-HCV test. 

Methods: We analyzed 422 samples from Alvaro Laboratory – Center of Analysis 

and Clinical Research with Immunoblot (CHIRON ® RIBA ® HCV 3.0 SIA Chiron 

Corporation) and CMIA (Architect ® Anti-HCV, Abbott). Tests were performed 

according to manufacturers’ instructions and evaluated with internal control. For 

CMIA testing, firstly results were interpreted according to package insert, and 

secondly, gray-zone intervals were evaluated to determine inconclusive results. The 

interpretation of RIBA tests were done strictly as describe in kit package insert. 

Results: The 422 samples tested by RIBA showed 190 negative, 146 positive and 

86 inconclusive results. When the same samples were tested by CMIA, 218 negative 

and 204 positive results were observed. Excluding inconclusive RIBA results, CMIA 

method showed only 01 false positive and 08 false negative. Afterwards CMIA results 

were reclassified allocating indeterminate results in three different groups of grayzone 

(group A = 1.0 - 2.0, group B = 1.0 - 3.0, group C = 1.0 to 6.0), searching for the 

group with the lower false results prevalence (between false positive, false negative 

and false inconclusive). In this stage was observed for group A = 79, B = 69 and C = 

71 discrepancies respectively. 

Conclusion: Interpreting the CMIA results, accordingly with package insert, showed 

a fairly considerable number of samples without confirmation by immunoblot 

technique. These samples, interpreted as indeterminate result due to the presence of a 

single band in RIBA test, totalize 95 discrepant results. Negative/inconclusive samples 

showed quantitative CMIA results distributed between 0.03 and 0.94, mostly far from 

1.0. Positive / inconclusive samples showed more than 80% of results between 1.0 

and 6.0. Adoption of a gray-zone group with values between 1.0 and 3.0 has only 69 

discrepant results, the fewer total discrepancies between all groups, thus reducing 

the number of false reactive tests released and the global number of inconsistencies. 

A-257 

Method Comparison of Quantitative Hevylite Immunoassays 

Performed on Nephelometric Versus Turbidimetric Platforms 

D. Walter 1 , T. Shulta 1 , J. Flanagan 1 , A. Khajuria 1 , J. Vander Kooi 2 , J. Faint 2 , 

L. Traylor 2 , R. J. Schneider 3 . 1 Marshfi eld Clinic, Marshfi eld, WI, 2 The 

Binding Site, San Diego, CA, 3 ProHealth Care, Waukesha, WI 

Background: The new Hevylite assay (The Binding Site, Inc), is a quantitative 

serum-based immunoassay for detection of immunoglobulins (Ig) with their 

associated light chains, kappa (κ) or lambda (λ) for the investigation of myeloma 

proteins. The immune complexes formed using Hevylite antibody reagents can 

be quantified by both nephelometry and turbidimetry. The objectives of this study 

were to compare performance characteristics and analytical results of the IgG and 

IgA Hevylite reagents on a turbidimeter (The Binding Site SPA PLUS 

) versus the 

nephelometer (Siemens BNII ® ). Hevylite reagents have been validated for both 

platforms and should provide comparable results. 

Methods: Intra-assay and inter-assay imprecision were analyzed for Hevylite IgGκ, 

IgGλ, IgAκ,and IgAλ reagents on a nephelometer and a turbidimeter using control 

(or pooled patient samples) provided by Marshfield Clinic and Waukesha Hospital 

laboratories. Patient and control serum sample results were compared between both 

platforms using Hevylite kit reagents and standards. Linear regression and Passing 

& Bablok analyses were performed for method comparison. 

Results: The precision for Hevylite reagents performed on the SPA PLUS 

and BNII 

are summarized in the table below. These data are expressed as %CV for low and high 

control samples provided by the manufacturer. 

Hevylite Reagent 

Reference Range 

g/L 

Inter-Assay 

(%CV Low/ 

High) 

Intra-Assay 

(%CV Low/ 

High) 

IgGκ Reagent - BNII 4.03-9.78 1.43/2.45 2.61/3.13 

IgGκ Reagent - 

SPAPlus 

3.84-12.07 2.29/2.84 1.54/0.71 

IgGλ Reagent - BNII 1.97-5.71 2.04/0.20 2.63/2.20 

IgGλ Reagent - 

SPAPlus 

1.91-6.74 2.71/3.23 2.18/1.37 

IgAκ Reagent - BNII 0.48-2.82 1.85/0.90 3.80/1.72 

IgAκ Reagent - 

SPAPlus 

0.57-2.08 4.42/2.62 0.46/1.31 

IgAλ Reagent - BNII 0.36-1.98 6.61/9.43 1.07/5.09 

IgAλ Reagent - 

SPAPlus 

0.44-2.04 5.71/3.31 1.33/1.12 

Linearity 

y = 0.98x - 1.11; R² 

= 0.98 

y = 0.99x - 8.21; R² 

= 0.99 

y = 0.98x + 0.20; R² 

= 0.99 

y = 1.01x + 38.0; R² 

= 0.99 

y = 0.98x + 0.46; R² 

= 0.99 

y = 1.00x - 4.12 R² 

= 0.99 

y = 1.03x + 0.10; R² 

= 0.99 

y = 1.00x + 0.56; R² 

= 0.99 

Conclusion: Method comparison of the Hevylite IgG and IgA assays by 

nephelometry and turbidimetry demonstrated that either the BNII or SPA PLUS 

platform 

produce comparable and precise results. Both platforms represent viable options for 

clinical IgGκ, IgGλ, IgAκ,and IgAλ analyses. Studies are ongoing to evaluate the 

clinical utility of the Hevylite assay in monitoring myeloma patients. 

A-258 

Prognostic Marker for Overall and Progression Free Survival in Newly 

Diagnosed Multiple Myeloma Patients Treated on Total Therapy 3 

J. Bornhorst 1 , L. Traylor 2 , A. Rosenthal 3 , R. Sexton 3 , A. Mitchell 3 , S. 

Harding 4 , A. Hoering 5 , F. van Rhee 5 , J. Crowley 5 , N. Petty 5 , B. Barlogie 5 , 

S. Z. Usmani 5 . 1 University of Arkansas for Medical Sciences, Little Rock, 

AR, 2 The Binding Site, Inc, San Diego, CA, 3 Research and Biostatistics, 

Cancer Research and Biostatistics, Seattle, WA, 4 Binding Site Group 

Ltd, Birmingham, United Kingdom, 5 Myeloma Institute for Research and 

Therapy, University of Arkansas for Medical Sciences, Little Rock, AR 

Background: International guidelines for identifying monoclonal gammopathies 

currently include serum protein electrophoresis (SPEP) and serum free light chain 

(FLC) immunoassays with associated kappa/lambda (κ/λ) ratios. The (κ/λ) ratio is a 

sensitive marker of monoclonal FLC production because it includes suppression of 

the non tumor FLC in its calculation and also has prognostic implications in multiple 

myeloma (MM). Novel paired nephlometric immunoassays, called Hevylite (HLC) 

assay, enables the measurement of isotype matched immunoglobulin pairs (IgGκ/ 

IgGλ, IgAκ/IgAλ). We examined the performance of HLC assay isotypes on stored 

samples from newly diagnosed MM patients treated on two successive Total Therapy 

3 (TT3A & TT3B) trials previously carried out at the Myeloma Institute for Research 

and Therapy, at the University of Arkansas for Medical Sciences. 

Methods: The details of the TT3A and TT3B clinical trials have been published. 

Reagent kits for IgA and IgG k/λ HLC, provided by The Binding Site, Inc, were used 

to retrospectively test a subset of TT3A patients where the stored serum samples were 

still available, in the UAMS Clinical Laboratory using the BNII instrument (Siemens). 

Chi-square and Fisher’s exact tests were used to compare baseline characteristics 

between protocols patients with and without available serum samples. Univariate 

and multivariate Cox proportional hazard regression were used to model associations 

between baseline covariates and HLC assay. Kaplan and Meier method was used to 

model progression free survival (PFS) and overall survival (OS). 

Results: In all, 101 baseline serum samples were available (TT3A=67, TT3B=34) 

for patients with IgGκ (n=45), IgGλ (n=22), IgAκ (n=17) and IgAλ (n=17) isotype 

MM. Patient characteristics between the patients with and without available samples 

were comparable except for a higher proportion of IgA isotype, higher baseline serum 

CRP and higher baseline serum LDH in patients without available samples. There 

were no differences in PFS or OS amongst the 4 heavy chain isotypes. Whether 

evaluating by optimal cut-point or by tertiles, there were no differences in PFS/OS for 

the IgAκ, IgAλ or IgGλ MM. There was an OS benefit (P=0.05) observed for IgGκ 

MM subset by baseline samples and an OS (P=0.0007) and PFS (P= 0.004) benefit 

for IgGk MM subset with uninvolved IgGλ concentrations in the upper 2 tertiles. 

A PFS/OS benefit for was not observed for IgAκ with uninvolved IgAλ, IgAλ with 

uninvolved IgAκ, or IgGλ with uninvolved IgGλ MM. Comparing post-therapy HLC 

ratio normalization in 30 paired samples (IgG k/λ =22, IgA k/λ =8), there was a trend 

for improved OS (P=0.18) in patients who had normalized the ratio after autologous 

stem cell transplantation. 


A77


Immunology 

Conclusions: These data provide early evidence of pre- and post-therapeutic 

prognostic utility of the HLC assay. Although our study was conducted on a small 

subset of TT3 patients, these data support further investigation of HLC assays in 

multiple myeloma evaluation. 

A-259 

The expression of Delta-like-1 in PBMC from patients with 

autoimmune diseases 

X. Peng 1 , X. Zhang 2 , J. Chen 3 , L. Chen 2 , X. Zhang 2 , Z. Luo 2 . 1 Division of 

Clinical immunology, Department of Lab Medcine, West China Hospital, 

Sichuan University, chengdu, China, 2 Department of Immunology, West 

China School of Preclinical and Forensic Medcine, Sichuan University, 

chengdu, China, 3 Key Laboratory of West China school of stomatology, 

Sichuan University, chengdu, China 

Background: Notch signaling is involved in many developmental processes and 

lineage decisions in fetal and post-natal organogenesis, as well as in adult selfrenewing 

organs. It’s a regulator of immune cells’ differenciation, prolification, 

survival, apoptosis, mature and function, including T lymphcyte, B lymphocyte and 

DCs etc. Various Notch ligands were closely associated with differenciation tendency 

of T cell type (Th1/Th2, Th17, Treg, etc). Because the abnormal differenciation and 

function of T lymphocytes is a key immunologic mechanism of autoimmune diseases, 

so it is worth to make clear that the expressiom of Notch ligands in autoimmune 

diseases. To adrress this issue, Delta-like-1, one ligand of Notch, was detected in 

peripheral blood mononuclear cells (PBMC) from patients with autoimmune diseases, 

including rheumatoid arthritis (RA), systemic lupus erythematosus (SLE), Sjogren’s 

syndrome (SS) and Scleroderma. 

Methods:Peripheral blood mononuclear cells (PBMC) from 89 RA, 81 SS, 96 

SLE, 83 scleroderma, 52 lymphoma and 51 healthy control were analyzed the 

expression of Delta-like-1 at mRNA and protein level by RT-PCR, Western-blot and 

immunofluorescence. The data obtained was statistically analyzed by chi-square test. 

Results: The expression of Delta-like-1 was detected in PBMC from the patients with 

autoimmune diseases, while no expression of Delta-like-1 was observed in PBMC 

from normal controls and patients with lymphoma. Moreover, the expression levels of 

Delta-like-1 in PBMC from the patients with RA, SLE or SS seems higher than that 

patients with scleroderma. It showed significant difference between RA, SLE, SS, 

scleroderma and healthy controls, lymphoma (P < 0.01). 

Conclusion: The expression level of Delta-like-1 in PBMC was upregulated 

significantly in patients with autoimmune diseases including RA, SLE, SS and 

scleroderma, and its extent in RA, SLE and SS is more obvious than that in 

Scleroderma. These results suggested that Delta-like-1 mediated Notch signaling 

pathway may involve in autoimmune diseases’ pathogenesis, and it would be a new 

therapy for autoimmune diseases by the regulation of this Notch signaling pathway. 

A-260 

HELIOS, a bright future for ANA - automated indirect 

immunofluorescence (IIF) assay. 

T. Matthias 1 , B. Gilburd 2 , N. Agmon-Levin 2 , T. Martins 1 , A. Petzold 1 , Y. Shoenfeld 2 . 

1 

AESKU.DIAGNOSTICS, Oakland, CA, 2 The Zabludowitcz Center for Autoimmune 

Diseases, Tel Aviv, Israel 

Introduction: In the latest declaration of the American College of Rheumatology 

committee for autoantibodies detection, the IIF technique was considered the standard 

screening test for ANA determination. Thereafter, an extensive evolution to develop 

technological solutions for automatization of IIF was initiated, including devices for 

substrates (slides) preparation as well as for their interpretation. 

Objective of the study: To evaluate the first fully automated (HELIOS) IIF processor 

including an integrated optical system for automatic slides reading aimed at positive/ 

negative sample discrimination. 

Patients and methods: Two hundred samples (47 ANA negative, 70 ANA- ENA 

positive and 83 ANA positive by ELISA) were reevaluated for ANA utilizing the 

HELIOS system as well as manual routine microscopic evaluated by two different 

expert observers. 

Results: The agreement between ANA determination by the HELIOS system and 

results obtained by the expert observers reached 92% of which a concurrence of 

97.6% was observed in the ANA negative group and 90% in the ANA positive group. 

Notably, all discordant positive samples were characterized by very low fluorescent 

signal and unidentified patterns. On the other hand, the HELIOS system recognized a 

broad range of fluorescence patterns, including one esoteric pattern. 

The correlation between the IFA performed by the automated system or manually 

and ELISA test was 91 %. 

Conclusions: The HELIOS system is able to discriminate correctly ANA positive/ 

negative samples compared to manual microscopic IIF performed by two independent 

experts. This novel approach to IIF determination may reduce inter-laboratory 

variability and time required to perform this test especially in high throughput 

laboratories. 

A-261 

Evaluation of the Utility of Serum FLC Ratio for Screening and 

Monitoring PTLD in Post Solid Organ Transplant Patients 

P. Wang 1 , I. Shu 1 , D. Kuhn 2 , K. Kuus 2 . 1 The Methodist Hospital, Houston, 

TX, 2 The Binding Site, San Diego, CA 

Background: Post Transplant Lymphoproliferative Disease (PTLD) is primarily 

diagnosed histologically using tissue biopsy and distinguished by features such as 

cytogenetic abnormalities, immunoglobulin gene rearrangements, donor vs recipient 

origin and EBV status. Monitoring for the presence of a persistent monoclonal protein 

in the serum or urine using SPEP (serum protein electrophoresis), UPEP (urine 

protein electrophoresis) and IFE (immunofixation electrophoresis) is an effective, 

inexpensive and non-invasive way to screen and monitor PTLD in post solid organ 

transplant patients. Although guidelines are available for the use of serum free light 

chain (FLC) ratio in the screening and monitoring of multiple myeloma and other 

B cell dyscrasias, the use of this ratio in the screening and monitoring of PTLD has 

not been studied. It is not clear what reference range should be used, and how this 

quantitative serum assay compares to SPEP/UPEP/IFE. 

Methods: We analyzed 75 serum samples of consecutive post solid organ transplant 

subjects (57 lung transplants, 4 heart, 5 kidney, 3 liver, 3 heart/lung, 2 kidney/lung 

and 1 liver/lung) using the serum FREELITE assay on a Beckman Immage analyzer. 

SPEP, UPEP, IFE results and clinical diagnosis related to PTLD were retrieved from 

medical records. 

Results: Sixty-three samples had normal SPEP, UPEP and no clinical diagnosis of 

PTLD or other B cell dyscrasias. In this group, the mean of free Kappa light chain 

concentration was 2.77 mg/dL, median was 1.35 mg/dL, and 95 percentile range 

was 0.44-11.18 mg/dL. The mean of free Lambda light chain concentration was 

2.34 mg/dL, median was 1.52 mg/dL, and 95 percentile range was 0.59-8.17 mg/ 

dL. The mean of Kappa/Lambda ratio was 1.15, median was 0.83, and 95 percentile 

range was 0.45-1.56. Twelve samples showed gammopathy on SPEP or UPEP but 

no clinical diagnosis of PTLD. Using the reference range of 0.26-1.65 for Kappa/ 

Lambda ratio, the FLC ratio would identify 69 samples as low probability for PTLD, 

and 6 samples as high probability for PTLD, which calculated a clinical specificity of 

92%. In contrast, the SPEP/UPEP/IFE as screening/monitoring tool for PTLD had a 

clinical specificity of 84%. 

Conclusions: The mean, median and upper 95 percentile range of FLC concentrations 

in transplant recipients without PTLD and gammopathy were higher than those of 

normal healthy population. The Kappa/Lambda ratio in this population was similar to 

that of healthy adults. When used as a screening/monitoring tool for PTLD, the FLC 

ratio demonstrated a higher clinical specificity than SPEP/UPEP/IFE. 

A-263 

Expansion Tregs and inhibition Th17/Th1 by sirolimus-based regimen 

is dependent on STAT-signaling compared with tacrolimus-based 

regimen in renal transplant recipients 

Y. Li 1 , Y. Shi 2 , Y. Bai 1 , J. Tang 1 , J. Zhang 1 , L. wang 1 . 1 Department of 

Clinical Immunological Laboratory, West China Hospital, Sichuan 

University, chengdu, China, 2 Department of Nephrology, West China 

Hospital, Sichuan University, chengdu, China 

Background: Mammalian Target-of-Rapamycin inhibitors (mTOR inhibitors, 

Sirolimus) has been used as de novo base therapy with steroids and mycophenolate 

mofetil (MMF) in an effort to completely avoid the use of CNI (calcineurin 

inhibitors). Previous studies have demonstrated sirolimus (SRL), might facilitate 

immunoregulation by increasing Treg percentages, recent studies found the kinase 


Immunology 


mTOR has emerged as an important regulator of the differentiation of helper T cells. 

So the recipients used sirolimus might affect the balance of the Th cells (Th17, Th1 

and Treg). 

Methods: We included 48 renal transplantation recipient (24 recipient used sirolimus 

based regimen coversion from tacrolimus and 24 recipient used tacrolimus based 

regimen) and 24 healthy control in our study. Of all these subjects, Th cells and the 

STAT proteins frequencies in the peripheral blood were analyzed by flow cytometry 

(FCM).At the meantime, the plasma levels of IL-1β, IFN-γ, IL-17, IL-6 and IL-10 

were analyzed by Bio-Plex® suspension array system. 

Results: Recipients who used tacrolimus based regimen exhibited renal dysfunction 

and hypertension.The frequencies of Treg cells in TAC group [1.5(1.2-1. 8)] decreased 

significantly when compared with SRL group [3.9(2.5-5.5)] and healthy control group 

[4.9(3.8-5.5)] (P0.05). The Th17/Treg ration in TAC group 

[1.2(0.6-1.6)] decreased significantly when compared with SRL group [0.5(0.3-1.6)] 

and healthy control group [0.6(0.2-1.2)] (P


Immunology 

diagnosis, there is no reliable markers to differentiate CNS patients who will convert 

to MS. It´s our aim to study the value of cerebrospinal fluid (CSF) k light chain in the 

differentiation of CNS patients vs EM patients. 

Material and methods: CSF samples were collected from 204 consecutive unselected 

patients who underwent a lumbar puncture. Patients’ records were reviewed and 

several diagnostic subgroups were established. Group 1: Control group with patients 

that do not fulfill MS criteria (no oligoclonal bands). Group 2: Patients without 

oligoclonal bands but with other CNS inflammatory diseases. Group 3: Patients with 

oligoclonal bands without EM diagnostic. Group 4: Patients with oligoclonal bands 

with a confirmed EM diagnostic. Kappa free light chains were quantified in CSF by 

nephelometry using polyclonal antibodies based assay. Serum and CSF Albumin and 

IgG were also quantified by nephelemotry and IgG Oligoclonal bands (OCB) were 

performed by iso-electro-focusing. Statistic analyses were performed with GraphPad 

Prism v5. Results are presented in table 1. 

Conclusion: The combined used of the actual criteria together with the levels of CSF 

k light chain may add beneficial information to aid in the MS diagnostic. K CSF 

presented a higher sensitivity and specificity when compared with the traditional IgG 

index. 

Analyte 

B/B B/B P/B P/B 

Mean SD Mean SD 

(B/B) - (P/B) B/B 3xSD 

AFP (ng/mL) 11,86 0,57 12,04 0,08 0,17 1,71 

aHAV (UI/L) 39,82 4,51 39,29 4,74 0,54 13,54 

aHBC (index value) 0,87 0,05 0,91 0,04 0,04 0,15 

aHBE (index value) 0,80 0,02 0,81 0,02 0,01 0,06 

aHBS (UI/L) 8,95 0,11 9,10 0,26 0,16 0,33 

HCGβ (mUI/mL) 1,35 0,18 1,41 0,09 0,06 0,53 

CA 125 (U/mL) 34,21 0,60 34,74 1,32 0,53 1,80 

CA 15-3 (U/mL) 24,51 0,31 24,60 0,16 0,10 0,93 

CA 19-9 (U/mL) 38,79 0,29 39,23 0,52 0,45 0,87 

CEA (ng/mL) 4,86 0,11 4,93 0,15 0,07 0,33 

fPSA (ng/mL) 0,67 0,01 0,66 0,01 0,01 0,02 

aHAV M (index value) 18,43 0,35 18,55 0,32 0,11 1,04 

HBSAgII (index value) 1,07 0,08 1,01 0,11 -0,07 0,24 

tPSA (ng/mL) 3,86 0,06 3,92 0,05 0,06 0,19 

HCV (index value) 2,52 0,98 2,82 0,87 0,30 2,95 

Conclusion: Our study suggest Siemens ADVIA Chemistry 2400 characteristics, 

such as positive liquid displacement sample probe and analyzer washing system, 

are proven to be efficient in preventing carryover, since no statistically or clinically 

significant difference was observed. For the analytes assessed, minimal analytical 

laboratory error is expected due to carryover. 

A-269 

Anti-dsDNA: How to trust in results from different kits and methods ? 

e. A. rosseto 1 , P. Estelha 2 , I. Cunha 2 , A. Oliveira 2 , N. Z. Maluf 2 , K. I. L. C. 

Salmazi 3 , C. L. Pitangueira Mangueira 1 . 1 Hospital Albert Einstein / HC- 

FMUSP, São Paulo, Brazil, 2 HC-FMUSP, São Paulo, Brazil, 3 Hospital 

Albert Einstein / USP, São Paulo, Brazil 

A-268 

Evaluation of potential sample-to-sample carryover between chemistry 

and immunoassay systems 

O. V. P. Denardin, L. K. Tirado, C. A. O. Galoro, S. S. Almeida. DASA, 

São Paulo, Brazil 

Background: The laboratory automation systems have allowed laboratories to reduce 

their aliquotting needs. However, sharing samples for testing between chemistry and 

immunoassay systems may cause carryover between samples. Carryover is defined 

as the transfer of a small portion of one sample to the sample immediately following 

it in the testing sequence of the analyzer. Cross contamination between samples can 

possibly produce false positive results. 

Objectives: The aim of this study was to evaluate sample-to-sample carryover when 

sharing samples between chemistry and immunoassay systems and its clinical impact. 

Methods: Carryover was assessed for fifteen analytes, using Control Lab protocol: 

two pools were prepared, collecting 10 positive and 10 borderline samples, for each 

immunoassay analyte. The positive sample pool (P) and the borderline sample pool 

(B) were aliquoted into a total of 21 tubes. The aliquots were processed in a specific 

sequence on the ADVIA® Chemistry 2400 (Siemens Healthcare Diagnostics), 

alternating the pools. Finally, the aliquots were assessed on Modular Analytics 

EVO (Roche Diagnostics). The mean of low concentration aliquots measured after 

high concentration aliquots (P/B) was calculated and compared to the mean of low 

concentration aliquots following low concentration aliquots (B/B). Sample-tosample 

carryover was determined as the difference between these means. Significant 

carryover was detected If the difference between P/B and B/B was higher than 3 

standard deviations (SD) from the of B/B value. 

Results: According to data shown in the table bellow, no statistically significant 

sample-to-sample carryover was detected when sharing samples between ADVIA 

Chemistry and Modular Analytics EVO. 

Background:The tests currently used to detect anti-dsDNA are the enzyme-linked 

immunosorbent assay (EIA) and the Indirect Immunoflluorescence (IFI) Crithidia 

luciliae test. However, discordant results between the different EIA kits and between 

EIA and IFI are commonly found in clinical practice and put the credibility of clinical 

laboratories under suspicion. 

Methods: In this study we used 4 commercial EIA kits and 3 commercial IFI kits 

to detect and quantify anti-dsDNA. The degree of correlation between them was 

measured, in a effort to show the possible result variations that a clinician can find 

by just changing the laboratory of analysis.We used 69 blood samples, ordered by 

a clinician for dosage of anti-dsDNA in a clinical laboratory of São Paulo, Brasil. 

These samples were selected: the negative results from the two methods; high positive 

reactant and low reactant by ELISA with IFI reactant; and not reactant for both. The 

EIA kits used dominant A, B, C and D and the kits of IFI Crithidia 1, 2 and 3. For 

the screen of samples we used EIA kit A (reference value 200 U/mL), the correlation 

between the EIA kits was 77,7% and between IFI kits was 91,6%. Only EIA (B) and 

(C) kits Kappa > 75% (77,9%). Only IFI (2) and (3) kits Kappa >75% (82,5%). The 

EIA >200 U/mL we found a high correlation between EIA and IFI. The EIA

Immunology 


A-270 

Measurement of serum free light chain levels in HIV patients using a 

new rapid lateral flow test 

J. Campbell, A. Stride, Y. Wang, M. Goodall, S. Bonney, A. Chamba, 

T. Plant, Z. Afzal, R. Jefferies, M. Drayson. University of Birmingham, 


Background: B cell dysregulation contributes to immunodeficiency, risk of AIDS 

and risk of B cell Non Hodgkins Lymphoma (NHL) in HIV patients. As viral load 

increases and CD4 counts decline, this B cell dysregulation is characterised by 

an increased production of intact immunoglobulins (e.g., IgA, IgM, IgG) and free 

light chains (FLC). Partly because FLC half-life in serum is 3-6 hours, compared to 

5-21 days for intact immunoglobulin, FLCs are often regarded as a more sensitive 

marker of B cell activation. Two recent studies have demonstrated that levels of κ 

or λ FLC >40mg/L were associated with a greater odds-ratio of acquiring AIDSdefining 

infections and NHL. At present, laboratory FLC tests offer the only means of 

quantitating FLC and require expensive analytical instrumentation, skilled personnel 

and often a turnaround time of many days. The aim of this study was to assess the 

clinical utility of a new and cost-effective rapid lateral-flow test that quantitates serum 

and urine FLC in 10 minutes (Seralite). 

Methods: Stored sera from HIV patients were tested for FLC by Seralite and results 

correlated with serum FLC levels measured by Freelite, total IgA, IgM, IgG, and CD4 

counts. Samples were selected based on known FLC levels (Freelite) falling within 

the following deciles (n=25 per decile): 0-10, 11-20, 21-30, 31-40 and 50+ mg/L for 

κ and λ FLC. 

Results: Results revealed that Seralite and Freelite had excellent quantitative 

concordance. Supporting prior findings, FLC levels were positively associated with 

total immunoglobulin levels, and negatively associated with CD4 counts. 

Conclusion: Prospective use of Seralite to monitor FLC levels as an indicator of 

B cell dysregulation in HIV patients should now be investigated. Use of Seralite as 

a surrogate for CD4 counts in resource-limited settings should also be investigated. 

A-271 

The Method Matters: Multiple Macroenzymes Detected in the 

Presence of Hypergammaglobulinemia 

S. P. Wyness 1 , S. L. La’ulu 1 , M. Yee 2 , L. Tosiello 3 , J. A. Straseski 4 . 1 ARUP 

Institute for Clinical and Experimental Pathology, Salt Lake City, UT, 

2 

SUNY, StonyBrook School of Medicine, StonyBrook, NY, 3 Department 

of Medicine Jersey City Medical Center, Jersey City, NJ, 4 Department of 

Pathology, University of Utah, Salt Lake City, UT 

Background: We report the finding of an individual with hypergammaglobulinemia, 

elevated creatinine kinase (CK), elevated liver enzymes, and amylase concentrations 

at the high end of the normal range. Patient denied any symptoms associated with these 

values (myalgia, fevers, rashes, chest pain, or muscle weakness). The elevated CK was 

determined to be due to immunoglobulin bound macro-CK type 1, thus macroenzymes 

were considered as a possible source of the elevated liver enzymes. The presence of 

multiple macroenzymes, and the possible role of hypergammaglobulinemia, has not 

been previously reported in the literature. 

Methods: Polyethylene glycol (PEG) precipitation and ultrafiltration (UF) were 

used to evaluate the presence of seven macroenzymes (alkaline phosphatase (ALP), 

alanine aminotransferase (ALT), amylase (AMYL), aspartate aminotransferase 

(AST), CK, lactate dehydrogenase (LD) and lipase (LIP)). Monomeric recoveries 

were determined by dividing the activity of the supernatant or ultrafiltrate by the neat 

activity and converting to a percent. Results were compared to previously reported 

reference intervals established in healthy populations. 

Results: PEG monomeric recoveries suggested the presence of 6 of the 7 

macroenzymes tested (all but ALP). UF revealed the presence of three macroenzymes 

(CK, AST and AMYL). These results were observed on two separate occasions, 10 

months apart. Previous data had indicated that UF was the more precise method of 

macroenzyme detection of CK, AST, AMYL, LD, and LIP (Wyness et al., Clin Chim 

Acta, 2010 and 2011). 

Conclusions: The macroenzymes identified by UF supported the clinical presentation 

of elevated CK and AST. MacroAMYL was also detected by UF, despite high-normal 

AMYL values. However, normal serum AMYL in the presence of macroAMYL is 

well documented. A previous report has shown that when globulins are present in 

excess, PEG may co-precipitate monomeric enzymes along with serum globulins, 

causing false-positive reporting of macroenzymes (Ram et al., Ann Clin Biochem, 

2008). This mechanism may explain the discrepancy between PEG and UF results 

in the presence of hypergammaglobulinemia, making UF a better method of 

detection in these circumstances. The presence of multiple macroenzymes in a single 

patient is novel, however, the preferential use of UF needs to be confirmed in other 

hypergammaglobulinemic patients. 

A-272 

Evaluation of a novel IgG assay for use on the Binding Site Next 


S. Kausar, A. J. Alvi, S. J. Harding, P. J. Showell. The Binding Site Ltd., 


IgG is a routinely assessed serum protein whose concentration can be diagnostically 

useful in a wide range of diseases, including infection, autoimmune conditions, 

chronic lymphocytic leukemia and multiple myeloma. We present the performance 

characteristics of a new immunoassay designed for the quantification of IgG in human 

serum using the Binding Site’s next generation protein analyser. The instrument is a 

random-access bench top turbidimetric analyser capable of a wide range of on-board 

sample dilutions (up to 1/10,000) and throughput of up to 120 tests per hour. Precision 

is promoted by single-use cuvettes which are automatically loaded and disposed of. 

The measuring range of the assay at a standard 1/10 dilution is 1.65 to 35.0g/L with 

reflex dilutions above and below the standard range, giving a higher range of 6.60 to 

140.0g/L and a sensitivity of 0.165g/L when using neat sample. Linearity of the assay 

was established by running a serially-diluted patient sample across the width of the 

standard measuring range and comparing the observed and expected results. Assay 

linearity was demonstrated over a range of 1.711 to 37.392g/L with a linear regression 

equation of y = 0.9705x + 0.2622, (R 2 = 0.9972). The assay was evaluated for intrarun 

precision across the width of the standard measuring range by measurement 

of twenty replicates of sample pools at relevant medical decision points and the 

extremities of the curve (Sample 1, 3.097g/L, CV = 2.15%), lower medical decision 

point of 6.295g/L (Sample 2, CV = 1.55%), upper medical decision point of 15.523g/L 

(Sample 3, CV = 1.98%) and at the upper level of the curve (Sample 4, 33.116g/L, 

CV = 1.16%). Antigen excess capacity was determined as 195g/L by extending the 

upper range of the calibration curve. Interference was tested by the addition of known 

concentrations of Bilirubin (200mg/L), Chyle (1500 formazine turbidity units) or 

Haemoglobin (5g/L) to serum samples (median 11.711g/L; range 1.880 – 19.696g/L). 

No significant (±10%) interference was observed. A comparison was made between 

this assay and the IgG assay for the Binding Site SPA PLUS using 28 normal (range 

10.322 – 22.173g/L) and 37 pathological (range 2.869 – 34.50g/L) sera. A Passing & 

Bablok regression equation of y = 0.99x – 0.03 demonstrated acceptable agreement 

between the two assays with no sample having a greater than 9.49% discordance. 

The results presented allow us to conclude that the IgG assay for the Binding Site 

next generation protein analyser is reliable, precise and accurate and shows good 

agreement with the SPA PLUS assay. 

A-273 

Evaluation of immunoglobulin free light chain (Freelite®) assays on 

the Binding Site Next Generation Protein Analyser 

D. G. McEntree, M. D. Coley, D. J. Matters, S. J. Harding, H. D. Carr- 

Smith, P. J. Showell. The Binding Site Ltd, Birmingham, United Kingdom 

International guidelines based upon the Freelite® assay recommend use of serum 

free light chain (FLC) measurements as an aid in the diagnosis of patients with B 

cell disorders and as tools to monitor patients with AL amyloidosis, non-secretory 

myeloma and light chain myeloma. Here we describe the development of the Freelite 

assay for the Binding Site’s Next Generation Protein Analyser. The instrument is a 

random-access bench top turbidimetric analyser capable of a wide range of on board 

sample dilutions (up to 1/10,000), throughput of up to 120 tests per hour and multiple 

methods of antigen excess detection. Precision is promoted by single use cuvettes 

which are automatically loaded and disposed of. The instrument automatically dilutes 

a single calibrator to produce a calibration curve producing measuring ranges of 

4-180g/L for Kappa FLC and 4.5-165mg/L for Lambda FLC at the standard 1/10 

sample dilution. There was acceptable intra-assay precision when levels of 134mg/L 

(2.2% CV) and 6.5mg/L (4.9%) for kappa FLC, and 130mg/L (1.0%) and 7.56mg/L 

(3.7%) for lambda FLC were run twenty times on a single calibration curve. Similarly, 

there was good linearity for the kappa (y = 0.99x + 0.99mg/L; R 2 = 1.00) and lambda 

(y = 1.01x + 0.07mg/L; R 2 = 1.00) FLC assays as determined by serial dilutions of a 


A81


Immunology 

sample across the width of the calibration curves at the minimum sample dilution. 

Comparison of these assays to Freelite BN TM II assays for 141 kappa (79 normal, 62 

monoclonal, mean 535.20mg/L, range 1.13-17,868.19mg/L) and 129 lambda (79 

normal, 50 monoclonal, 275.06mg/L, range 0.52-3833.94mg/L) FLC samples showed 

good agreement (kappa, y=0.91x + 43.91mg/L R 2 = 0.98, and lambda, y=0.97x - 

4.28g/L; R 2 = 0.96). A selected population of 9 kappa and 9 lambda FLC samples were 

analysed at a non-standard dilution to mimic antigen excess. In all cases (9/9 kappa 

and 9/9 lambda) antigen excess samples were identified by the instruments protective 

function. We conclude that the Freelite assays for the Binding Site Next Generation 

Protein Analyser are rapid, accurate and precise and protected from false low results 

by the instruments automatic antigen excess check function. 

A-274 

Evaluation of a C4 assay for use on the Binding Site Next Generation 

Protein Analyser 

P. S. Patel, F. Murphy, S. J. Harding, P. J. Showell. The Binding Site Ltd, 


Serum complement consists of around 30 proteins that have a fundamental role in 

immune system functionality. Inherited deficiencies in C4 are associated with an 

increased risk of developing systemic lupus erythematosus (SLE). Conversely, high 

levels of circulating immune complexes in SLE can reduce serum levels of complement 

components. C4 deficiency is also associated with glomerulonephritis and vasculitis. 

Here we describe the evaluation of a serum C4 assay for Binding Site’s next generation 

protein analyser. The instrument is a random-access bench top turbidimetric analyser 

capable of a wide range of on-board sample dilutions (up to 1/10,000) and throughput 

of up to 120 tests per hour. Precision is promoted by single-use cuvettes which are 

automatically loaded and disposed of. The instrument automatically dilutes a single 

calibrator to produce a calibration curve with a measuring range of 0.064 - 0.9 g/L at 

the standard 1/10 sample dilution, with sensitivity of 0.0064 g/L. High samples are 

remeasured at a dilution of 1/20 with an upper measuring range of 0.128 -1.8 g/L. 

Precision studies (CLSI EP5-A2) were performed at three levels in duplicate over 21 

working days. Antigen levels of 0.779, 0.166 and 0.117g/L were assessed for total, 

within-run, between-run and between-day precision, using one lot of reagent on three 

analysers. The coefficients of variation were 4.4%, 2.2%, 2.0% and 3.3% for the high 

sample, 7.7%, 2.2%, 1.5% and 7.3% for the medium sample and 5.2%, 2.0% 2.4% and 

4.1% for the low sample respectively. Linearity was assessed by assaying a seriallydiluted 

patient sample pool across the width of the measuring range (0.001 - 0.882 

g/L) and comparing expected versus observed results. The assay showed a high degree 

of linearity when expected values were regressed against measured values (y=1.013x 

+ 0.0177 R² = 0.998. No significant interference (within ±10%) was observed on 

addition of bilirubin (200mg/L), haemoglobin (5000mg/L) or chyle (1500 formazine 

turbidity units) when spiked into to samples with known C4 concentrations at the 

minimum sample dilution. Correlation to the Binding Site C4 assay for the SPA PLUS 

was performed using normal and clinical samples (n=70, range 0.028-0.839g/L). 

Good agreement was demonstrated by Passing-Bablok regression; y=0.98x + 0.0g/L. 

We conclude that the C4 assay for the Binding Site next generation protein analyser is 

reliable, accurate and precise and shows good agreement with existing assays. 

A-275 

Evaluation of a novel assay for IgA subclasses for use on the Binding 

Site Next Generation Protein Analyser 

S. K. Dhaliwal, N. L. Gilman, A. J. Alvi, S. J. Harding, P. J. Showell. The 

Binding Site Ltd., Birmingham, United Kingdom 

There are two human IgA subclasses (IgA1 and IgA2), of which IgA1 is the most 

abundant in serum, representing 80-90% of total IgA. Elevated levels of either or both 

subclass may indicate infection whilst reduced levels are associated with IgA subclass 

specific immune-deficiencies. Here we present the performance characteristics of 

two new IgA subclass immunoassays designed for the quantification of IgA1 and 

IgA2 in human serum using the Binding Site next generation protein analyser. The 

instrument is a random-access bench top turbidimetric analyser capable of a wide 

range of on-board sample dilutions (up to 1/10,000) and throughput of up to 120 

tests per hour. Precision is promoted by single-use cuvettes which are automatically 

loaded and disposed of, thus eliminating the risk of cuvette carry-over. Linearity of the 

assays was established by running serially-diluted patient samples across the width 

of the standard measuring range and comparing the observed and expected results. 

Interference was tested by the addition of known concentrations of Haemoglobin 

(5g/L), Bilirubin (200mg/L) or Chyle (1500 formazine turbidity units) to serum 

samples at the immune-deficiency medical decision points (IgA1: 760mg/L, IgA2: 

67.260mg/L). The assays were evaluated for intra-run precision across the width of 

their standard measuring ranges by measurement of twenty replicates of sample pools 

at points emphasising the lower and upper portions of the curve. A comparison study 

was performed between these assays and the equivalent assays for the Binding Site 

SPA PLUS. 

Assay IgA1 IgA2 

Range 362.12 – 6156.0 mg/L 50.92 – 1273.0 mg/L 

Minimum sample 

1/1 1/1 

dilution 

Standard sample 

1/10 1/10 

dilution 

Sensitivity 36.2 mg/L 5.092 mg/L 

Linearity – linear 

y = 0.9995x – 0.4164, R 

regression 

2 = 0.9994 y = 1.0011x – 3.0844, R2 = 

0.9965 

Interference – 

-3.31% -0.52% 

Haemoglobin 

Interference – 

2.44% -0.80% 

Bilirubin 

Interference – Chyle 4.91% -3.96% 

y = 0.9978x – 97.164, R 

Comparison-linear 

2 = y = 1.0469x + 18.445, R 2 = 

0.9947 (n = 46, range = 462.9 – 0.9909 (n = 49, range = 57.4 – 

regression 

6156.0mg/L) 

1012.0mg/L) 

Intra-assay precision 

(n=20) %CV (Mean) 

0.78% 

(4954.59mg/L) 

1.04% 

(504.915mg/L) 

1.74% 

(894mg/L) 

1.14% 

(80mg/L) 

The results presented above allow us to conclude that the IgA1 and IgA2 assays for 

the Binding Site next generation protein analyser are reliable, precise and accurate and 

show good agreement with the SPA PLUS assays. 

A-276 

Evaluation of a C3c assay for use on the Binding Site Next Generation 

Protein Analyser 

L. W. Aston-Abbott, F. Murphy, S. J. Harding, P. J. Showell. The Binding 

Site Ltd, Birmingham, United Kingdom 

Serum complement consists of around 30 proteins that have a fundamental role in 

immune system functionality. Inherited deficiencies in C3c are associated with an 

increased risk of developing systemic lupus erythematosus (SLE). C3c deficiency 

may present with recurrent infections such as pneumonia, septicaemia and meningitis. 

Here we describe the evaluation of a serum C3c assay for use on the Binding Site’s 

next generation protein analyser. The instrument is a random-access bench top 

turbidimetric analyser capable of a wide range of on-board sample dilutions (up 

to 1/10,000) and throughput of up to 120 tests per hour. Precision is promoted by 

single-use cuvettes which are automatically loaded and disposed of. The instrument 

automatically dilutes a single calibrator to produce a calibration curve with a 

measuring range of 0.25-3.0g/L at the standard 1/10 sample dilution, with sensitivity 

of 0.025g/L. High samples are automatically re-measured at a dilution of 1/20, with an 

upper measuring range of 0.5-6g/L. Precision studies (CLSI EP5-A2) were performed 

at three levels in duplicate over 21 working days. Antigen levels of 2.39, 0.793 and 

0.39g/L were assessed for total, within-run, between-run and between-day precision, 

using one lot of reagent on three analysers. The coefficients of variation were 4.1%, 

1.8%, 2.5% and 2.7% for the high sample, 4.9%, 1.5%, 1.7% and 4.4% for the medium 

sample and 4.0%, 2.1% 1.4% and 3.2% for the low sample respectively. Linearity was 

assessed by assaying a serially-diluted patient sample pool across the width of the 

measuring range (0.303-3.036g/L) and comparing expected versus observed results. 

The assay showed a high degree of linearity when expected values were regressed 

against measured values (y=1.03x + 0.017g/L, R² = 0.998). No significant interference 

(within ±10%) was observed on addition of bilirubin (200mg/L), haemoglobin 

(5000mg/L) or chyle (1250 formazine turbidity units) when spiked into a sample with 

known C3c concentrations analysed at the minimum sample dilution. Correlation to 

the Binding Site C3c assay for the SPA PLUS was performed using both normal and 

clinical samples (n=78, range 0.41-4.75g/L). Good agreement was demonstrated by 

Passing-Bablok regression; y=0.95x + 0.01g/L. We conclude that the C3c assay for 

the Binding Site next generation protein analyser is reliable, accurate and precise and 

shows good agreement with existing assays. 


Immunology 


A-277 

Evaluation of an IgG4 assay for use on the Binding Site Next 


L. D. Southan, R. E. Grieveson, A. Kaur, S. J. Harding, P. J. Showell. The 

Binding Site Ltd, Birmingham, United Kingdom 

High polyclonal IgG4 levels are associated with autoimmune pancreatitis (AIP) and 

other hyper-IgG4-globulinemia’s. Here we evaluate the performance of an IgG4 assay 

for use on the Binding Site’s next generation protein analyser. The instrument is a 

random-access bench top turbidimetric analyser capable of a wide range of on-board 

sample dilutions (up to 1/10,000) and throughput of up to 120 tests per hour. Precision 

is promoted by single-use cuvettes which are automatically loaded and disposed of. 

The instrument automatically dilutes a single calibrator to produce a calibration curve 

with a measuring range of 0.03-3g/L at the standard 1/25 sample dilution, with a 

sensitivity of 0.0024g/L and a maximimum measuring range of 1.5-60g/L at a 1/500 

dilution. Intra-run precision was assessed by measurement of twenty replicates of 

serum samples on a single kit lot using one instrument. The following coefficients 

of variation were produced: 0.073g/L IgG4 (4.64% CV), 1.126g/L IgG4 (2.66% CV) 

and 2.187g/L IgG4 (2.56% CV). Linearity was assessed by assaying a serially-diluted 

patient sample pool and comparing expected versus observed results. The assay was 

linear over the range of 0.03-2.39g/L when analysed by linear regression; y=0.9751x 

+ 4.506 (R 2 =0.995). Correlation to the Binding Site IgG4 assay for the SPA PLUS was 

performed using 42 patient samples (range 0.026-2.39g/L). Acceptable agreement 

was observed when the data was analysed by Passing-Bablok regression; y=0.97x + 

9.11. Antigen excess protection was assessed by measuring 18 analyte concentrations 

ranging 0.038-2.37g/L at the minimum sample dilution (equivalent to 0.96-59.2g/L at 

the standard 1/25 sample dilution). All samples up to 2.37g/L (equivalent to 59.2g/L 

at the standard sample dilution) were correctly flagged. We conclude that the IgG4 

assay for the Binding Site next generation protein analyser is reliable, accurate and 

precise and is protected from antigen excess when challenged with high serum IgG4 

concentrations. 

A-278 

Evaluation of a Transferrin assay for use on the Binding Site Next 


S. Amin, F. Murphy, S. J. Harding, P. J. Showell. The Binding Site Ltd, 


Increased serum concentrations of transferrin are associated with iron deficiency, 

pregnancy and oestrogen administration, whereas decreased serum concentrations 

occur with chronic infection, neoplasia, hepatic and renal disease. Here we describe 

the evaluation of a serum transferrin assay for use on the Binding Site’s next generation 

protein analyser. The instrument is a random-access bench top turbidimetric analyser 

capable of a wide range of on-board sample dilutions (up to 1/10,000) and throughput 

of up to 120 tests per hour. Precision is promoted by single-use cuvettes which are 

automatically loaded and disposed of. The instrument automatically dilutes a single 

calibrator to produce a calibration curve with a measuring range of 0.1333- 5.3330 

g/L at the standard 1/10 sample dilution, with sensitivity of 0.1333 g/L. High samples 

are remeasured at a dilution of 1/40 with an upper measuring range of 0.5332 - 

21.332 g/L. The assay time is 9 minutes and is read at end point. Intra-run precision 

was assessed by measurement of twenty replicates of samples at 4.417g/L (3.18% 

CV), 4.382 g/L (2.37% CV) and 0.223 g/L (1.02% CV). Furthermore, precision 

was assessed at the medical decision points of 3.407g/L (2.29% CV) and 2.108 g/L 

(1.22% CV). Linearity was assessed by assaying a serially-diluted patient sample pool 

across the width of the measuring range (0.078 – 5.745 g/L) and comparing expected 

versus observed results. The assay showed a high degree of linearity when expected 

values were regressed against measured values; y=0.9932x + 0.072, R² = 0.9991. No 

significant interference (within 10%) was observed on addition of bilirubin (200mg/L), 

haemoglobin (5000mg/L) or chyle (1500 formazine turbidity units) when spiked into 

a sample with known transferrin concentrations and measured at the minimum sample 

dilution. Correlation of this assay with the equivalent assay for the Binding Site SPA 

PLUS was performed using normal and clinical serum samples (n=60, range 0.4435 

– 4.4425 g/L). Good agreement was demonstrated by linear regression; y=1.0755x 

+ 0.0648 g/L, R 2 = 0.9898. We conclude that the transferrin assay for the Binding 

Site next generation protein analyser is reliable, accurate and precise and shows good 

agreement with existing assays. 


A83


Endocrinology/Hormones 

A-279 




Comparison of equilibrium dialysis, ultrafiltration and constantvolume 

diafiltration as potential methods for the measurement of free 

thyroxine and triiodothyronine in human serum by isotope dilution 

liquid chromatography tandem mass spectrometry 

A. Ribera, J. C. Botelho, H. W. Vesper. Centers for Disease Control and 

Prevention, Atlanta, GA 

Background: Free triiodothyronine (FT3) and free thyroxine (FT4) levels are 

routinely measured in serum as an important part of the diagnosis and management 

of hypo- and hyperthyroidism. Measurement of FT3 and FT4, is the measurement of 

the hormones which are not bound to thyroxine binding globulin, transthyretin and 

albumin. Although immunoassays for FT3 and FT4 are commonly used in patient 

care and research, these assays show high variability especially in samples collected 

during pregnancy and estrogen therapy use. The use of mass spectrometry (MS) can 

overcome these short comings. The measurement of FT3 and FT4 by MS require that 

the free hormone be isolated. Two of the most common practices used to isolate FT3 

and FT4 from serum are equilibrium dialysis (ED) and ultrafiltration (UF). A third 

method, diafiltration (DF) is designed to overcome lengthy dialysis times and avoid 

possible disruption of equilibrium and conversion of free to bound thyroid hormone. 

The proposed DF method maintains FT3 and FT4 equilibrium by keeping sample 

volume constant during filtration of FT3 and FT4 from the protein bound analytes. 

Methods: The efficiency of each isolation technique has been evaluated using an 

internal standard spiking scheme using a 0.9% saline solution with FT3 and FT4 

added. Prior to analysis by MS, anion exchange solid phase extraction is used and 

chromatographic separation and quantitation is achieved by liquid chromatography 

tandem mass spectrometry. A triple quadrupole mass spectrometer using electrospray 

ionization in the positive mode coupled with HPLC is used for measurement. A 

gradient of water and acetonitrile with 0.1% formic acid is used for chromatographic 

separation on a C18 column. Two transitions were monitored for each analyte and 

internal standard. In addition each approach was evaluated using serum material from 

CAP. Free T3 and T4 are isolated by ED, UF, or DF, and then isotope-labeled internal 

standards (T3- 13 C 6 

and T4- 13 C 12 

) are added to the serum material for quantification. 

Internal standards are not added before FT3 and FT4 isolation to prevent the standards 

from equilibrating with the binding proteins in serum. 

Results: This method showed great stability when analytes were protected from light, 

with minimal conversion of T4 to T3 (100% for DF and 69% for ED. 

Efficiency of FT4 isolation calculated by spiking at 2.0 ng/dL was 85% for UF, 77% 

for DF and 61% for ED. A linear response was obtained within the clinically relevant 

calibration range of 0.1-1.0 ng/dL for FT3 and 0.5-3.0 ng/dL for FT4. Cap K 2011 and 

2012 survey samples with FT3 values of 0.56-1.60 ng/dL and FT4 values of 1.61-4.55 

ng/dL were measured using the 3 separation techniques. 

Conclusion: The accuracy and isolation efficiency of methods using ED, UF and DF 

to isolate FT3 and FT4 was assessed for measurement of these analytes in serum, 

using a sensitive ID-LC-MS/MS method. 

A-280 

Standardization of 25-hydroxyvitamin D assays: impact of 

vitamin-D binding protein concentrations and uremic media on the 

restandarization of six different 25(OH) vitamin D immunoassays. 

E. Cavalier 1 , P. Lukas 1 , Y. Crine 1 , S. Peeters 1 , A. Carlisi 1 , C. Le Goff 1 , J. 

Souberbielle 2 . 1 University Hospital of Liège, University of Liège, Liège, 

Belgium, 2 Hôpital Necker-Enfants malades, Paris, France 

Introduction: Different reports have shown the lack of standardization of 25-hydroxy 

vitamin D assays and have warned the potential clinical consequences of such a 

problem. Recently, the Vitamin D Standardization Program (VDSP), led by the NIH 

in collaboration with the CDC and NIST have issued a series of 40 single patients 

whose 25D had been determined by a commonly accepted reference method. The 

aims of the VDSP are to study the differences and similarities in the distributions 

of 25-hydroxyvitamin D (25D) around the world, standardize 25D measurements in 

national health surveys and allow for the participations of commercial laboratories 

and manufacturers in the standardization effort. In this study, we assimilated the 

standardization process in six immunoassays and assessed their harmonization 

effectiveness in a population of healthy individuals, but also in different patients 

presenting some differences in their serum matrix. 

Materials and Methods: The LCMS ChromSystem (Chrom) kit was calibrated 

against the VDSP Phase 1 samples. Sera from apparent healthy subjects (n=88, 

calibration) were measured with the calibrated LCMS Chrom, Architect, Centaur, 

Elecsys, IDS-iSYS, Liaison XL and DiaSorin RIA. The regression equations of these 

results were used to adjust the immunoasssays. The samples from 1 st trimester (n = 

32) and 3 rd trimester (n = 36) pregnant women, and dialysis (n = 28) samples were 

quantified to determine the harmonization. The samples vitamin-D-binding protein 

(DBP) concentrations were also determined with a R&D ELISA kit. 

Results: Third trimester pregnant women have the highest DBP circulating levels 

among the investigated populations, 511±167, 410±114, 544±280 and 836±290 

μg/mL for the apparently healthy, haemodialysis, 1 st and 3 rd trimester, respectively. 

Prior to the adjustment, the PB regression slope (95%Cl.) between immunoassays 

and calibrated LCMS of the entire samples cohort (n = 184) varied from 0.59 (0.55 

to 0.63) to 0.99 (0.92 to 1.05), with RIA being the lowest and IDS-iSYS being the 

highest. The difference [Mean±SD (ng/mL)] between LCMS and Architect, Centaur, 

Elecsys, IDS-iSYS, XL and RIA was: -2.6±9.3, -4.5±10.8, -1.6±8.8, 4.7±6.7, -6.1±9.6 

and -6.8±8.0, respectively. After adjustment, the regression slope became more 

consistent, ranging from 1.00 (0.94 - 1.07) to 1.05 (0.93 - 1.16). Most notable changes 

were the XL and RIA: 0.70 (before) vs. 1.05 (after), 0.59 (before) vs. 1.03 (after), 

respectively. The mean difference (ng/mL) was also improved: -0.7±10.2 (Architect); 

0.4±11.3 (Centaur); -0.5±9.1 (Elecsys); 0.1±6.8 (IDS-iSYS); -1.2±10.2 (XL) and 

0.3±6.7 (RIA). We also observed that large bias remained, especially in 3 rd trimester 

and haemodialysis samples. The mean concentration bias in 3 rd trimester samples was: 

-7.0±5.0 (Architect); -10.6±7.2 (Centaur); -6.7±5.2 (Elecsys); -3.2±4.5 (IDS-iSYS); 

-11.6±5.2 (XL) and -3.1±4.0 (RIA). The bias was more pronounced in haemodialysis 

samples: -12.5±9.5 (Architect); -4.3±13.0 (Centaur); -9.7±10.8 (Elecsys); -3.3±7.6 

(IDS-iSYS); -11.0±10.0 (XL) and -5.5±7.6 (RIA). 

Conclusions: By calibrating the immunoassays against the same patient samples, 

the harmonization is achieved for the samples from apparent healthy subjects. The 

calibration process appears not to be effective for samples from 3 rd trimester pregnant 

women and haemodialysis patients. The influence of vitamin-D binding protein 

concentrations and uremic media are more visible in some immunoassays than other. 

A-281 

A Highly Sensitive Analysis of Estradiol in Human Plasma by 

MicroLC-MS/MS, with Reduced Solvent Consumption and Increased 

Throughput 

M. Jarvis 1 , A. Wang 2 , B. Patterson 3 . 1 AB SCIEX, Concord, ON, Canada, 

2 

AB SCIEX, Foster City, CA, 3 AB SCIEX, Victoria, Australia 

Background: For Research Use Only. Not for Use in Diagnostic Procedures. 

Micro flow chromatography, with flow rates ranging from 5-60uL/min, and with 

column diameters less than 1mm, is an exciting approach for sensitive, highthroughput 

LC/MS/MS analysis. This technique represents a compelling alternative 

to conventional HPLC due to its solvent-reduction, cost-reduction and time-saving 

potential. Compared to traditional HPLC, solvent consumption savings of up to 95% 

are possible using micro-flow LC, which significantly reduces solvent and waste 

disposal costs. Furthermore, high on-column linear velocities and low mixing and 

delay volumes allow for fast chromatography and higher sample throughput. Microflow 

chromatography also enables the use of significantly smaller sample injection 

volumes, while maintaining equivalent sensitivity compared to traditional HPLC, 

making micro-flow LC an excellent fit for the analysis of estradiol (E2) in clinical 

research samples, which may be limited in size and availability. 

Methods: The Eksigent ekspert microLC 200 system, a dedicated microflow 

UHPLC system, has been used to develop a sensitive micro-LC/MS/MS method for 

the analysis of estradiol in human serum. Chromatographic separation was achieved in 

a run-time of 4 minutes, using a Halo C18 column (0.5x50mm) at a flow rate of 25 uL/ 

min. This represents a significant time savings compared to the equivalent high-flow 

LC-MS/MS analysis, which typically requires a run-time of greater than 7 minutes to 

achieve adequate chromatographic separation of estradiol from potential interferences 




in biological samples. The injection volume was set to 5uL, with an overfill volume of 

2 uL. Mass spectrometric detection was accomplished using the AB SCIEX QTRAP® 

5500 system, operating in the Multiple Reaction Monitoring (MRM) mode. 

Results: Using an injection volume of only 5uL, and at a flow rate of only 25 uL/min, 

the micro-LC/MS/MS method described above has enabled the detection of estradiol 

in human serum at concentrations as low as 1 pg/mL, with a S/N of approximately 

10. A calibration curve was prepared in double charcoal-stripped human serum, over a 

concentration range from 1 to 500 pg/mL. The CV% over the calibration range ranged 

from 2.5% (at 500 pg/mL) to 11.70% (at 1 pg/mL), with accuracies ranging from 

90 - 111% for n=10 replicate injections. The response was linear over the calibration 

range, with R = 0.9994. 

Conclusion: A micro-LC/MS/MS method has been developed for the analysis of 

estradiol in human serum, with equivalent performance to conventional HPLC-MS/ 

MS analysis. The micro-flow method enabled solvent consumption savings of 95% 

compared to high-flow methods, and enabled a reduction of the sample-to-sample 

injection time, from approximately 7 minutes to approximately 4 minutes. 

A-283 

The polymorphism in the let-7 targeted region of the Lin28 gene is 

associated with increased risk of type 2 diabetes 

J. Zhang, L. Zhang, R. Fan, J. Lu. Wenzhou Medical College, Wenzhou, 

China 

Background: Genetic polymorphisms in the miRNAs pathway of the pathogenesis 

of disease might contribute to the risk of disease. Recently, a study reported the let- 

7/ Lin28 pathway plays important role in the pathogenesis of T2DM, and several 

polymorphisms have been identified in the let-7 targeted gene Lin28. However, it 

is unclear whether these polymorphisms are associated with the risk of T2DM and 

whether the gene markers predict the risk of T2DM. 

Methods: We performed a case-control genetic association study based on 588 T2DM 

patients and 588 age and sex matched strictly healthy controls. Restriction fragment 

length polymorphism technique was used in distinguishing genotype. 

Results: For the rs3811463 polymorphism, compared with the wild TT genotype, the 

variant genotype TC+CC could significantly increase the risk of T2DM in the total 

analysis (OR=1.47, 95%CI=1.13-1.93, P=0.005); after subgroup analysis by sex, the 

variant genotypes were associated with increased risk of disease in females but not in 

males. As for the rs3811464 polymorphism, no significantly association was found in 

the total analysis (OR=1.04, 95%CI=0.79-1.36, P=0.78); after subgroup analysis by 

sex, the variant genotypes were not associated with increased risk of disease either 

males or females. In addition, statistically differences were observed in the clinical 

features of age at diagnosis, hypertension and peripheral neuropathy for the variant 

genotypes and wild genotype of the rs3811463 polymorphism. 

Conclusion: Our study indicated that the rs3811463 polymorphism in the let-7/ Lin28 

pathway could significantly increase the risk of T2DM. 

A-284 

Development and Validation of an Improved Chemiluminescent Assay 

for Inhibin B 

M. Attaelmannan 1 , R. Pandian 2 , K. Thomassian 1 , S. Khachatryan 1 , 

A. Kumar 3 . 1 Quest Diagnostics Nichols Institute, Valencia, CA, 2 Pan 

Laboratories, Irvine, CA, 3 Ansh Laboratories, Webster, TX 

Relevance: Inhibins are protein hormones that are secreted by the granulosa cells 

of the ovary and the Sertoli cells of the testes. These hormones selectively suppress 

the secretion of pituitary follicle-stimulating hormone (FSH); they also exert local 

paracrine actions in the gonads. Elevated inhibin B levels have been associated with 

Sertoli cell function (potential marker for spermatogenesis and testicular function), 

ovarian reserve, and granulosa cell tumors. Inhibin B is a 32 kDa dimeric hormone 

composed of two distinct subunits, alpha (α) and beta (β), which are linked by 

disulfide bonds. The free α subunit is usually physiologically inactive; the α-β dimer 

is the biologically active form. 

Objective: To develop and validate a quantitative chemiluminescent assay for serum 

inhibin B that conforms to WHO standards. 

Methodology: We have developed a sandwich-type, enzymatic microplate assay. This 

assay uses a well-characterized monoclonal antibody pair that is specific for inhibin 

B (captures β subunit and detects α subunit of inhibin B). The antibody pair does not 

detect inhibin A, activin A, activin B, AMH, FSH, LH, and TGF-β1, even at twice 

their normal physiological concentrations. The assay calibrators range from 10 pg/ 

mL to 1300 pg/mL. In this three-step procedure, calibrators, controls, and unknown 

samples are added to microplate wells coated with an anti-inhibin B antibodyand 

incubated. Inhibin B in the samples is detected using a biotinylated anti-inhibin B 

antibody, a streptavidin horseradish peroxidase conjugate (SHRP), and a luminogenic 

substrate. The emitted luminesence, measured in relative light output units (RLU) 

using a microplate luminometer, is directly proportional to the concentration of 

inhibin B. 

Validation Results: This Inhibin B assay is traceable to the WHO 96/784 IRP 

Standard and the assay had excellent correlation with a commercially available inhibin 

B assay. Comparison using 71 serum patient samples showed a correlation coefficient 

of >0.99, a slope of 1.13, and an intercept of 4.23 pg/mL. Total imprecision was 2.68% 

at 340 pg/mL and 10.59% at 116 pg/mL. No significant interference was observed 

with hemoglobin, triglycerides, or bilirubin. The LOD was 12 ng/mL AMH were routinely diluted. 

Results: This new assay has a sensitivity of 0.027 ng/mL and a reportable range of 

0.03 to 440 ng/mL. Serum samples with high AMH concentrations dilute in parallel 

with the standard curve. This assay is highly reproducible, with an interassay CV of 

6.4%. The assay is highly specific for human AMH, has no cross-reactivity with other 

members of the TGF-β superfamily, and no interference with lipemic, icteric, and 

hemolysed samples. Correlation with the AMH Gen II immunoassay is excellent at 

low concentrations, ie, 10 ng/mL (y = 0.43x + 5.33; 

R 2 = 0.71). This poor correlation is likely due to the Gen II dilution problem and its lack 

of parallelism for human samples. 

Conclusion: We have developed a highly sensitive and reproducible immunoassay to 

quantify all levels of AMH, including high concentrations. The assay is very specific 

for human AMH since human recombinant AMH was used. Because of its wide range, 

this assay could be used in various pathophysiological conditions. 


A85



A-286 

Role of Progranulin and Tumor Necrosis Factor-alpha in Polycystic 

Ovary Syndrome Pathogenesis 

A. Uzdogan 1 , F. Akbiyik 2 , A. P. Cil 3 , M. Kuru Pekcan 3 . 1 Hacettepe 

University Faculty of Medicine, Department of Medical Biochemistry, 

Ankara, Turkey, 2 Hacettepe University Faculty of Medicine, Department of 

Medical Biochemistry and Clinical Pathology Laboratory, Ankara, Turkey, 

3 

Kirikkale University Faculty of Medicine, Department of Obstetrics and 

Gynecology, Kirikkale, Turkey 

Background: Polycystic ovary syndrome (PCOS) is the most prevelant 

endocrinological disorder (6-10%) of reproductive age women, which is characterized 

by menstrual irregularities, hirsutism, acne, obesity and insulin resistance. Chronic 

inflammation is frequently associated with central obesity, insulin resistance, type 2 

diabetes, dyslipidemia, PCOS and cardiovascular diseases. However the relationship 

between the basic pathogenesis of PCOS and adipokines is not known very well. 

Progranulin (PGRN) and TNF-alpha are very important adipokines which are 

involved in chronic inflammation. Paraoxanase 1 (PON1), an enzyme associated with 

high-density lipoprotein (HDL), has anti-oxidant and anti-inflammatory effects. The 

aim of this study is to analyze serum PGRN and TNF-alpha levels, serum total oxidant 

status (TOS), total anti-oxidant status (TAOS) and PON1 enzyme activities and to 

compare the results of PCOS patients to the healthy control group. 

Methods: A total of 40 patients with PCOS and 40 healthy women between 18- 

40 ages are involved in the study groups. Rotterdam criteria was used to evaluate 

patients. Body mass index (BMI) and homeostasis model of assessment-insulin 

resistance (HOMA-IR) are calculated for all woman in both groups. Serum PGRN 

and TNF-alpha levels were analyzed by enzyme immunoassay method. Serum 

TOS, TAOS levels and PON1 enzyme activities (phenyl acetate as substrate) were 

measured spectrophotometrically. Statistical evaluation was carried out by using t-test 

for independent samples and Pearson correlation analyses tests. The differences were 

considered statistically significant if p



Interference with acetylated, carbamylated or labile hemoglobin was observed at less 

than or equal to 3%. The assay is also designed to have a difference in specificity of 

samples containing abnormal hemoglobin variants C, D, E, F and S within +0.14 

%HbA1c for samples 7.0 %HbA1c. 

Conclusion: These results demonstrate that the new ARCHITECT clinical chemistry 

Hemoglobin A1c assay is a precise and accurate method for measuring HbA1c in 

human whole blood on a high throughput analyzer. The performance supports use of 

this assay as an aid to diagnose and monitor diabetes mellitus. 

A-289 

Serum calcium (s-Ca) requesting inappropriateness to detect Primary 

hyperparathyroidism (pHPT): The forgotten test 

M. Salinas 1 , M. Lopez Garrigos 1 , F. Pomares 1 , J. Lugo 1 , A. Asencio 2 , L. López- 

Penabad 1 , J. R. Dominguez 1 , C. Leiva-Salinas 3 . 1 Hospital Universitario San Juan, 

San Juan, Spain, 2 Primary Care Center of Mutxamel, Mutxamel, Spain, 3 Hospital 

Universitario y Politécnico La Fe, Valencia, Spain 

Background: With the introduction of automated multichannel continuous-flow 

analyzers, pHPT, the silent disease, began to be detected through hypercalcemia 

results. Later, with random access analysers, tests were again requested according to 

patient clinical symptoms; in that scenario s-Ca could become the forgotten test. In 

consensus with endocrinologists and general practitioners (GP), we implemented a 

strategy to “catch” pHPT patients. 

Methods: The laboratory serves a population of 234 551 inhabitants, including 9 

different primary care centers (PCC). From 21/12/2011 to 3/10/2012, the Laboratory 

Information System automatically added s-Ca to every phlebotomized primary care 

patient older than 45, without s-Ca request in the previous three years. If hypercalcemia 

was detected (albumin-corrected s-Ca >2.6 mmol/L), phosphate, 25-hydroxy vitamin 

D and parathyroid hormone (PTH) were automatically processed in the same sample. 

Before establishment, the strategy was communicated to PCCs GPs coordinators. We 

reviewed the medical record for every patient with hypercalcemia. 

Results: Blood samples from 61674 patients were analysed. s-Ca was automatically 

added to 14461 samples, generating 73 hypercalcemia results. 21 corresponded to 

patients taking diuretics, malignancies, etc (Figure). 52 were unexpected: 34 resulted 

in a diagnosis of pHPT and 18 were not followed to find out the hypercalcemia root 

cause, being actually in study. The prevalence in this population of pHPT was 0.24%. 

The cost of adding s-Ca, and extra tests in the 73 patients with hypercalcemia was 

1987 dollars. 

Conclusion: Opportunistic screening to discover pHPT through adding s-Ca to every 

phlebotomized primary care patient above 45 years old, with no previous s-Ca requests 

is clearly cost-effective. s-Ca was not adequately requested to detect asymptomatic 

pHPT. This emphasizes the need to establish strategies to identify pHPT, to avoid 

complications of untreated disease. Pathologists should help physicians to detect 

and respond to clinically important results through strategies that aid to unmask key 

results. 

A-290 

Estimation of biological variation and reference change value of 

glycated hemoglobin (HbA1c) when two analytical methods are used 

F. Ucar 1 , G. Erden 1 , Z. Ginis 1 , G. Ozturk 1 , S. Sezer 2 , M. Gurler 3 , A. Guneyk 1 . 

1 

Diskapi Yildirim Beyazit Training and Research Hospital,Department of 

Clinical Biochemistry, Ankara, Turkey, 2 Numune Training and Research 

Hospital,Department of Clinical Biochemistry, Ankara, Turkey, 3 Ankara 

Branch of the Council of Forensic Medicine, Department of Chemistry, 

Ankara, Turkey 

Background: To date, several studies have dealt with biological variation of HbA 1c 

in 

diabetic or/and in healthy individuals. However, available data on biological variation 

of HbA 1c 

revealed marked heterogeneity. There is still need for robust data. We 

therefore investigated and estimated the components of biological variation for HbA 1c 

in a group of healthy individuals by applying a recommended and strictly designed 

study protocol using two different assay methods. 

Methods: Four EDTA whole blood samples were collected from each individual (20 

women, 9 men; 20-45 years of age) and stored at -80°C until analysis. Each month, 

samples were derived on the same day, for three months. HbA 1c 

values were measured 

by both high performance liquid chromatography (HPLC) (Shimadzu, Prominence, 

JAPAN) and boronate affinity chromatography methods (Trinity Biotech, Premier 

Hb9210, Ireland) on the same day. All samples were assayed in duplicate in a single 

batch for each assay method. Data were analyzed by SPSS 15.0 and estimations were 

calculated according to the formulas described by Fraser and Harris. 

Results: All of the estimations were performed for both assay methods. No significant 

differences for measured parameters were observed between the male and female 

participants except BMI (p



results from 11 of these patients are summarized in the accompanying table. Specific 

antibodies failing to detect TSH in these cases were identified in the four affected 

assays. 

Conclusion: To date, 17 cases have been identified out of approximately two million 

Northern California Kaiser Permanente members. We suspect these individuals 

have a previously unrecognized, functionally normal, TSH variant to which some 

monoclonal antibodies fail to bind. More than half of these individuals were initially 

treated based on repeated falsely undetectable TSH values. Health care providers 

should be aware of the limitations of hyper-selective TSH immunoassays. 

respectively). No significant differences in F, E and FER were observed among men 

18-30, 31-40, and 41-50 yo; significantly lower concentrations of F were observed in 

51-60 yo men, as compared to 41-50 yo men (p=0.045). 

Conclusion: We observed a decline in concentrations of F, E, and FER in men and 

women with advancing age. Higher concentrations of F and E were observed in 18- 

30 yo women than in all other age groups in both genders. Concentrations of F and 

FER declined during the menstrual cycle, with the lowest concentrations observed at 

the end of the luteal phase. These observations suggest that typically used reference 

intervals for F, E and FER associated only with the time of the blood draw, may 

inaccurately describe the physiological variation of F, E and FER. Based on our data, 

age-, gender- and stage of menstrual cycle-associated reference intervals of F, E, FER 

are warranted. 

A-293 

Non-oxidized, biological active parathyroid hormone determines 

mortality in hemodialysis patients 

B. Hocher 1 , F. Armbruster 2 , M. Tepel 3 . 1 Inst. of Nurtitional Science, Potsdan Nuthetal, 

Germany, 2 Immundiagnostik AG, Bensheim, Germany, 3 Inst. of Nurtitional Science, 

Odense University Hospital, Denmark 

A-292 

Age and gender-related variation in concentrations of cortisol, 

cortisone and cortisol/cortisone ratio 

M. M. Kushnir, S. L. La’ulu, R. Greer, J. A. Ray, A. L. Rockwood, M. 

L. Rawlins, A. W. Meikle, J. A. Straseski. ARUP Laboratories, Salt Lake 

City, UT 

Background: Cortisol is commonly measured for diagnosis of neuroendocrine 

disorders associated with function of hypothalamus pituitary adrenal axis. Because of 

strong diurnal variation, reference intervals for cortisol are typically established for the 

morning and afternoon blood draw. Data describing the association of age and gender 

with concentrations of cortisol (F), cortisone (E), and the cortisol/cortisone ratio 

(FER) are limited. We determined concentrations of F, E and FER in serum samples 

from healthy adults (collected between 8 and 10am) and evaluated distributions of 

the observed concentrations for association with age, gender, menopausal status, and 

stage of menstrual cycle. 

Methods: Concentrations of F, E and FER were determined using a liquid 

chromatography - tandem mass spectrometry (LC-MS/MS) method in 76 serum 

samples from self-reported healthy adult volunteers 18-60 years old (yo) (42 men 

and 35 women: 19, 23, 23 and 11 individuals of age groups of 18-30, 31-40, 41-50 

and 51-60, respectively). During the analysis two mass transitions were monitored 

for E, F and the internal standards; ratio of the mass transitions was used to confirm 

specificity of the measurements. Association of the observed values for the continuous 

variables was performed using ANOVA; estimate of the differences among the groups 

was performed with the Wilcoxon test. 

Results: Concentrations of F and E declined by an average 25 and 2.5 nmol/L 

per decade of life (p-values for parameters of linear regression 0.047 and 0.026), 

respectively. FER was lower in men than in women (p=0.017). No statistically 

significant difference in distribution of concentrations was observed between 

premenopausal (PrMW) and postmenopausal (PoMW) women. Higher concentrations 

of F and E were observed in 18-30 yo women, as compared to 41-50 yo women (p= 

0.06 and 0.005). FER was higher in 18-30 yo women than in 18-30 yo men (p=0.009). 

Concentrations of F and FER in PrMW decreased during the menstrual cycle; 

concentrations of F decreased on average by 30 nmol/L per week, and average FER 

decreased by 0.4 per week (p-values for parameters of linear regression 0.05 and 0.08, 

Background: Animal studies showed that non-oxidized PTH (n-oxPTH) is bioactive, 

whereas oxidation of PTH at methionine residues results in loss of biological activity. 

Now, we analyzed the effect of n-oxPTH on mortality in hemodialysis patients. 

Methods: We performed a prospective cohort study in 340 hemodialysis patients. PTH 

was measured by means of a third generation intact-PTH immunoassay system, either 

directly (total intact parathyroid hormone, iPTH) and after prior removal of oxidized 

PTH molecules from the samples using specific monoclonal antibodies raised against 

oxidized human PTH. The association between n-oxPTH concentrations and survival 

was assessed by Kaplan-Meier analysis. 

Results: Hemodialysis patients (224 men/116 women) had a median age of 66 years. 

170 patients (50%) died during the follow up time of 5 years. Median n-ox-PTH levels 

were higher in survivors (7.2 ng/L) compared 

to deceased patients (5.0 ng/L; p=0.002). Survival analysis showed an increased 

survival in the highest n-ox-PTH tertile compared to the lowest n-oxPTH tertile (Chi 

square 14.3; p=0.0008). Median survival was 1702 days in the highest n-ox-PTH 

tertile, whereas it was only 453 days in the lowest n-oxPTH tertile. Multivariableadjusted 

Cox regression showed that higher age increased odds for death, whereas 

higher n-oxPTH reduced the odds for death. Another model analyzing a subgroup of 

patients with iPTH concentrations at baseline above the upper normal limut of the 

iPTH assay (70 ng/L) revealed that mortality in this subgroup was associated with 

PTH oxidation but not with n-oxPTH levels. 

Conclusion: In conclusion, the predictive power of n-oxPTH and iPTH on mortality 

of patients on dialysis differs substantially indicating that the underlying biological 

processes might be different. The iPTH associated mortality especially when iPHH 

levels are high reflects mainly protein oxidation/oxidative stress. 

A-294 

Comparison of three commercially available immunoassays for 

measurement of 25-hydroxyvitamin D with an LC-MS/MS method 

capable of resolving 3-epi-25-hydroxyvitamin D3 

B. Niravel, G. Maine, E. Sykes, K. Leonard, S. Barden, B. Bailey, M. P. 

Smith. Beaumont Health System, Royal Oak, MI 

Background: Two commonly used methods for 25-hydroxyvitamin D (25- 

OHD) measurement are automated immunoassays for total 25-OHD, and liquid 

chromatography-tandem mass spectrometry (LC-MS/MS) capable of separating and 

measuring 25-hydroxyvitamin D 3 

(25-OHD 3 

) and 25-hydroxyvitamin D 2 

(25-OHD 2 

). 

The presence of 3-epi-25-OHD 3 

is not often differentiated on LC-MS/MS due to 

co-elution and a shared mass-transition with 25-OHD 3 

. However, by manipulating 

elution time and employing a fluoro-phenyl column, we were able to efficiently elute 

and measure 3-epi-25-OHD 3 

as a distinct peak (LOQ = 4.0 ng/mL). Compared to 

25-OHD 3, 

the active metabolite of 3-epi-25-OHD 3 

may have a reduced effect on 

calcium regulation while still suppressing PTH secretion. The purpose of this study 

was to compare our laboratory-developed LC-MS/MS method to three commercially 

available immunoassays measuring total 25-OHD (Abbott ARCHITECT, Diasorin 

Liaison, Siemens Centaur), and to determine the prevalence of 3-epi-25-OHD 3 

in this 

study cohort. 




Methods: Serum aliquots (n = 169) were frozen and tested in batches of 30 on each 

instrument. Each batch was assigned to an eight hour window for testing on 6 separate 

days. EP evaluator software was used for analysis. 

Results: See table 

Conclusions: 

1. Results from the Abbott ARCHITECT were not statistically different from LC-MS/ 

MS. However comparison of results from the Diasorin Liaison and Siemens Centaur 

with LC-MS/MS were statistically different. 

2. The Diasorin Liaison demonstrated the best correlation with LC-MS/MS in 25- 

OHD deficient samples (80 ng/mL). 

Table: Immunoassay Comparison to LC-MS/MS 

Instrument Sample Cohort n* Slope Intercept SEM r p-value 

Abbott ARCHITECT All 144 0.962 1.74 7.26 0.947 0.388 

Diasorin Liaison All 166 0.731 2.56 6.31 0.970



The most performing model, based on ethnicity, body-mass index, familial history 

of diabetes and past history of GDM, resulted in sensitivity, specificity, positive and 

negative likelihood ratio and AUROC of 73%, 81%, 3.8, 0.3 and 0.82 respectively for 

the identification of women with GDM requiring insulin therapy. 

Conclusion: External validation in a large cohort of Caucasian women of four riskprediction 

models based on clinical characteristics yielded a moderate performance, 

but the strategy seems particularly promising for the early prediction of GDM 

requiring insulin therapy. Addition of selected biochemical markers to such model has 

the potential to reach a performance justifying clinical implementation. 

$$MISSING OR BAD TABLE SPECIFICATION {9B5AF915-94D4-445F-8E12- 

EECAC406DAF6}$$ 

Table 1: Performance of the clinical risk-prediction models to identify women who developed 

GDM 

n n 

AUROC 

Model Risk Factors 

Se Sp LR+ LR- 

Naylor et al. 

(1997) 

Caliskan et al. 

(2004) 

Van Leeuwen 

et al. (2010) 

Teede et al. 

(2011) 

GDM Total 

Maternal age, BMI, Ethnicity 324 6,160 72.2 55.1 1.6 0.5 

Maternal age, BMI, Fam. 

History of diabetes, Prev. 

macrosomic infant, Prev. adv. 

obst. outcome 

BMI, Ethnicity, Fam. history 

of diabetes, Prev. GDM 

Maternal age, BMI, Ethnicity, 

Fam. history of diabetes, 

Prev. GDM 

311 5,639 71.1 59.3 1.7 0.5 

280 5,302 60.4 80.7 3.1 0.5 

247 4,408 65.6 75.0 2.6 0.5 

(95% CI) 

0.67 

(0.64- 

0.70) 

0.68 

(0.65- 

0.71) 

0.76 

(0.73- 

0.79) 

0.74 

(0.70- 

0.78) 

BMI: body-mass index; GDM: Gestational diabetes; Se: sensitivity; Sp: specificity; LR+: positive 

likelihood ratio; LR-: negative likelihood ratio; CI:confidence interval; Performance at the 

threshold optimizing Youden index 

A-298 

Establishment of Reference Intervals for Prolactin after Precipitation 

with Polyethyleneglycol and Detection of Macroprolactin 

D. T. Meier, M. A. V. Willrich, D. R. Block, N. A. Baumann. Mayo Clinic, 

Rochester, MN 

Background: Approximately 15% of hyperprolactinemic patients have 30-60% 

macroprolactin, a complex of prolactin and immunoglobulin. Macroprolactinemia 

is a benign condition and should be suspected when hyperprolactinemia is 

asymptomatic or pituitary imaging studies are not informative. Polyethyleneglycol 

(PEG) precipitation is a widely used method to detect macroprolactinemia. However, 

controversy exists about how to report and interpret PEG-precipitation results. The 

objectives of this study were to: i) compare PEG-precipitation to gold standard gel 

filtration chromatography (GFC) for detecting macroprolactin in serum; ii) establish 

reference interval (RI) for post-PEG-precipitation prolactin (post-PEG PRL) and 

%PEG-precipitated prolactin (%PEG-ppt PRL) in normoprolactinemic subjects; 

iii) validate the established RIs using samples from patients with clinically-defined 

hyperprolactinemia; and iv) compare the use of post-PEG PRL RIs with a % PEG-ppt 

PRL cut-off for detecting macroprolactinemia. 

Methods: Prolactin was measured using the Roche Prolactin II assay on a Cobas 

8000e immunoassay analyzer (Roche Diagnostics). Precision (intra-assay, n=10; 

inter-assay, n=13days), measurable range and analyte stability were determined 

for the PEG-precipitation method. Method comparison between GFC and PEGprecipitation 

was performed (n=15). Residual serum samples from female (F, 

n=217) and male (M, n=138) patients having prolactin concentrations within 

gender-stratified reference intervals (M, 2.0-15.3ng/mL, F, 3.0-23.3ng/mL) were 

PEG-precipitated and prolactin (post-PEG PRL) in the supernatant was measured. 

Reference intervals and 90% confidence intervals (CI) were established using EP 

Evaluator (nonparametric analysis). A hyperprolactinemia (prolactin greater than 

reference interval) cohort included patients with physician-ordered prolactin (F n=26, 

M n=97) or macroprolactin (F n=191, M n=41). Residual serum samples were PEGprecipitated 

and post-PEG PRL was measured. Medical records were reviewed for 

49 hyperprolactinemic patients and divided into symptomatic with known etiology 

(n=34) or asymptomatic with unknown etiology (n=15). 

Results: Intra- and inter-assay imprecision were 3% and 7%, respectively. The 

measurable range was 1-400ng/mL (slope=1.00, y-intercept =1.78, r2=1.00) and 

prolactin recovery for x400 dilutions was 91-96%. Samples were stable (



Africa, including the metabolic and cardiovascular complications. Leptin has been 

inadequately explored as a risk factor for cardiovascular events here. Therefore, the 

aim of this study is to determine the association between leptin and insulin resistance, 

an established CVD risk factor, in obese adult Nigerian females. 

Method: This was a cross-sectional study of obese, adult Nigerian female outpatients 

at the Lagos University Teaching Hospital, Nigeria. Participants were examined for 

body mass index (BMI) at their clinic visit. Those with BMI >30kg/m2, not diabetic, 

pregnant nor lactating, were voluntarily recruited as subjects and instructed to return 

in a fasting state on an agreed date when serum leptin, fasting plasma glucose, and 

insulin were determined. Insulin resistance (IR) was calculated with HOMA method 

using the formula: HOMA-IR = (glucose x insulin)/22.5 for glucose in mmol/l. 

Pearson correlation coefficient was used to determine the association between leptin 

and HOMA-IR. A p 0.99). Using this model, eAG vs. %A 1c 

was calculated for 

RCLs of 90 days and 75 days, by proportionally changing only the time scale of the 

red cell age distribution. 

Results: In comparison to eAG vs. %A 1c 

for RCL = 120 days, eAG predicted for a 

given %A 1c 

was significantly increased when RCL was reduced to 90 or 75 days (open 

points, Figure). 

Conclusions: Results of model calculations may help inform clinicians about the 

scale on which substantial deviations from the established relationship between eAG 

and %A 1c 

may be operative for patients suspected of having reduced RCL. 

A-301 

Fasting Serum Soluble CD 163 Predicts Risk for Type 2 Diabetes in 

Individuals with the Metabolic Syndrome in Rivers State 

C. G. Orluwene 1 , I. N. Nnatuanya 2 . 1 University of Port Harcourt Teaching 

Hospital, Port Harcourt, Nigeria, 2 Madonna University Teaching Hospital, 

Elele Campus, Elele Town, Rivers State, Nigeria 

Background: Activation of adipose tissue macrophages with concomitant low-grade 

inflammation is believed to play a central role in the evolution of type 2 diabetes. 

Aim: To assess whether a new macrophage-derived biomarker, soluble CD163, 

identifies at-risk individuals with metabolic syndrome before overt disease develops. 

Methods: A prospective study of 72 subjects with metabolic syndrome and without 

overt type 2 diabetes was done from 2006-2011 for incidence of type 2 diabetes. Risk 

of diabetes was categorized according to age, gender and level of soluble CD163. 

Statistical analysis system (SAS) 9.2 for windows was used to analyze data. 

Results: A total of 9 (30%) of the subjects in the age bracket of 20-40 years and 16 

(38.1%) of the subjects in the age bracket of 41-60 years and who had high fasting 

serum soluble CD163 levels (> 1.5mg/L) developed diabetes in 5 years of follow-up. 

More females [7 (23.3%)] as against 2 (6.7%) male in the 20-40 year age bracket 

and 11 (26.2%) female as against 5 (11.9%) males in the 41-60 years age bracket 

progressed to overt type 2 diabetes within the 5 years period. 

Conclusion: Increased concentrations of soluble CD163 in individuals with metabolic 

syndrome predict increased risk of type 2 diabetes and may be a useful marker for 

identification of high risk metabolic syndrome individuals. 

Keywords: Soluble CD 163, Type 2 diabetes mellitus, Metabolic syndrome 

A-302 

Mathematical model for hemoglobin A1c formation predicts estimated 

average glucose for reduced red cell lifetimes 

R. J. Molinaro 1 , L. J. McCloskey 2 , J. D. Landmark 3 , J. H. Herman 2 , D. F. 

Stickle 2 . 1 Emory University School of Medicine, Atlanta, GA, 2 Jefferson 

University Hospitals, Philadelphia, PA, 3 University of Nebraska Medical 

Center, Omaha, NE, 

Background: The established relationship of estimated average glucose (eAG) to 

hemoglobin A 1c 

(Hb A 1c 

) may not be applicable to patients with reduced red cell 

lifetimes (RCL) attributed to certain hemoglobin variants. We used a mathematical 

A-303 

Average glucose operative during short intervals between hemoglobin 

A1c measurements: predicted relationship to estimated average 

glucose 

R. J. Molinaro 1 , L. J. McCloskey 2 , D. F. Stickle 2 . 1 Emory University School 

of Medicine, Atlanta, GA, 2 Jefferson University Hospitals, Philadelphia, PA 

Background: Estimated average glucose (eAG) is a linear function of %A1c. 

The inverse slope, Smax = Δ(%A1c)/Δ(eAG), is a constant that corresponds to the 

maximum Δ(%A1c) that can occur for a change in glucose (ΔG) (Smax = 0.035 

(%A1c)/(mg/dL)). When the interval between sequential %A1c measurements is not 

long enough to span the entire red cell lifetime (120 days), the apparent Δ(eAG) as 

calculated from Δ(%A1c)/ Smax must underestimate that true ΔG operative during the 

interval, because the entire circulating red cell population has not yet been uniformly 

exposed to this change. Our objective was to predict the relationship between Δ(eAG) 

and ΔG for short measurement intervals (



Results: For each interval Δt, the calculated slope S = Δ(%A 1c 

)/ΔG was found to be 

a constant value, S(Δt). Across intervals, S(Δt) approached S max 

as Δt approached 120 

days. The predicted relationship between Δ(eAG) and ΔG as a function of Δt was 

given by the ratio R = S(Δt)/S max 

= Δ(eAG)/ΔG (see Figure). 

Conclusions: For %A 1c 

measurement intervals Δt



FT3) than current immunoassays. Here we present a patient with confounding thyroid 

hormone immunoassay findings where LC-MS/MS thyroid hormone measurement 

permitted elucidation of the patient’s condition. 

Case report: A seventy-year-old Caucasian female presented with a history of 

receiving thyroid hormone replacement therapy for several decades. Her current 

complaints were increased lethargy and weight gain of ±10 pounds over the past 

year despite increase in levothyroxine(LT4) replacement dosage to 150 μg daily. On 

physical examination no thyromegaly or thyroid nodules were palpable. 

Laboratory testing: Immunoassay results for thyroid functions tests analyzed on the 

Dimension Vista (Siemens Diagnostics, Tarrytown, US) were as follows: TSH 0.6 

mIU/L (0.4-4.0), FT4 1.2 ng/dL (0.8-1.5), FT3 247pg/mL (180-420) and TT4 10.3 

μg/dL(4.5-12.5). Total T3 analyzed on the Immulite XPi (Siemens Diagnostics, 

Tarrytown, US) was 107 ng/dL (90-215). Testing for thyroid peroxidase antibodies 

and thyroglobulin antibodies were negative. Blood samples were later analyzed by 

LC-MS/MS as per methods previously published (Clin Chim Acta. 2004;343(1- 

2):185-90,Clin Chem. 2011 ;57(1):122-7 and Clin Chem 2011;57:A82 Abstract 

B-99.) MS/MS Results were as follows: TT3 64 ng/dL (74-168), FT3 1.9 pg/mL (1.5- 

6.3), TT4 7.2 μg/dL(4.2-10.9), FT4 1.8 ng/dL (1.3-2.4). In view of the low total T3 

and low normal FT3 on mass spectrometry analysis, the patient was initiated on a 

trial of combination of LT4 75μg daily and levotriiodothyronine18.75 μg (three times 

daily). On follow-up: TSH level was 0.01 mIU/mL (0.4- 4.0) and a decrease in total 

cholesterol (from 202 mg/dL to 160 mg/dL) and LDL cholesterol (from 133 mg/dL 

to 89 mg/dL) were also noted due to thyroid hormone replacement. With cessation of 

replacement therapy TSH levels increased to 0.03 mIU/L and MS/MS TT3 and TT4 

remained low at 34 ng/dL ng/dL (74-168), and 1.1 μg/dL(4.2-10.9 respectively, with 

the patient’s complaints of fatigue persisting. To exclude possible secondary/tertiary 

hypothyroidism an MRI Brain was performed. Findings showed no intracranial 

mass or pituitary lesion. Genetic studies for type 2 deiodinase (D2) polymorphisms 

revealed that the patient was heterozygous for the Thr92Ala polymorphism. 

Discussion: D2 catalyses the intracellular conversion of T4 to T3, and thus plays 

a major role in thyroid hormone metabolism. The presence of the D2 Thr92Ala 

polymorphism has been shown to predict the need for higher T4 intake or addition of 

T3 in those requiring replacement therapy. The finding of the low mass spectrometry 

TT3 and low normal FT3 levels together with the persistent hypothyroid symptoms 

despite seemingly adequate (as reflected by immunoassay results) thyroid hormone 

replacement alerted to the possibility of a deiodinase disorder. 

A-308 

Prevalence of subclassifications of subclinical hypothyroidism: 

comparison to reclassifications when using FT4-dependent reference 

ranges for TSH 

H. L. Matlin, L. J. McCloskey, D. F. Stickle. Jefferson University Hospitals, 

Philadelphia, PA 

Background: Subclinical hypothyroidism (SH: normal free T4 (FT4), elevated 

TSH) is the subject of frequent inquiries to the laboratory. New practice guidelines 

for hypothyroidism from the American Association of Clinical Endocrinologists 

and the American Thyroid Association (Endocr Pract 2012;18:988-1028) define 

subclassifications of SH with respect to whether TSH is less than or greater than 10 

mIU/L (here defined as subclassifications A and B, respectively), delineating whether 

recommendation for T4 replacement therapy is automatic (for subclass B). Our 

objectives were to determine %A and %B in our patient population, and, because 

of the log-linear relationship between TSH and FT4, to examine how prevalence of 

subclasses might change if FT4-dependent TSH reference ranges were used. 

Methods: Paired TSH and FT4 results from our institution over a period of 1 year 

(2012) were obtained from electronic records. A subset database was formed from 

first-or-only results from individual patients having normal FT4 (0.7-1.7 ng/dL) (n = 

4781). Spreadsheet analyses determined classification as subclinical hypothyroidism 

(SH), from which %A (TSH 10 mIU/L) were 

determined. TSH distributions were analyzed as a function of FT4 as a preliminary 

step in specifying FT4-dependent TSH reference ranges. 

Results: Among paired TSH and FT4 results, 616 patients (12.9% of total) were 

classified as SH, using TSH reference range = 0.3-5.0 mIU/L. Subclassifications of SH 

patients were 75.6% A and 24.4% B. TSH distributions were analyzed as a function 

of FT4. Each distribution was well-characterized as a log-normal distribution (that is, 

on a log scale, the distributions were individually well characterized by parameters 

of a median (xm) and a standard deviation (s) such that probabilities of results were 

a normal distribution according to xm ± s). xm was a linear function of FT4: for FT4 

= 0.6-1.6 ng/dL, xm = -0.478 FT4+ 0.850 (r 2 = 0.929) (Eqn.1). Standard deviations s 

for TSH were a parabolic function of FT4 (range: s = 0.35-0.9), with a minimum s = 

0.35 centered at FT4 = 1.1 ng/dL. This minimum s was only marginally greater than s 

associated with the TSH reference range (s = 0.31). The fact that all-patient-inclusive 

TSH data showed log-normal distributions indicated that any assumed FT4-dependent 

TSH reference ranges should likewise possess these same FT4-dependent medians. 

We therefore assumed, very conservatively, FT4-dependent reference ranges having 

medians according to Eqn.1, and having fixed widths equal to that of the standard TSH 

reference range (±2s = ±0.62). Applying these FT4-dependent TSH reference ranges 

to the paired TSH-FT4 patient data, 245 patients (5.1% of total) were classified as SH, 

with subclassifications of 43.3% A, 56.7%B. 

Conclusions: Comparing to use of a standard, FT4-independent TSH reference 

range, paired TSH-FT4 measurements classified as SH were reduced by 60% when 

conservative FT4-dependent TSH reference ranges were applied. Additionally, 

FT4-dependent TSH reference ranges were also more highly selective for SH 

subclassification B patients, for whom T4 replacement therapy would be automatically 

recommended. 

A-309 

Sex Hormone Binding Globulin As A Marker Of Categories Of Glucose 

Intolerance And Undiagnosed Diabetes In First Degree Relatives 

(FDR) Of Type 2 Diabetic Patients. 

O. A. Mojiminiyi, N. A. Abdella. Faculty of Medicine, Kuwait University, 

Kuwait, Kuwait 

Background: Recent evidence showed that raised sex hormone binding globulin 

(SHBG) levels could reduce the risk of Type 2 diabetes but the exact mechanisms 

remain unknown. This study explores the associations of SHBG with categories of 

glucose intolerance and undiagnosed diabetes in first degree relatives (FDR) of T2DM 

patients and explores the associations with potential risk factors. 

Methods: Anthropometric indices (BMI, waist (WC), Hip circumference and waist:hip 

ratio (WHR)), fasting lipids, glucose, C-peptide, insulin, adiponectin, SHBG, oestradiol 

(E2), testosterone (T), androstenedione (AND), dehydroepiandrosterone sulphate 

(DHEA-S), high-sensitivity C-reactive protein (hsCRP) and alanine aminotransferase 

(ALT - marker of hepatic steatosis) were measured in 141 (61M, 80F) FDR aged 20- 

48 years. Homeostasis model assessment-estimated insulin resistance (HOMA-IR), 

beta cell function (%B), insulin sensitivity (%S) and Free androgen index (FAI) were 

calculated. Categories of glucose intolerance and diagnosis of diabetes were defined 

based on fasting glucose and/or HbA1c (ADA criteria). 

Results: 82 subjects were normoglycemic; 40 had impaired fasting glucose and 

19 had undiagnosed diabetes. SHBG showed significant positive correlations with 

adiponectin (r=0.35), %S (0.33) and HDL-C (r = 0.45) and significant negative 

correlations with BMI (r=-0.39), WC (r = -0.35), WHR (r = -0.62), T (r = - 0.35), 

FAI (r = -0.72), DHEAS (r= -0.26), C-Peptide (r = -0.30), insulin (r = -0.37), %B 

(r=-0.38), HOMA-IR (-0.39), ALT (r=-0.39), Triglycerides (r = - 0.32) and HbA1c 

(r=-0.22). After partial correlation analysis correcting for BMI, only correlations with 

WHR (r= -0.53), FAI (r= - 0.41) and HDL-C (r = 0.37) remained significant. SHBG 

decreased stepwise with worsening categories of glucose intolerance in females but 

not in males whereas FAI decreased stepwise with worsening categories in males only. 

The area under the Receiver Operating Characteristic Curve for detection of diabetes 

for FAI and SHBG were 0.711 and 0.386 respectively for males and 0.430 and 0.660 

respectively for females 

Conclusion: Associations of SHBG with some anthropometric and metabolic 

variables in FDR suggests that lower levels may contribute to the risk of T2DM 

through obesity dependent metabolic pathways but low FAI is a better marker of 

diabetic state in males. The obesity independent associations of SHBG with HDL-C 

and WHR deserve further studies. 

A-310 

Magnesium Regulates Reticular NADPH production in the 

Hepatocytes; Possible implications of Magnesium in Diabetes and 

Obesity onset 

c. B. voma 1 , A. P. Romani 2 . 1 Cleveland State University, Brooklyn, OH, 

2 

Case Western Reserve University, Cleveland, OH 

Background: The current western diet is approximately 35% deficient in magnesium 

(Mg 2+ ). Magnesium deficiency has been correlated with the onset and progression of 

several pathologic conditions that include diabetes and obesity. As opposed to other 

electrolytes, Mg 2+ is not given the same clinical attention due to the poor understanding 


A93



of its homeostasis. The hormonal regulation of magnesium has not been fully 

elucidated, and we continue to interpret the serum concentrations relative to urinary 

Mg 2+ excretion. Also, our understanding of the extra- and intra-cellular role of Mg 2+ 

is further complicated by the fact that the principal reservoir of Mg 2+ (i.e., the bones) 

are not readily exchangeable with circulating Mg 2+ in the extracellular fluid space. 

Thus, in states of a negative Mg 2+ balance, initial losses come from the extracellular 

space since equilibrium with bone stores does not begin for several weeks. The long 

term goal of this research is to elucidate the implications of magnesium deficiency for 

liver and whole body metabolism. Our laboratory has previously reported that Mg 2+ 

deficiency increases G6P transport into the liver ER, and its hydrolysis by G6Pase. 

The study reported here evaluates the role of Mg 2+ deficiency on G6P conversion 

by Glucose-6-Phosphate Dehydrogenase (G6PD), the other intrareticular metabolic 

pathway for G6P, and its connection with 11Beta-Hydroxysteroid Dehydrogenase 

1 (11β-HSD1), the NADPH-dependent enzyme responsible for the conversion of 

cortisone to cortisol. Both enzymes have been implicated in onset/progression of 

diabetes and obesity. The results reported here validate our working hypothesis that a 

deficiency in hepatic Mg 2+ content enhances the activities of both G6PD and 11Beta- 

HSD1within the lumen of the hepatic endoplasmic reticulum. 

Methods: Minimal deviation hepatocellular carcinoma cell line (HepG2-C34) were 

grown in media containing 0.2mM, 0.4mM (deficient) and 0.8mM (physiological) 

[Mg 2+ ]o acutely (i.e., 5 days) and analyzed for NADPH production by fluorescence 

detection (350 nm excitation; 460 nm emission). NADPH production was induced by 

addition of varying concentrations of glucose 6-phosphate to digitonin-permeabilized 

cells. G6PD, G6Pase, and 11Beta-HSD1 expression levels were analyzed by western 

blot method for up- or down-regulation following Mg 2+ deficiency onset. Production 

of cortisol from cortisone as a measure of the activity of 11Beta-HSD1 was analyzed 

by reversed phase HPLC. 

Results: NADPH production increased by ~60% under conditions of Mg 2+ deficiency 

compared to cells presenting physiological levels of Mg 2+ , and resulted in a marked 

increase in cortisol production through 11Beta-HSD1 activity. 

Conclusion: Deficiency in Mg 2+ appears to upregulate the utilization of G6P by G6PD 

for energetic purposes, with increased synthesis of NADPH. In turn, the increased 

level of intrareticular NADPH will favor the conversion of cortisone to cortisol. 

Increased cortisol production can explain – at least in part- the insulin resistance 

observed in several diabetic and/or obese conditions. Validation of these results in 

human patients represents the next step in our study. 

A-311 

Evaluation of Hemoglobin A1c Assay on Mindray’s BS-800 Clinical 

Chemistry System* 

Y. Wang, J. Cai, W. Luo. Shenzhen Mindray Bio-medical Electronics CO., 

LTD., Shenzhen, China 

Objective: The objective of this study was to evaluate the performance of a HbA1c 

assay on Mindray’s BS-800 clinical chemistry system. 

Relevance: Hemoglobin A1c (HbA1c) is used to monitor long term glucose control 

in patients with diabetes mellitus. 

Methodology: Human whole blood samples were pre-treated off-line with 

hemolyzing reagent prior to analysis. HbA1c concentration, relative to that of 

total hemoglobin, was determined by enzymatic assay of HbA1c and colorimetric 

measurement of total hemoglobin. The assay successfully completed the National 

Glycohemoglobin Standardization Program (NGSP) manufacturer certification, and 

results can be converted to IFCC units. 

Results: The HbA1c assay demonstrated acceptable observed within-run and total 

imprecision of



abdominal magnetic resonance imaging (MRI) was performed to further characterize 

the mass, revealing a small ileus mass (3 x 2cm) probably a carcinoid tumor with 

infiltrated mesenteric fat and desmoplastic-like appearance, and a small adenopathy 

nearby. Two hepathic lesions are also showed, they are suggestive of metastasis. The 

determination of 5-hydroxyindoleacetic acid (5HIAA) and serotonin in 24-hour urine 

sample and plasma chromogranin A were solicited. Data are 5HIAA= 94.5 nmol/ 

mgCr (0-34), serotonin= 0.56 nmol/mgCr (0-0.80) and chromogranin A= 66 ng/mL 

(19.4-98.1). Surgical resection was performed. 

Conclusion:To our knowledge, this observation describes the case of skin 

manifestations associated with carcinoid tumor of the small bowel. The detection 

of this tumor at an early stage, revealed by figurative erythema, which was possible 

because of the availability of markers. 

A-314 

Comparison of Three Automated Hb A1c Assays 

F. Gerin, O. Baykan, M. Arpa, O. Sirikci, G. Haklar. Marmara University 

School of Medicine Department of Biochemistry, Istanbul, Turkey 

Background: Hemoglobin A 1c 

(Hb A 1c 

) is used for monitoring glycemic control 

and response to therapy in diabetic patients. The American Diabetes Association 

(ADA) recommended its use in diagnosis of diabetes. We evaluated the analytical 

performances of 3 automated assays; Recipe and Zivak HPLC, and Roche 

immunoassay. We paid special attention to the interference of uremia, different 

hemoglobin concentrations, carbamylated hemoglobin (cHb), acetylated hemoglobin 

(AcHb), and fetal hemoglobin (Hb F). 

Methods: A total of 199 EDTA anticoagulated venous samples from 62 healthy 

individuals, 90 diabetic patients, chronic hemodialysis patients (n=8) and samples with 

low (Hb15 g/dL, n=10) hemoglobin concentration, or 

high Hb F (n=19) were analyzed within 2 hours. The interference of cHb and AcHb 

was checked by incubating pooled blood samples (Hb A 1c 

, 5.0%) with sodium cyanide 

(≤2 mmol/L) or acetaldehyde solutions (2–10 mol/L), respectively. 

All Hb A 1c 

analyses were performed at the Marmara University Pendik Hospital 

Biochemistry Laboratory with two ion-exchange HPLC methods; the Recipe HPLC 

(Recipe Chemicals–Instruments, Germany) and the Zivak HPLC automated system 

(Zivak Technologies, Turkey), and the Roche immunoassay reagent on Roche 

Modular autoanalyzer. Precision, bias and correlation studies were performed 

according to ‘Approved Guideline’ (EP09-A2). NGSP approved control materials 

were used. Statistical analysis were performed using the SPSS 15.0 software and 

MedCalc 11.6.0.0. The differences between methods and significance of pairwise 

differences were conducted with Friedman and Wilcoxon sign test, respectively. 

Bland-Altman and relative differences plots were used for comparison. Passing- 

Bablok regression analysis and correlation coefficents were calculated. p



IMMULITE 2000; Ortho VITROS ECi) and an in-house LC-MS/MS method. 

Additionally, cortisone was measured by LC-MS/MS in both populations. 

Results: Agreement was observed for most of the six automated immunoassays when 

compared with LC-MS/MS using samples from healthy subjects and SRM material. 

Substantial positive biases were observed using samples from ICU subjects (Table). 

Statistically significant differences were observed between regression slopes of 

ICU and healthy subjects for all immunoassays (p



Conclusion: An automated assay of aldosterone could be very attractive for 

laboratorians. Even if its results are not very comparable to those yielded by the 

previously used RIAs, these assays are known to be plagued by lower consistency. 

StatisProTM allows an easy and fast comparison of methods via paired results from 

patients and can be employed for providing the necessary information to clinicians 

and carries out the required calculations and graphs. 

A-319 

Plasma Aldosterone measured using DiaSorin ALDOCTK-2 

and DiaSorin LIAISON® XL; a comparison using the software 

StatisProTM (CLSI-Analyse-it) 

R. M. Dorizzi, V. Zanardi, S. Vallicelli, A. Piscopo, S. Bellini, C. Gollini. 

Laboratorio Unico di AVR, Cesena, Italy 

Background: CLSI standards are used all around the world in clinical practice 

by many laboratorians but very often they require complex calculations not easily 

performed by standard commercial softwares. CLSI developed in conjunction with 

Analyse-it a Software (StatisProTM) which friendly carries out all the calculations 

required by relevant CLSI standards: EP10-A3, EP09-A2-IR, EP15-A2, EP05-A2, 

EP06-A, EP17-A, C28-A3 that we are using quite frequently in daily activity. The 

aim of our study was to compare the results yielded by ALDOCTK-2 (CTK2) and 

DiaSorin LIAISON® XL (XL) in the measurement of plasma aldosterone using 

EP9A2-IR CLSI standard and StatisProTM (CLSI and Analyse-it, Wayne, PA, USA). 

Methods: We measured aldosterone using respectively CTK2 and XL (DiaSorin, 

Saluggia, Italy) in 44 plasma samples collected in patients suffering from hypertension. 

The measurements were simultaneously carried out in duplicate strictly following the 

EP9A2-IR CLSI standard and the calculations and the graphs were carried out using 

StatisProTM. 

Results: We found a moderate correlation (r : 0.900), an intercept= 28.617 and a 

slope =0-593 (Passing Bablok regression); Sy.x was 58.2. The difference plot shows 

a fair consistency under 131.9 ng/L (mean bias: 6.17 ng/L), higher RIA concentration 

between 131.95 and 243 ng/L (mean bias: 54.15 ng/L), and much higher RIA 

concentration at values higher than 243 ng/L values (mean bias: 165.64 ng/L). The 

repeatability plots demonstrate excellent repeatability of LIAISON®XL (Figure, 

bottom) compared to RIA (Figure, top). 

A-320 

Analytical Performance Of The Premier Hb9210 For HbA1c 

Measurement 

J. Arias-Stella, J. Zajechowski, L. Stezar, M. Cosman, D. Swiderski, C. 

Feldkamp, V. I. Luzzi. Henry Ford Hospital, Detroit, MI 

Background: Glycated hemoglobin (A1c%) is used in the diagnosis and management 

of diabetes and directly correlates with the mean blood glucose concentration 8 to 

12 weeks prior. We use the BioRad Variant II system and perform approximately 

800 tests per day. The average turn-around-time (TAT) for results is approximately 

20 hours. The goal of this study was to decrease the TAT, increase the accuracy in 

the presence of Hb variants and decrease the cost of the test. We investigated the 

analytical performance of the Trinity Hb9210 boronate affinity chromatography 

method to measure glycated Hb. The Trinity instrument is reported to be unaffected 

by most variants and also allowed instrument interface with autovalidation. 

Methods: A1c % was measured on the BioRad Variant II and the Trinity Hb9210 

instrument on ~ 50 consecutive specimens. Imprecision and linearity were examined 

using human whole blood specimens or commercially available reagents. A1c controls 

were used for the imprecision. Linearity was demonstrated by mixing different 

proportions of selected low and high concentration specimens (3% and 18.7%). TAT 

is the average time from arrival of the specimen in the laboratory to the time results 

were reported. 

Results: For specimens not containing Hb variants the correlation was excellent 

(Hb9210=0.95(BioRad) + 0.08; R2=0.99, n=49). Three specimens with Hb variants 

were discrepant. Hb9210 values were confirmed by an alternate method (figure). 

Imprecision (coefficient of variation, CV (%)) was 0% at 5.4%, and 0.5% at 10.8%. 


A97



Average percent recovery of controls between 3.7% and 18.5% was 98% with 

maximum deviation of 92%. TAT for autovalidated results using the Hb9210 was



A-323 

Demonstration of a Combined Total Hemoglobin and Hemoglobin A1c 

Control with Extended Stability 

J. Starobin, B. Fernandez, S. Musngi, M. Ghadessi, M. Ban. Quantimetrix 

Corporation, Redondo Beach, CA 

Background:Total Hemoglobin (Hb) and the Hemoglobin A1c variant (HbA1c) have 

become increasingly important tests, particularly in the point-of-care (POC) setting. 

Hb is used to detect the presence of several conditions and diseases including anemia, 

chronic renal disease, chronic lung disease, and dehydration. HbA1c is used to both 

diagnose diabetes mellitus and assess long-term glycemic control in diabetic patients. 

Objective:To formulate a liquid combined Hb/HbA1c control with stability of at least 

6 months at 2-8ºC and 3 weeks at room-temperature (RT) for utility in both the central 

laboratory and POC settings. 

Methods:A two level control was formulated in whole blood and adjusted for Hb and 

HbA1c levels. Level 1 (normal) consisted of Hb in the 14.5 to 15.5 g/dL range and 

HbA1c in the 5.0 to 7.5% range. Level 2 (abnormal) consisted of Hb in the 9.5 to 10.5 

g/dL range and HbA1c in the 10 to 15% range. Samples of both levels were subjected 

to accelerated stability testing at 25°C and 30°C as well as on-going real-time stability 

testing. HbA1c testing was performed on the Siemens Dimension ExL. Hb testing 

was performed on the HemoCue Hb 201+. The accelerated stress data was used to 

create an Arrhenius model allowing for the prediction of long-term stability. 

Results: 

Accelerated Stability for Hb and HbA1c 

Level 1 

Calculated Ea Predicted -20ºC Predicted 4ºC 

Analyte 

(cal/mol) Stability Stability 

Total 

16,706 > 10 years 8.5 months 40 days 

Hemoglobin 

% HbA1c 22,118 >> 10 years 36 months 93 days 

Level 2 

Calculated Ea Predicted -20ºC Predicted 4ºC 

Analyte 

(cal/mol) Stability Stability 

Total 

15,211 8 years 7 months 39 days 

Hemoglobin 

% HbA1c 27,296 >> 10 years 35 months 52 days 

Predicted 22ºC 

Stability 

Predicted 22ºC 

Stability 

Conclusion:The new Quantimetrix combined Hb/HbA1c control shows 2-8ºC 

stability of at least 7 months and room temperature stability of at least 5 weeks. 

Real-time results at 25ºC correlate well with the room temperature (22ºC) prediction. 

On-going real-time analysis will be used to validate the 2-8ºC stability prediction. 

The control is suited to both the central laboratory and POC settings where the 

extended room temperature stability is ideal for locations where refrigeration is not 

conveniently available. 

A-324 

A Sensitive and Selective Analysis of Allopregnanolone and 

Pregnanolone in Human Plasma using LC-MS/MS and Differential 

Ion Mobility Spectrometry 

W. Jin 1 , M. J. Y. Jarvis 1 , M. Star-Weinstock 2 , B. Patterson 3 , M. Altemus 4 . 

1 

AB SCIEX, Concord, ON, Canada, 2 AB SCIEX, Framingham, MA, 3 AB 

SCIEX, Victoria, Australia, 4 Weill Medical College, Cornell University, 

New York, NY 

Background: For Research Use Only. Not For Use In Diagnostic Procedures. There 

is growing interest in the therapeutic potential of gabaergic neuroactive steroid 

compounds, and the 3-alpha metabolites of progesterone, testosterone, deoxycortisol 

and androstenedione have been shown to have potent anxiolytic, analgesic, antiseizure, 

and neuroprotective effects in animal models and to activate GABA A 

receptors. The 

most studied of these has been allopregnanolone. However, understanding of the 

physiological role of these compounds has been limited by the difficulty of measuring 

these compounds in biological samples. Currently only GC/MS assays with labor 

intensive extraction steps have adequate sensitivity to measure these compounds 

in biological samples and only a few specialized academic laboratories have the 

expertise to conduct these measurements. We propose to develop the capacity to use 

LC-MS/MS to measure GABAergic neurosteroid compounds in biological samples 

to enable the identification of biomarkers of disease risk, predictors of treatment 

response, and new therapeutic targets. 

Methods: The challenges for LC-MS/MS analysis of allopregnanolone are (i) its 

poor ionization efficiency, and (ii) the presence of numerous isobaric interferences 

in biological samples including, but not limited to, its isomer pregnanolone. To 

overcome these challenges, ion mobility separation was combined with conventional 

LC-MS/MS detection using a highly sensitive AB SCIEX Triple Quad 6500 

mass spectrometer equipped with the SelexION ion mobility device. The method 

employed liquid-liquid extraction of 100μL serum or plasma. After extraction, 

the sample was derivatized using a commercially available quaternary aminooxy 

reagent. Liquid chromatography (LC) separation of allopregnanolone and its isomer 

pregnanolone was achieved using a Phenomenex Kinetex C18 2.1x100 mm column. 

Results: The analytical method was developed to cover a calibration range from 5 pg/ 

mL to 100 ng/mL in serum or plasma. Inter- and intra-day precision was determined 

to be less than 10%, and inter- and intra-day accuracy was between 91 and 108%. 

The observed recovery for the extraction method was greater than 95%, and the 

limit of quantitation for the method was 5 pg/mL, for both allopregnanolone and 

pregnanolone, which is significantly better than what can be found in the literature. In 

reality, this method is sufficiently sensitive to enable the measurement of less than 1 

pg/mL of allopregnanolone and pregnanolone, however it was difficult to find blank 

matrix material (double-charcoal stripped human plasma) containing less than 1-2 pg/ 

mL of endogenous allopregnanolone and pregnanolone, for which reason we have 

prepared our lowest calibrators at 5 pg/mL. 

Plasma samples from ‘normal’, pregnant, and postpartum women were analysed using 

this method. Measured concentrations of allopregnanolone ranged from 4,000-16,000 

pg/mL in the pregnant samples, from 25-210 pg/mL in the ‘normal’ samples, and from 

6-30 pg/mL in the postpartum samples. 

Conclusions: Employing LC-MS/MS and differential ion mobility spectrometry, 

a highly sensitive method has been developed to enable the measurement of 

allopregnanolone and pregnanolone at concentrations as low as 5 pg/mL in human 

plasma. 

A-325 

Circulating levels of matrix metalloproteinases(MMP-2), tissue 

inhibitors of metalloproteinases(TIMP-2), reactive carbonyl 

compounds and advanced glycation end products in type 2 diabetic 

patients 

H. Erman 1 , R. Gelisgen 2 , Ö. Tabak 3 , H. Uzun 2 . 1 Kafkas university Kafkas 

medical faculty Department of Medical Biochemistry, Kars, Turkey, 

2 

Istanbul university Cerrahpasa medical faculty Department of Medical 

Biochemistry, Istanbul, Turkey, 3 Istanbul Education and Research Hospital, 

Internal Medicine Clinic, Istanbul, Turkey 

Background:Diabetes mellitus (DM) is associated with an increased incidence of 

cardiovascular events and microvascular complications. Alterations in vascular 

structure, characterized by extracellular matrix deposits in the capillary and basement 

membranes, contribute to the pathogenesis of vascular complicatios of diabetes. 

Among several biochemical pathways mediated by hyperglycemia, the accumulation 

of advance glycation end products (AGEs) has been shown to correlate with the 

degree of diabetic complications. In particular, increases in extracellular matrix 

(ECM) are associated with the accumulation of AGEs, which reduces matrix turnover. 

The balance between MMPs and TIMPs are critical for the eventual ECM remodelling 

in the tissue. Disturbances of physiological balance between metalloproteinases and 

their inhibitors seem to play an important role in the development and progression of 

diabetic microangiopathy. RCOs react nonenzymatically with protein amino groups 

and eventually yield AGE. A role for glucose and for AGEs in the regulation of MMP 

expression has also been demonstrated in vitro. In this study, we aimed firstly to 

measure the plasma levels of MMP-2 an their specific tissue inhibitors TIMP-2 in 

type 2 diabetic patients with microvascular complications and without complications 

and in healthy subjects, secondly to investigate the plasma levels of AGEs and RCOs, 

which are precursors of AGEs and their relationship with MMPs-TIMPs levels. 

Methods:We studied 65 patients with type 2 diabetes and 25 healthy subjects as 

control. Type 2 diabetic patients were divided into two groups as with microvascular 

complications (n:40) and without complications (n:25). Plasma levels of MMP-2, 

TIMP-2, AGE were determined using immunoenzymatic assays. Plasma levels of 

RCO were determined using spectrophotometric methods. 

Results:MMP-2, TIMP-2, AGE and RCO plasma levels were found significantly 

higher in tip 2 diabetic patients(p



p



A-329 

Multi-center comparison of testosterone measurements using 

immunoassay and mass spectrometry 

D. M. Milhorn 1 , D. W. Chandler 2 , S. H. Pepkowitz 2 , N. L. Korpi-Steiner 1 , 

C. A. Hammett-Stabler 1 . 1 UNC Hospitals, Chapel Hill, NC, 2 Endocrine 

Sciences, a LabCorp Company, Calabasas Hills, CA 

Background: Measurement of circulating total testosterone can be important in the 

evaluation of endocrine function as well as in the investigation of other endogenously 

and exogenously produced androgen disorders. These investigations encompass all 

ages and include females as well as males. Thus analytical methods must be able to 

span a broad measuring range, typically over 1-1000 ng/dL. The aim of this study 

was to compare the analytical performance of a micro-well competitive testosterone 

immunoassay with a testosterone measurement using LC-MS/MS to determine the 

suitability of this immunoassay for all populations. 

Methods: Serum samples (n=45) submitted for routine testosterone evaluation were 

used for this comparative study as part of ongoing quality initiatives. Testosterone 

measurements were performed using the VITROS 5600 Integrated System (Ortho 

Clinical Diagnostics, Rochester, NY) and a laboratory developed method (Endocrine 

Sciences, a LabCorp company, Calabasas Hills, CA) using the API5000 High 

Performance LC-MS/MS (Applied Biosystems Sciex, Grand Island, NY). The results 

of the samples used for the comparison study ranged from 5 ng/dL to 1530 ng/dL. In 

addition calibrations were compared on each instrument by exchange of calibration 

material. 

Results: Comparative analysis of the testosterone VITROS automated immunoassay 

with testosterone by LC-MS/MS yielded the regression equation: VITROS = 0.67x 

LC-MS/MS + 5.9, (R 2 = 0.976). These data demonstrated the VITROS immunoassay 

has a proportional bias that included a positive bias at reportable testosterone levels 

of ≤ 35 ng/dL and a negative bias at the higher end of the AMR as compared to 

the LC-MS/MS method. Analysis of calibration materials yielded a negative bias 

throughout the AMR using the immunoassay as compared to LC MS/MS on both 

sets of calibrators. 

Conclusion: While the VITROS automated immunoassay is a sensitive and specific 

assay likely sufficient for the measurement of testosterone in the adult healthy male, its 

use in the pediatric and female populations may be problematic because in our hands 

the assay overestimates testosterone concentration in the ranges necessary for these 

populations. Given this positive bias we recommend its use for screening purposes 

with consideration of follow-up confirmation using LC-MS/MS based upon clinical 

needs. Noteworthy, calibration comparisons demonstrated a different bias profile 

compared to patient specimens suggesting matrices effect and lack of commutability. 

This study further supports the need for the development of communicable standards 

as well as harmonization of testosterone measurement procedures, such as the CDC 

steroid hormone standardization project, in order to improve comparability and 

facilitate interpretation of clinical data. 

A-330 

OPTIMIZING GLUCAGON STIMULATING TEST FOR 

CHILDHOOD GROWTH HORMONE DEFICIENCY 

Y. Schrank, M. Freire, R. Fontes, O. Fernandes. DASA - laboratory 

medicine, rio de janeiro, Brazil 

Background: There is no consensus on the stimulation test considered the “gold 

standard” for the diagnosis of GH deficiency, although the GH stimulation test with 

insulin continues to play a major role in the diagnosis of GH deficiency, because it 

has the best overall test performance (sensitivity and specificity). The administration 

of insulin represents, however, not an entirely risk-free procedure, and is therefore 

contraindicated in children younger than 3 years, as well as in children with a history 

of seizures. In this context, the glucagon stimulation test has been increasingly 

indicated (because of its safety and tolerance), especially in children below 6 years. 

The greatest limitation of this test is its long duration (blood samples are taken before 

intramuscular or subcutaneous administration of glucagon, and then every half hour 

for 3 hours). 

Objectives: In order to optimize the specimen collection for the glucagon stimulation 

test we studied timing of the peak value of GH. The aim of our study was to examine 

whether the glucagon stimulation test could be performed with fewer samples without 

compromising its diagnostic value. 

Materials and Methods: We retrospectively reviewed 100 responsive GH stimulation 

test with glucagon performed at our clinical laboratory. A test was considered 

responsive when peak GH was above 5ng/mL. 

Results: The mean age of our patients was 8 years, and male:female ratio was 2:1. 

Median GH values were respectively 2.4ng/mL, 5.9ng/mL, 12.8ng/mL, 8.4ng/mL, 

5.6ng/mL and 2.5ng/mL before and 90, 120, 150, 180 and 210 minutes after the 

stimulus. Eighty-four patients showed GH peak response 120 minutes after glucagon. 

Only 8% hat a peak GH response at any other time than 90, 120 and 150 minutes. 

However, half of these patients showed a GH satisfactory response (but not a peak 

response) at 90, 120 or 150 minutes after the stimulus. We further note that the 

omission of the basal time, in no way compromises the interpretation of GH stimulus 

with glucagon. 

Conclusions: We conclude that GH stimulations test with Glucagon can be 

optimized, without compromising its end result, by collecting only three specimens 

for GH determination 90, 120 and 150 minutes after sub-cutaneous administration of 

the secretagoge. 

A-331 

Total vitamin D status in the patients with diabetes mellitus and 

possible connection with low levels of pancreatic elastase in the feces 

R. Stojkovic, S. Jovicic, S. Ignjatovic, N. Majkic-Singh. Clinical Center of 

Serbia, Belgrade, Serbia 

In pancreas, the cells of Langerhans islets are scattered within the exocrine pancreatic 

tissue achieving close contact via islet-acinar portal system. The measurement of 

pancreatic elastase (PE) in feces is used widely to screen for pancreatic exocrine 

disfunction. There is a convincing evidence that vitamin 1,25-(OH)2D regulates β-cell 

function by various mechanisms, such as the effect on insulin secretion through the 

regulation of intracellular Ca2 + levels, increased resistance to β-cell apoptosis and 

a likely increase of β-cell replication. We examined the prevalence of insufficient 

concentrations of total vitamin D in the patients with diabetes mellitus (DM) and 

possible connection between low levels of PE in the feces and inadequate levels of the 

total vitamin D, as a measure of qualitative malnutrition. 

The study population was comprised of a cohort of 48 patients with type 1 and type 

2 diabetes mellitus. Study also included a control group that consisted of 24 healthy 

volunteers. PE was determined by ELISA method, using monoclonal antibody 

(ScheBo Biotech, Giessen, Germany), while the total vitamin D concentration in 

serum was assayed by electrochemiluminiscence technology on Cobas e601 analyzer 

(Roche Diagnostics, Wiesbaden, Germany). 

Compared to the control group, patients with DM had significantly lower values 

(Student t-test, P



Methods: E2 and TT were simultaneously isolated from proteins, phospholipids, 

and other matrix components in serum (200 μl) through liquid-liquid extractions 

(LLE). All extraction procedures were performed with a 96-well plate platform 

using an automated Hamilton liquid handling system to allow for high throughput. 

Internal standards of 13C-labeled estradiol (E2) and testosterone (TT) were used for 

quantification. The LC separation was performed on a Thermo Scientific Accucore 

Phenylhexyl column (150 x 3.0 mm, 2.6 μm particle size) with a gradient of water 

and methanol and ammonium fluoride modifier to improve the ionization of E2. An 

ABSciex 5500 quadrupole instrument was operated in electrospray positive-negative 

switching selected reaction monitoring mode. E2 and its internal standard were 

quantified in negative-ion mode with the ion transition m/z 271 to 145 and 274 to 148, 

respectively. Simultaneously TT and its internal standard were quantified in positiveion 

mode with transition m/z 289 to 97 and 292 to 100. 

Results: E2 and TT were measured simultaneously by ID LC-MS analysis coupled 

with LLE in a 96 well plate format using an automated system. The LODs of E2 and 

TT were determined to be 2.0 pg/mL and 0.35 ng/dL, respectively. The upper limit 

of linearity was 1000 pg/ml for E2 and 1300 ng/dL for TT. Between run CVs were 

3.5-5.2% for E2 at 3 representative levels and 1.2-5.0% for TT, respectively. Within 

run CV were 4.3-7.1% for E2 and 1.4-2.3 % for TT, respectively. The testosterone and 

estradiol were well separated, and no interference was detected for the 32 analogues 

tested. The accuracy of the method was evaluated with comparisons to 40 serum based 

certified reference materials with the average bias within the suggested performance 

criteria: E2 (8.3%) and TT (6.4%). 

Conclusion: Total E2 and TT were measured simultaneously by this method with 

accuracy and appropriate sample throughput. This method can be used in serum of 

male and female including pediatrics, old men, and postmenopausal women. This 

method will be used to measure E2 and TT in the NHANES and other research studies. 

analytical platform migration should be studied. The aim of this study was to establish 

reference intervals for prolactin send to Labrede (Reference Laboratory of Specialized 

Diagnostics), MG, Brazil using a commercial reagent. 

Methods: Samples were obtained from 125 female and 322 male blood donors, 

presumably healthy based on interview and clinical examination, according to 

national regulation of blood donation. These criteria excluded patients with acute 

illness, chronic diseases, pregnant women, users of various drugs and accepted the 

use of female hormones. The sample was taken after donation and physical rest, 

but fasting was not observed. The samples were stored at -20oC. We used Architect 

i2000, microparticle chemiluminescence immunoassay (Abbott Park, IL, USA). The 

maximum imprecision for controls was 4.57%. The reference range was defined as 

95% central interval. Statistical analyses were performed by EP Evaluator® and 

applied CLSI nonparametric and parametric transformed protocols. 

Results and Conclusions: The 95% central interval non-parametric approach was 

4.1-37.5ng/ml to females and 4.0-29.0ng/mL for males. It was concluded that the 

manufacturer’s values (n = 100), 3.46-19.40ng/mL and 5.18-26.53ng/mL, for men 

and women respectively, do not apply to the present study population. Thus, use of 

samples of database, as selected, consists in a viable option to statistical analysis and 

populational reference values calculation, providing improvement in laboratorial 

practice as occurred with prolactin in Architect System. 

A-333 

Age-specific increase in thyrotropin (TSH): a population based study 

in Brazil 

R. FONTES 1 , C. C. R. COELI 2 , F. AGUIAR 2 , M. FREIRE 1 , M. VAISMAN 2 . 

1 

DASA, RIO DE JANEIRO,RJ, Brazil, 2 UFRJ, RIO DE JANEIRO,RJ, Brazil 

Background: Some studies show a tendency to increase TSH levels with advancing 

age, with greater increase in those older than 60 years old. 

Objectives: To estimate changes in TSH by age groups in a cohort of elderly 

individuals comparing with young ones and determine central tendency values for 

each age group. 

Methods: Cross-sectional analysis of 1,220 individuals (50% women), mean age 62.2 

± 18 years (20-100), without goiter, no previous personal or family history of thyroid 

disease and negative thyroid antibodies, stratified by age. 

Results: In the whole sample, women and man had no different distribution of TSH 

values (2.45 ± 1.94 mUI/L vs. 2.25 ± 1.84 mUI/L; p=0.7786). Median TSH levels 

increased significantly with age: (p



Objective: Assess the cross-reactivity of synthetic insulins by commercial 

immunoassays to develop a testing strategy for physicians suspecting exogenous 

insulin use 

Methods: Spiked serum was prepared in triplicate at 50, 200 and 500 μIU/mL insulin, 

including Humalog (Lispro, Eli Lilly), NovoLog (Aspart, Novo Nordisk), Lantus 

(Glargine, Sanofi-Aventis), Novolin N (NPH, Novo Nordisk), Levemir (Detemir, 

Novo Nordisk) and Apidra (Glulisine, Sanofi-Aventis). Each sample was analyzed 

according to manufacturer’s specifications on six immunoassay platforms, including 

Beckman Access and Unicel DxI, Abbott Architect, ADVIA Centaur XP, Siemens 

Immulite 2000 and Roche Cobas e602. Mass spectrometric evaluation was performed 

as referenced in the literature by immunoaffinity chromatography and MS/MS on an 

Applied Biosystems QTrap mass spectrometer. Cross-reactivity was calculated as 

[(measured-blank/expected)x100], where the expected value was the known amount 

spiked into serum. For each set of samples, a serum blank was assayed without spiked 

synthetic insulin to account for endogenous insulin present. 

Results: Cross-reactivity results are demonstrated below: 

Conclusion: Results demonstrate that the Roche e602 assay has little cross-reactivity 

with synthetic insulins; under this circumstance, the recommended assay for assessing 

exogenous insulin uses an alternative immunoassay platform which can confirm most 

of the pharmaceutical insulins. 

Cross-Reactivity of Synthetic Insulins by Immunoassay and MS Quantitation (as a 

percentage) 

Humalog NovoLog Lantus Novolin Levemir Aprida 

Beckman Access 72.1 55.1 98.4 75.8 18.3 8.52 

Abbott Architect 81.5 48.3 104.0 76.0 110.7 10.9 

ADVIA Centaur XP 65.5 70.5 87.7 77.3 54.6 1.53 

Beckman DxI 67.7 54.9 89.8 70.8 21.5 10.6 

Siemens Immulite 2000 25.1 18.8 54.8 78.3 95.8 -2.84 

Roche e602 0.00 -0.01 15.4 90.9 0.34 -0.12 

Mass Spectrometry 92.4 79.0 N/A* 113.5 106.1 109.4 

*Due to sample instability and international shipping, results were not obtainable for Lantus 

with mass spectrometry. 

A-337 

Prolactin and Reproductive Hormone Status in Oligomenorrheic and 

Infertile Females 

R. SUWAL, A. NEPAL, B. GELAL, S. GAUTAM, M. LAMSAL, S. 

MAJHI, N. BARAL. B P Koirala Institute of Health Sciences, Dharan, 

Nepal 

Background: Oligomenorrhea is one of the significant problems of female these 

days. Oligomenorrhea during reproductive age group may lead to infertility which 

may cause matrimonial disharmony which is taken as serious problem in Asian 

sub-continent. The present study was designed to assess the prolactin, Follicular 

Stimulating Hormone (FSH) and Luteinizing Hormone (LH) in oligomenorrheic 

patients in Eastern region of Nepal. 

Materials and Methods: A total of 126 patients came to the immunoassay laboratory 

of Department of Biochemistry for the testing of Prolactin, LH and FSH from 

Department of the Obstetrics and Gynecology with complain of oligomenorrhea 

and primary and secondary infertility were enrolled in this study. Five milliliters 

venous blood samples were collected in plain vials and transported to the laboratory 

maintaining cold chains. Serum Prolactin, FSH and LH were measured by ELISA 

method (Eliscan, India). Kolmogorov-Smirnov test was used to test the normality of 

the data. Man-Whitney test was used to test the significance of hormone level between 

the groups at p value



Conclusion: This study establishes a strong relationship between serum testosterone 

and metabolic syndrome in subjects with both diabetes and hypertension. This suggests 

that hypogonadism is a common phenomenon in patients with both diabetes and 

hypertension in Nigeria.It may therefore be advisable to include routine measurement 

of testosterone level in the management of patients presented with both diabetes and 

hypertension. Furthermore, testosterone replacement therapy may improve the life 

expectancy of these patients. 

A-340 

Novel sandwich immunoassay for quantification of 25-hydroxy vitamin 

D on fully automated analyzer 

T. Ando, Y. Kitamura, T. Sakyu, Y. Uchida, M. Tomita, F. Takemura, T. 

Shirakawa, K. Aoyagi, K. Goishi, K. Omi. Fujirebio Inc., Tokyo, Japan 

Background: Vitamin D is well known for its role as an important regulator of 

calcium homeostasis and bone remodeling, and also known to affect the development 

of several non-bone diseases. 25-hydroxy vitamin D (25OH-D) is the best vitamin 

D marker, and can be measured by using competitive immunoassay, HPLC, or 

liquid chromatography tandem mass spectrometry at present. As the number of 

tests increases, demand for an automated 25OH-D assay continues to grow, but 

the automated assays available from various diagnostic manufacturers adopting 

competitive immunoassay with one antibody reportedly fail to meet accuracy and 

specificity requirements. Converting the assay principle from competitive to sandwich 

should greatly improve the assay performance. However, conventional sandwich 

immunoassay cannot be applied for measuring haptens, because haptens are too 

small for two antibody molecules to bind simultaneously. By using an antibody that 

specifically recognizes an immunocomplex consisting of 25OH-D and anti-25OH-D 

antibody, we have developed a sandwich immunoassay for 25OH-D that accurately 

measures 25OH-D. 

Methods: An antibody was established by ADLib (Autonomously Diversifying 

Library) system developed by Chiome Bioscience Inc. In ADLib, antibodies are 

generated in vitro from antibody libraries established by activating immunoglobulin 

gene diversification of chicken-derived DT40 cell. Human specimens were mixed 

with anti-25OH-D antibody-conjugated magnetic beads in treatment solution. The 

immunocomplex was quantified using an alkaline phosphatase-labeled secondary 

antibody recognizing the complex. All reactions were executed on fully automated 

chemiluminescence analyzer (LUMIPULSE, Fujirebio Inc.). 

Results: 25OH-D in human specimens was detected in a dose-dependent manner, 

and significant correlation with the commercially available Total Vitamin D RIA was 

observed (Pearson’s correlation coefficient, R 2 = 0.94). Precision ranges (CV %) of 

our sandwich assay were 1.0-2.3% within run, and 1.9-3.5% for total precision. The 

use of the two antibodies enabled our assay to exhibit improved specificity against 

immunoreactive derivatives such as 24,25(OH) 2 

-D, which are present in human 

serum and known to cross-react with antibodies used in most commercially available 

immunoassay kits. 

Conclusion: Assay performance was significantly improved by converting the 

immunoassay principle from competitive to sandwich. Our novel assay would 

provide high-throughput, accurate and specific immunoassay for 25OH-D. Our hapten 

sandwich immunoassay platform should be the simplest and most practical approach 

for routine assays of haptens including vitamins, hormones, drugs and toxins, leading 

to the breakthrough in analytical/clinical chemistry. 

A-341 

Evaluation of a Next Generation Enzymatic Assay for Hemoglobin A1c 

on the Abbott ARCHITECT c8000 Chemistry System 

T. Teodoro-Morrison 1 , Y. Wang 2 , P. M. Yip 2 . 1 University of Toronto, 

Toronto, ON, Canada, 2 University Health Network, Toronto, ON, Canada 

Background: Current guidelines from the American and Canadian Diabetes 

Association have recommended the use of HbA1c testing in the management and 

diagnosis of type 2 diabetes mellitus. With this expanded role for HbA1c, there is 

a clinical need for accurate and precise test methods for HbA1c quantification as 

endorsed by the National Glycohemoglobin Standardization Program (NGSP). 

Furthermore, screening for early diabetes in the general population will find increased 

use considering the increasing prevalence of obesity. This present study evaluated 

a next generation fully automated and high-throughput enzymatic assay for HbA1c 

that is run on the Abbott ARCHITECT c8000 chemistry system (List #4P52). Using 

a whole blood sample, red blood cells are lysed and total hemoglobin is measured 

in the first step. Following protease digestion in the second step, a fructosyl-Val- 

His dipeptide from the N-terminus of the beta-chain of hemoglobin is released and 

provides a substrate for fructosyl peptide oxidase. This enzymatic method produces 

hydrogen peroxide which is then measured using a colormetric reagent. 

Methods: Method comparisons were performed against the on-market Abbott 

ARCHITECT HbA1c on the i2000 immunoassay system (List #4P72) and the 

Bio-Rad Variant II Turbo 2.0 ion-exchange HPLC using fresh whole blood patient 

samples as well as specimens with reference values assigned by NGSP. Additionally, 

heterozygous hemoglobin variants HbS, HbC, HbD, HbE, and HbF were assessed for 

potential interference using approximately 20 samples for each variant. 

Results: Method comparison of the ARCHITECT c8000 enzymatic assay (y) with 

124 patient samples across a range of 4.3 to 12.8 %HbA1c with the ARCHITECT 

i2000 immunoassay (x) showed a regression relationship of y=0.953-0.05 and 

R=0.984, while the comparison with the Bio-Rad Variant II Turbo HPLC assay (x) 

showed a regression relationship of y=1.006x-0.25 and R=0.9851. The set included 

60 samples which were in the clinically relevant diagnostic range 6.0 to 7.0 %HbA1c 

and sub-range analysis showed a mean bias of -0.3 %HbA1c relative to both 

immunoassay and HPLC. Although assay imprecision was not formally assessed, the 

enzymatic assay performed better than the immunoassay which showed a standard 

error estimate of 0.05 between replicates for the enzymatic assay compared to 0.24 

for the immunoassay. Finally, hemoglobin variants HbS, HbC, HbD and HbE did not 

interfere with the enzymatic assay when compared to assigned values determined by 

the NGSP primary reference laboratory. The mean biases were -0.28, -0.45, -0.26, and 

-0.09 %HbA1c, respectively, across HbA1c concentrations from 4.1-13.5%. Samples 

containing HbF, however, showed significant negative interference when levels were 

>10% HbF. 

Conclusion: We have evaluated the performance of the next generation Abbott 

ARCHITECT enzymatic HbA1c assay on the c8000 chemistry system. This assay 

has excellent agreement with the Bio-Rad Variant II Turbo HPLC assay and has no 

significant interference from hemoglobin variants S, C, D, and E, while negative bias 

was observed in the presence of >10% HbF. Overall, the clinical chemistry HbA1c 

assay showed acceptable performance for clinical use and shows minimal interference 

from common hemoglobin variants. 

A-342 

Clinical Importance of “Bioavailable” Vitamin D: Development and 

analytical validation of Bioavailable 25Hydroxy Vitamin D assay 

R. Pandian, J. Pandian, A. N. Elias. Pan Laboratories, IRVINE, CA 

Objective:To develop a reproducible assay for quantitation of “bioavailable “ vitamin 

D (Bio D) in human serum samples. 

Relevance: Vitamin D deficiency is determined by measuring circulating 25 hydroxy 

Vitamin D (25(OH)D). Over 85 % of circulating 25(OH) D is tightly bound to a 

specific vitamin D binding protein (DBP). A lesser amount is bound loosely with 

albumin. Less than 1% is free Vitamin D (Free D). The free fraction along with 

the albumin bound fraction, called Bioavailable Vitamin D, is readily available for 

metabolic function. 

Recent studies indicate that bioavailable, and not total 25(OH) D, correlate well 

with serum calcium. There was poor correlation between 25(OH) D levels with bone 

mineral density in studies that examined this relationship. However, the correlation 

between Bio D and bone mineral density was good. Similarly, measurement of Bio D 

in hemodialysis patients showed better correlation in terms of mineral metabolism and 

PTH levels than total Vitamin D measurement. It is therefore important to measure 

Bio D in some of the clinical conditions associated with potential mineral metabolic 

changes. 

Methodology: Bioavailable 25(OH) D is vitamin D (25 OH) not bound to DBP. To 

obtain the bioavailable fraction, total vitamin D was quantitated using an immunoassay 

with equal cross reactivity with D2 and D3 (Calbiotech) . DBP was quantitated by an 

immunoassay using reagents from R & D systems. Albumin was quantitated by a 

calorimetric method. Using the affinity constant of 25(OH)D for DBP ( Ka = 7 X 10 8 

M -1 ) and albumin (Ka = 6 X10 5 M -1 ), Bio D, DBP bound 25(OH)D , albumin bound 

25(OH)D and free 25(OH)D were calculated . Bioavailable is the combination of 

albumin bound 25(OH)D + free 25(OH)D. 

Results: The assays used in this study are 25(OH)D, DBP and albumin. All the assays 

are all very reproducible, individually and in combination, for calculations of Bio D 

with a CV of less than 13 %. Sensitivity, specificity, and interference studies met the 




acceptability criteria .All the three assays were run in normal samples and calculated 

Bioavailable vitamin D ( 3.87 ± 2.0 ng/ml ), calculated free D ( 9.94 ± 5.47 pg/ml ) 

and DBP bound 25(OH)D ( 28.14 ± 15.2 ng/ml ). Correlation of Bio D with calculated 

free D in these normal samples was good (r2 = 0.97) whereas correlation with Bio D 

with total 25(OH) D was poor (r 2 =0.366). 

Conclusion: We have developed a reproducible bioavailable 25( OH ) Vitamin D 

assay , useful for routine testing in a clinical lab . The availability of “Bioavailable 

“ vitamin D may be useful to elucidate accurately the nature of relationship between 

Vitamin D and wide range of disorders including fracture , infection, cancer and 

cardiovascular diseases . 

A-343 

Elevated hs-CRP correlates with other atherosclerotic risk factors in 

young patients of type 1 Diabetes Mellitus 

objective of this study was to confirm the presence of hemoglobin variants in our 

patients: they give a false HbA1c result which means a bad control of diabetes 

mellitus. 

Methods: In the routine HPLC assays (Bio-Rad Variant II Turbo 1.5 min. program), 

some samples were found to have an abnormal peak before the HbA0 peak. After 

checking the chromatogram, samples were tested by latex aglutination inmunoassay 

(DCA System, Siemens) and alternative HbA1c levels were determined. The α-globin 

gene was amplified by PCR and sequencing was performed on a ABI Prism 310 

sequencer. 

Results: Samples came from patients in the same family and a peak before HbA0 (P4) 

was observed in all of them. Alternative results suggested the presence of abnormal 

Hb variant. In fact, a 15 % difference regarding previous results was observed. After 

sequencing, the presence of GCC>GAC mutation was described at codon 12 in the 

first exon of Alfa-2 gene. This mutation determines alanine change for aspartic acid 

known as Hb J-Paris - I. 

N. G. CHAUDHARY, H. Sharma. GOVERNMENT MEDICAL COLLEGE, 

BHAVNAGAR, India 

Aims: The present research work is designed to study serum high sensitivity 

C-reactive protein (hs-CRP) as a marker of low grade inflammation and its association 

with lipid profile for assessment of future risk of atherosclerosis in pediatric and 

young patients with type 1 diabetes mellitus. 

Methods: In the present study, 60 Patients of known type 1 diabetes mellitus with 

mean duration of disease of 7.8 ± 2.8 year and 60 apparently healthy subjects were 

included and their body mass index (BMI), waist circumference and waist to hip ratio 

(WHR) were measured. Fasting blood samples were collected from each participant 

and analyzed for hs-CRP, blood glucose, HbA 1 

c, cholesterol, triglyceride, HDL and 

LDL. Statistical analysisi were carried out by applying student t test and pearson 

correlation test. 

Results: The levels of serum hs-CRP (p



LC/MS/MS method on the Applied Biosystems API4000. Gender specific reference 

interval verification was performed on each of 20 apparently healthy male and female 

subjects. Standard statistical analyses were performed using EP Evaluator Release 7 

software. 

Results: Imprecision (CV) of Abbott Low, Medium, and High controls at mean values 

of 0.3, 2.2, and 7.7 nmol/L equaled 5.6%, 3.8%, and 3.9%, respectively, and agreed 

with the manufacturer’s claimed precision. Bio-Rad controls at mean concentrations 

of 4.5, 17, and 40 nmol/L gave CVs of 3.5%, 2.9%, and 3.2%, respectively. The 

claimed functional sensitivity is ≤0.15 nmol/L which was verified at a concentration of 

0.14 nmol/L with a CV of 6.9%. Linearity was achieved with a



A-349 

Development of a Well Characterized Ultra-sensitive Human Anti- 

Müllerian Hormone (AMH) ELISA. 

A. Kumar, B. Kalra, A. S. Patel, S. Shah. Ansh Labs, Webster, TX 

Objective: Development of a specific and sensitive human AMH ELISA for the 

quantitative measurement of biologically active AMH in serum, plasma and follicular 

fluid. 

Relevance: AMH is a member of the transforming growth factor-β (TGF-β) 

superfamily responsible for the regression of Müllerian ducts in the male embryo. In 

female embryos, the Müllerian ducts give rise to the uterus, fallopian tubes, and upper 

part of the vagina. AMH is produced in small amounts by ovarian granulosa cells after 

birth until menopause, and then becomes undetectable. In the adults, AMH also plays 

a role in Leydig cell differentiation and function and follicular development. 

Like other TGF-β superfamily members, AMH is produced as a large, 140-kDa 

homodimeric precursor linked by disulfide bridges. Cleavage at the monobasic site 

generates a 110-kDa N-terminal homodimer and a 25-kDa C-terminal homodimer, 

which remain associated in a non-covalent complex. Recent studies have shown that 

the AMH C-terminal homodimer is much less active than the non-covalent complex, 

but almost full activity can be restored by associating the N-terminal pro-region, 

which re-forms a complex with the mature C-terminal dimer. The finding suggests 

that the AMH non-covalent complex is the active form of protein. 

Methodology: We have developed a two-step, sandwich-type enzymatic microplate 

assay using highly characterized monoclonal antibody pair to measure human AMH 

levels in 25 μL of sample in less than 3.5 hours. The assay uses stabilized recombinant 

human AMH as calibrators (0.06-14 ng/mL). The assay measures the non-covalent 

complex of human AMH and does not detect inhibin A, inhibin B, activin A, activin 

B, activin AB, FSH, LH, TSH, α2M, progesterone, estradiol, prolactin, myostatin at 

two times their physiological concentrations. 

Validation: The Ultra-sensitive AMH ELISA, when compared to AMH Gen II assay 

using 90 serum samples in the range of 0.1-13 ng/mL, yielded a correlation coefficient 

of >0.98 and a slope of 1.10 with an intercept of 0.06 ng/mL. Forty matched Lithium 

heparin plasma and serum specimens in the range of 0.13-13.01 ng/mL yielded a 

correlation coefficient of >0.99 and a slope of 1.06 with an intercept of -0.1 ng/mL. 

Total imprecision calculated on three serum pools and two kit controls over 40 runs, 

two replicates per run, was 5.4% at 0.51 ng/mL, 5.7% at 0.71 ng/mL, 5.6% at 1.05 ng/ 

mL and 5.5% at 1.1 ng/mL, 5.9% at 2.7 ng/mL, respectively. The functional sensitivity 

calculated at 20% CV was 0.023 ng/mL. Dilution and spiking studies showed average 

recoveries between 90-110%. When potential interferents (hemoglobin, triglycerides 

and bilirubin) were added at twice their physiological concentrations, AMH 

concentrations were within ±10% of the control. 

Conclusions: A highly sensitive, specific and reproducible AMH assay has been 

developed that measures the non-covalent complex of human AMH. The performance 

of the AMH assay is ideal for research involving neonatal gender determination, 

ovarian reserve assessment, premature ovarian failure (POF), primary ovarian 

insufficiency (POI), polycystic ovary syndrome (PCOS), peri-menopausal transition, 

testicular function, and monitoring of granulosa cell tumor therapy. 

A-350 

Development of a Sensitive Inhibin B ELISA Optimized to Eliminate 

False Positive Results. 

A. Kumar, B. Kalra, A. S. Patel, S. Shah. Ansh Labs, Webster, TX 

Objective: Development of a sensitive Inhibin B ELISA for the quantitative 

measurement of inhibin B in serum, plasma and follicular fluid. 

Relevance: Inhibins are heterodimeric protein hormones secreted by granulosa cells 

of the ovary in the female and Sertoli cells of the testis in the male. The role of inhibin 

B in male factor and female infertility has been extensively published. In males 

inhibin B is a potential marker for spermatogenesis and testicular function. In females 

inhibin B is a useful tool for assessment of ovarian reserve, oocyte quality, and 

granulosa cell tumors. Early commercial Inhibin B assays required pre-treatment of 

samples with an oxidation procedure, which allowed for full immunoreactivity. This 

important pre-treatment step minimized the risk of false positive results by removing 

binding proteins, deactivating proteases and catalases. However, these original assays 

requiring overnight incubation were time-consuming and procedurally cumbersome 

for laboratories. A commercially available Inhibin B Gen II assay does not require 

oxidation. 

Methodology: We have developed a two-step, sandwich-type enzymatic microplate 

assay to measure inhibin B levels. This convenient assay utilizes oxidation and binding 

protein-releasing reagents that eliminate potential false positive results. Results are 

generated in less than 3.5 hours with excellent precision. The assay measures inhibin 

B in 50 μL of serum or Li-Hep plasma samples. The assay uses human inhibin B 

calibrators (10-1200 pg/mL). The highly characterized dual monoclonal antibody 

pair is specific to inhibin B and does not detect inhibin A, activin A, activin B, 

activin AB, AMH, FSH, LH, follistatin 288 and 315 at two times their physiological 

concentrations. 

Validation: The Ansh Labs Inhibin B ELISA assay was compared against two 

commercially available assays using 97 random male and female samples. The 

assay showed significant positive linear correlations to the Inhibin B Gen II assay 

and the AnshLite Inhibin B CLIA assay (r=0.97; P



limits of +5.0% and ≤10.0%, respectively, after four consecutive challenges. Assays 

are evaluated based on total 25-hydroxyvitamin D, which is defined as the sum of 

25-hydroxyvitamin D2 and 25-hydroxyvitamin D3. 

Results: Currently there are 15 participants enrolled in various stages of the program, 

including clinical laboratories, academic institutes, and immunoassay manufactures. 

To date, two quarters have been completed. 

A-352 

Hemoglobin variant integration method for HbA1c analysis by HPLC 

S. K. Tanaka. Bio-Rad Laboratories, Hercules, CA 

Background: Improved precision and accuracy for HbA 1c 

testing in the presence 

of the most common hemoglobin variants (E, D, S, and C) is needed to meet the 

tightening criteria from NGSP and external quality assessment programs. A new 

integration approach separates HbA 0 

from HbA 2 

, and improves precision and 

accuracy for HbAE, HbAD, HbAS, and HbAC sample types. 

Methods: Previous hemoglobin variant HbA 1c 

analysis method included HbA 0 

and 

HbA 2 

in the total area and %HbA 1c 

calculation. The new analysis method applies an 

HbA 0 

peak fit to all samples, and excludes all post HbA 0 

area. 

Verification of the improved integration method on the Variant II TURBO 2.0 method 

was performed in the following manner: (1) Variant patient samples previously 

analyzed by an NGSP reference laboratory were tested using the test integration 

method. Criteria of ±7% of true value was used to assess clinically significant 

interference. Test and reference methods were correlated to determine bias at 6.5% 

and 8.5% by linear regression analysis. (2) A dose-response interference study per 

CLSI guideline EP-7A2 was conducted for each variant at the clinically significant 

HbA 1c 

values of 6.5% and 8.5%. Homozygous variant patient samples were spiked 

into a non-variant patient sample pools. 

A-353 

Evaluating serum vitamin D levels in elderly patients with subclinical 

hypothyroidism 

F. Ucar 1 , G. Ozturk 1 , Z. Ginis 1 , G. Erden 1 , M. Y. Taslıpınar 1 , A. E. Arzuhal 1 , 

T. Delibası 2 . 1 Diskapi Yildirim Beyazit Training and Research Hospital, 

Department of Clinical Biochemistry, Ankara, Turkey, 2 Diskapi Yildirim 

Beyazit Training and Research Hospital, Department of Endocrinology 

and Metabolism, Ankara, Turkey 

Background: Vitamin D is the principal regulator of calcium homeostasis and also 

known as an immune modulator hormone. It has been recently shown that vitamin D 

deficiency is associated with various diseases such as cardiovascular disease, cancer, 

osteoporosis and autoimmune diseases. Increasing researches have indicated the 

relation between serum vitamin D level and several autoimmune diseases regarding 

to important roles of this hormone in immune regulation. However the role of vitamin 

D in the etiopathogenesis of these diseases is also not well understood. As similar 

the detailed mechanism of vitamin D action on thyroid hormone metabolism and 

autoimmune thyroid diseases is still poorly understood. It was reported more recently 

that patients with autoimmune thyroid disease had lower vitamin D 

levels. However, there are few studies examining vitamin D status in elderly patients 

with subclinical hypothyroidism. We therefore aimed to investigate vitamin D levels 

in elderly patients with subclinical hypothyroidism. 

Methods: In the present study, a total of 37 patients (>70 years old) with subclinical 

hypothyroidism and 40 healthy controls (>70 years old) were retrospectively analyzed. 

Serum free triiodothyronine (fT3), free thyroxine (fT4) and thyrotrophic hormone 

(TSH) were analyzed by chemiluminescence immunoassay (Centaur XP, Siemens 

Healthcare Diagnostics Inc., Tarrytown, USA). Serum levels of 25-Hydoxy vitamin D 

(25-OH D) were measured by chemiluminescence immunoassay (DiaSorin,Liaison, 

Italy). Serum anti thyroid peroxidase (anti-TPO) and anti thyroglobulin (anti- 

TG) were measured by using a solid-phase, enzyme-labeled, chemiluminenescent 

sequential immunometric assay (Immulite 2000 XPi, Siemens Healthcare Diagnostics 

Inc., Tarrytown, USA). 

Results: There was no significant difference between groups in terms of age and 

gender distribution. Serum TSH, anti-TPO and anti-TG levels in elderly patients with 

subclinical hypothyroidism showed expected higher values than healthy controls. 

Serum 25-OH D levels in elderly patients with subclinical hypothyroidism were lower 

than healthy controls (p< 0.001). 

Conclusions: These data confirm the association between serum 25-OH D levels and 

subclinical hypothyroidism in elderly patients. Vitamin D insufficiency is associated 

with subclinical hypothyroidism in elderly patients. Further studies are needed to 

determine whether vitamin D insufficiency is a casual factor in the etiopathogenesis of 

subclinical hypothyroidism in elderly patients or rather a consequence of the disease. 

A-354 

Serum levels of matrix metalloproteinases(MMP-2, MMP-9), tissue inhibitors 

of metalloproteinases(TIMP-1, TIMP-2) in type 2 diabetic patients with 

microvascular complications 

H. Erman 1 , R. Gelisgen 2 , Ö. Tabak 3 , H. Uzun 2 . 1 Kafkas university Kafkas 

medical faculty Department of Medical Biochemistry, kars, Turkey, 

2 

Istanbul university Cerrahpasa medical faculty Department of Medical 

Biochemistry, Istanbul, Turkey, 3 Istanbul Education and Research Hospital, 

Internal Medicine Clinic, Istanbul, Turkey 

Conclusion: HbA 1c 

analysis for most commonly occurring hemoglobin variant 

sample types using the HbA 0 

peak fit integration method produced HbA1c results that 

are: (1) within 5% of the NGSP secondary reference laboratory results at 6.5% and 

8.5% A1c based upon regression analysis of patient sample correlation. (2) within 7% 

of reference values at normally occurring levels of heterozygous variant hemoglobins 

(approximately 28% for HbE and 40% for HbD, S, and C) following the CLSI EP- 

7A2 dose response protocol. 

Background:ECM is a dynamic structure that requires constant synthesis and 

degradation by matrix metalloproteinases (MMPs) and this is tightly controlled by 

tissue inhibitors of matrix metalloproteinases (TIMPs). Disturbances of physiological 

balance between MMPs and TIMPs seem to play an important role in the development 

and progression of diabetic microangiopathy. In this study, we aimed to measure the 

plasma levels of MMP-2, MMP-9 an their specific tissue inhibitors TIMP-1 and 

TIMP-2 in type 2 diabetic patients with microvascular complications and without 

complications and patients with early stage nephropathy and in healthy subjects,. 

Methods:We studied 65 patients with type 2 diabetes and 25 healthy subjects as 

control. Type 2 diabetic patients were divided into two groups as with microvascular 

complications (n:40) and without complications (n:25). We formed a subgroup of 

patients with diabetic nephropathy(n:19) from the group of patients with microvascular 

complications. Plasma levels of MMP-2, MMP-9, TIMP-1, TIMP-2 were determined 

using immunoenzymatic assays. 




Results:MMP-2, MMP-9, TIMP-1,TIMP-2 plasma levels were found significantly 

higher in tip 2 diabetic patients(p



aged up to 8 years and 9 years boys). We determined serum levels of LH in basal and 

GnRH-stimulated by Chemiluminescence (Centaur XP) in 846 girls (367 children 

under 8 years) and 129 boys (25 below 9 years), as requested their own doctors. 

Results: Based on retrospective evaluation of the results of these tests, 104 girls aged 

up to 8 years tested positive for precocious puberty and 06 boys with age until 9 years 

also showed puberty levels of LH after stimulation. This study demonstrated that basal 

LH levels above 0.42 mIU / mL in girls showed 54.3% sensitivity, 90.3% specificity 

and 79.6% accuracy for the diagnosis of gonadal axis activation (true puberty) . In 

boys, basal LH levels above 0.69 mIU / mL has 80% sensitivity, 96.3% specificity and 

91.9% accuracy for the diagnosis of true precocious puberty. 

Conclusion: Basal LH levels above 0.42 mIU/mL for girls and 0.69 mIU/mL in 

boys are indicative of activation of the gonadotropic axis and may, in the presence 

of clinical signs (age and Tanner), corroborate to confirm diagnosis and indicate 

the begin of therapy for true precocious puberty, without the need of intravenous 

administration of a GnRH agonist and performing a multiple sample hormone curve. 

A-359 

Role of Transthyretin (TTR) in balancing cell renewal and energy 

metabolism - applying a holistic view. 

T. M. Pettersson 1 , C. Lowbeer 2 . 1 LeanLabMed, Stockholm, Sweden, 2 Aleris 

Medilab, Stockholm, Sweden 

Background - Approach: Transthyretin (previous pre-albumin until 1985) is 

extensively studied and associated with several functions the major two related to 

binding of thyroid pro-hormone thyroxine (T4) and holo- /apo- Retinol Binding 

Protein (RBP4). Null mutated mice indicate TTR redundancy with very limited 

phenotype impact. This overview of observed multiple TTR relationships intends 

re-evaluation of TTR role as to multi-functionality as well as common function in 

metabolism. 

Methods - Summarizing relationships: Four major sites of TTR synthesis are 

considered, that in the liver, plexus choroideus, alpha cells in pancreas and retinal 

pigment epithelium as well as ciliar epithelial cells in the eye. The hormone binding 

in relation to that of the competing binding proteins Albumin, TBG and HDL is reevaluated 

as well as the significance of TTR heterogeneity and dynamics regarding 

tetramer stability and conditions for dissociation into dimers and monomers in vivo. 

Variation in role in relation to compartmentalized functions in combination with 

mechanistic aspects of TTR amyloid formation as well as tissue localization of TTR 

amyloid is recognized. Possible roles of TTR in neuro-transmittor related functions 

(Glu, Gly, monoamines, NO) are included as well as considerations of specific 

metabolic role of the RBP4-vitamin A complex. The relevance of tissue variation 

in Basal Metabolic Rate and oxygen consumption/extraction at rest and activity is 

considered including aspects related to cell proliferation and death. Considerations 

of related plasma membrane transporting functions, pro-hormone activation/ 

deactivation (T4, T3, rT3, T2), intra cellular/nuclear signalling and crosstalk are 

notified. Aspects of TTR evolution are considered as well as comparison of perceived 

TTR role in thyroid hormone metabolism with that of the major binding protein of 

Vitamin D with respect to vitamin/hormone bio-availability and co-operativity of 

signalling ligands at the nuclear level. 

Result and Conclusions: In plasma the free fraction of pro-hormone T4 (FT4) is 

under strong regulation supporting the hypothesis of free hormone bio-availability. 

No lack of TTR is observed in man and the fraction of TTRT4 in plasma is 

under physiological conditions significant and controlled. Acidic pH and plasma 

components in combination dissociate TTR into monomers indicating possible 

interstitial mechanism at acidic pH gradients (6 - 5) regulating FT4 availability 

involving TTRT4. TTR therefore provides regulatory mechanisms of pull system 

design introducing beneficial elasticity in relation to tissue need of thyroid hormone 

in basal/activity induced metabolism and growth promotion but at the risk of amyloid 

formation and thyreotoxic cell death in conditions of oxygen sensitivity and disruptive 

metabolism such as gluco- or lipotoxicity in Type-2-Diabetes. Suggested model 

indicates that TSH and FT4 plasma measurements - presently the in vitro thyroid 

diagnostic standards - may be appropriate in estimating thyroid gland functionality but 

not variation in thyroid hormone effect on peripheral tissues at cellular level. Further 

aspects on multiplicity of TTR functionality are outlined and support integrative role 

of the protein. 

A-360 

Müllerian Inhibiting Substance and Sex Hormone Levels in Attention- 

Deficit/Hyperactivity Disorder 

A. B. Erbagci, C. Gökcen, M. Orkmez, N. Aksoy, A. Karayagmurlu. 

University of Gaziantep, Gaziantep, Turkey 

Background: Testicular Müllerian inhibiting substance (MIS) is involved in the 

regression of the Müllerian ducts in male embryos during the first trimester of 

pregnancy. However, plasma concentration of MIS is continued at high levels until 

puberty. MIS receptor typeII (MISRII), a MIS-dependent signaling pathway in the 

brain inducing neuroserpin expression, and MIS dependent sexual dimorphic behavior 

have been shown in rats. Neuroserpin and MIS are suggested to protect neurons against 

glutamate N-methyl-D-aspartate (NMDA) receptor mediated excitotoxicity in vivo. 

Attention-deficit/hyperactivity disorder (ADHD) is a complex neurodevelopmental 

disorder with a strong gender bias, considering frequency, psychiatric, cognitive, 

and functional impairment, and risk for co morbid major depression favoring boys. 

In addition to dopaminergic and norepinephrinergic pathways excessive glutamate 

stimulation of the prefrontal cortex is suggested to contribute clinical manifestations 

of ADHD. A fairly new drug for ADHD treatment; Atomoxetine also antagonizes 

NMDA receptors. In this study we aimed to investigate possible effect of MIS and 

sex hormone levels in ADHD. 

Methods: Present study included 49 boys with ADHD at the time of first diagnosis 

and 30 healthy age matched boys as the control group (min-max age: 5-9 years). 36 of 

the patient group were re-evaluated after 30 days’ methylphenidate treatment. ADHD 

diagnosis was assessed using the schedule for affective disorders and Schizophrenia 

for school age children. Conners parent and teacher rating scales were assesed at the 

first visit and the 1st month of treatment. AMH levels were analyzed by Beckman 

Coulter ® AMH Gen II ELISA reagents, serum testosterone, estradiol, and albumin 

concentrations were assessed by Abbott reagents and sex hormone binding globulin 

(SHBG) levels by Immulite reagents according to the manufacturers’ instructions. 

Serum samples were concentrated before testosterone and estradiol analyses. 

Results: Patients with ADHD had lower SHBG and estradiol levels (p



Methods: The study was performed in sera from 51 multiple myeloma patients 

with high immunoglobulin levels from 20 control healthy subjects with normal 

immunoglobulin levels. Biochemical measurements were performed with Roche 

Elecsys 2010 immunochemistry apparatus using electrochemiluminescence method. 

Following initial TSH measurements, immunoglobulins were precipitated using PEG 

6000. PEG solution prepared as 20% were mixed with serum samples in a ratio of ½ 

and vortexed. Following centrifuge for 5 min at 10000 g, supernatants were collected 

and used for repeat TSH measurements. Results were multiplied by 2. 

Results: There were statistically significant reductions in measured TSH values 

(repeat) following PEG precipitation in sera from both groups compared to initial 

values; mean serum TSH levels before and after PEG precipitation were 2.20 ± 

1.48 vs. 1.31 ± 0.78 μIU/ml, around 41% (p


Clinical Studies/Outcomes 

A-364 




Evaluation of Critical Laboratory Result Reporting Processes 

J. H. Noguez 1 , R. J. Molinaro 1 , S. E. Melanson 2 , W. J. Lane 2 , C. Schmotzer 3 , 

C. R. Fantz 1 . 1 Emory University, Atlanta, GA, 2 Brigham and Women’s 

Hospital, Boston, MA, 3 Case Western Reserve University and University 

Hospitals Case Medical Center, Cleveland, OH 

Background: The timeliness of reporting critical values is vital to patient safety. 

Laboratories are required by regulatory agencies to communicate critical laboratory 

results to providers; however, the effectiveness and institutional variation of these 

notification practices is not well understood. The objective of this study was to 

evaluate the critical result reporting processes of three academic medical centers of 

similar size and patient complexity. 

Method: We first studied the time difference in the reporting of critical results and noncritical 

results by abstracting the data from each institution’s laboratory information 

system for 3 tests that are run in different sections of the clinical laboratory [chemistry 

(potassium), immunoassay (troponin), hematology (platelets)]. The time from when 

the result was ready on the instrument to its release into the electronic medical record 

was measured. Second, we benchmarked treatment intervention times based on the 

availability of a critical low potassium result by measuring the elapsed time from 

when the critical result was reported to when an order for potassium supplementation 

was placed. 

Results: Critical results were found to be released 3X-20X slower than non-critical 

results. Institutions that documented contact with a provider before releasing a critical 

result into the medical record were found to have results available in the medical 

record 2-3X faster for potassium, 5X faster for troponin, and 2X faster for platelets 

than the institution that did not. In one institution it was found that the median time 

to intervention for a critically low potassium level was 23 minutes for the emergency 

department, 31 minutes for the intensive care units, 14 minutes for the general 

medicine units and 9.5 minutes for the surgical units. 

Conclusions: Our data revealed that in all three medical centers the critical results 

took longer to report in comparison to non-critical results. Furthermore, intervention 

orders were initiated shortly after the result was released, emphasizing that medical 

decisions/interventions are prompted by laboratory alerts. While calling critical results 

is intended to ensure that necessary interventions will not be delayed for the safety of 

the patient, our current reporting practices may actually be delaying their treatment. 

This is this first report to benchmark a relationship between laboratory critical value 

communications and treatment interventions. 

A-365 

Use of urinary Neutrophil Gelatinase-Associated Lipocalin (NGAL) in 

the diagnosis of Acute Kidney Injury (AKI) among stroke patients. Is 

it time to rethink our diagnostic criteria for AKI? 

K. Makris 1 , K. Koniari 2 , E. Gialouri 2 , M. Koursopoulou 1 , L. Spanou 1 , O. 

Glezakou 2 . 1 Clinical Biochemistry Department, KAT General Hospital, 

Kifi ssia, Athens, Greece, Athens, Greece, 2 Internal Medicine Department, 

KAT General Hospital, Kifi ssia, Athens, Greece, Athens, Greece 

Background: Acute kidney injury (AKI) is a common complication following acute 

stroke (AS). However its diagnosis is hampered by the absence of specific biomarkers 

in the currently used diagnostic criteria which are based on serum creatinine (sCrea) 

changes and urinary output. Recently urinary neutrophil gelatinase-associated 

lipocalin (uNGAL) has been proposed as an early biomarker for the detection of 

tubular damage and a recent meta-anlaysis found that urinary levels >150ng/mL are 

indicative of AKI. The utility of uNGAL for the early detection of AKI was evaluated 

in a prospective study of 98 adults with AS. We also studied the effect of AKI on 

mortality and severity of stroke. 

Methods: sCrea and uNGAL were measrued upon admission and at 24, 48 and 72 

hours thereafter, with a final measurement on day-7. Stroke severity was measured 

at the time of admission with the Scandinavian Stroke Scale (SSS). Functional 

outcome was measured with the modified Rankin scale (mRS) on day-7. Patients 

categorized into 3 severity groups according to mRS score: mild (mRS-score 0-2), 

moderate (mRS-score 3-4) and severe (mRS-score 5-6). AKI was defined using the 

AKIN (Acute Kidney Injury Network) criteria (an absolute increase in sCrea above 

baseline of at least 0.3 mg/dL or a percentage increase of at least 50%) plus uNGAL 

levels >150 ng/mL. sCrea was determined with the Jaffe reaction on Architectci8000 

analyzer (Abbott Laboratories, Il.) and uNGAL was measured with an ELISA 

(Bioporto Gentofte, Denmark) 

Results: The mean age (SD) of the patients was 75.2(9.4) years. Forty-two patients 

(42.86%) died during a follow-up period of 1 year. The mean time (SD) between the 

onset of neurological symptoms and hospital admission was 3.22(1.58) hours. AKI 

was diagnosed in 24(24.49%) patients. Using the AKIN criteria we diagnosed 19 cases 

that developed AKI during hospitalization. uNGAL was diagnostic of AKI within 24 

hours from admission (mean increase from 86.69 to 182.06ng/mL, p



Results α-amino-n-butyric acid predicted the therapeutic response to SSRI. This 

result was conserved after the multivariable analysis with clinical factors (p = 0.019; 

odds ratio (OR), 1.12; 95% confidence interval (CI), 1.02-1.23). Arginine (p = 0.039), 

asparagine (p = 0.017), and cysteine (p = 0.039) were differentially expressed between 

pre- and post-treatment specimens of patients with MDD. Especially, glutamic acid 

was showed the significant change between pre- and post-treatment specimens only in 

response group (p = 0.045). In comparison between pre-treatment patients and healthy 

individuals, L-alanine (p = 0.043), β-alanine (p = 0.024), γ-aminobutyric acid (p = 

0.050), β-aminoisobutyric acid (p < 0.001), cystathionine (p < 0.001), glutamic acid 

(p = 0.047), homocysteine (p < 0.001), methionine (p = 0.004), O-phospho-L-serine 

(p < 0.001), and sarcosine (p < 0.001) were differentially expressed. 

Conclusion We identified differentially expressed amino acids, especially relating to 

the glutamic acid and sulfur-containing amino acid pathways, between pre-treatment 

patients with MDD, and either healthy individuals or patients after treatment. Our 

findings also showed the possibility of plasma amino acids as potential predictive 

biomarkers for SSRI response and warrant further validation studies. 

Acknowledgements 

This study was supported by a grant of the Korean Health Technology R&D Project, 

Ministry of Health & Welfare, Republic of Korea (A110339). 

A-367 

Clinical Laboratory Testing Patterns in Kampala, Uganda: Test 

Volumes, Test Menus, and Alignment with Disease Burden 

L. F. Schroeder 1 , A. Elbireer 2 , T. Amukele 3 . 1 Department of Pathology, 

Stanford University School of Medicine, Stanford, CA, 2 Johns Hopkins 

University Clinical Core Laboratory at Infectious Diseases Institute, 

Makerere University, Kampala, Uganda, 3 Department of Pathology, Johns 

Hopkins University School of Medicine, Baltimore, MD 

Background: The most basic information about laboratories in sub-Saharan Africa 

(SSA) such as their number, quality, and testing volumes are unknown. We created 

a practical method for obtaining this information in SSA towns and cities. Here we 

present some results of our initial city-wide survey of clinical laboratories in Kampala, 

Uganda. 

Methods: Kampala city (population 1.7 million) was divided into 5 partiallyoverlapping 

regions. Each region was assigned to 2-3 surveyors who identified and 

surveyed laboratories in their respective regions; in person and on foot. A modified 

version of the WHO/AFRO Laboratory Strengthening Checklist was used to obtain 

baseline measures of quality for all clinical laboratories within Kampala. The checklist 

consisted of 80 ‘yes’/’no’ questions covering all levels of the laboratory process and 

ultimately translated into a 0- to 5-star scale of quality. The surveyors also measured 

other attributes such as test menu and self-reported testing volume. 

Results: A total of 954 laboratories were identified and surveyed in Kampala, with an 

overall daily testing volume of 13134 tests or an average of 14.9 tests per laboratory 

per day. The vast majority of laboratories (n=909) did not meet the lowest quality 

standards defined by the WHO/AFRO-derived laboratory strengthening tool (i.e. they 

achieved zero stars). These 909 zero star laboratories accounted for roughly half of 

daily testing volume. When limiting analysis to the 20% of laboratories accounting 

for 80% of volume, the most commonly offered tests in order of decreasing frequency 

were HIV, syphilis, urinalysis, typhoid, hCG, stool analysis, blood smear, brucellosis, 

glucose, ABORh, malaria, hemoglobin, tuberculosis, CBC, viral hepatitis, and H. 

pylori. 

Conclusions: The active survey method used in this study identified twice as many 

laboratories as were previously registered in the Ministry of Health. Laboratories 

per capita in Kampala are commensurate with levels in the United States (1781 vs 

1337 people per laboratory) with estimated annual testing volumes per capita ~10 

times lower in Kampala (2 vs 22 tests per person per year). However, according to 

World Bank estimates, Uganda spends nearly 200 times less on health care per person 

than does the United States ($46 vs $8362). In this light, the people of Kampala are 

investing relatively heavily in laboratory medicine. The Institute for Health Care 

Metrics estimates that in those over 5 years of age in Eastern Africa, mortality due 

to NCDs (cardiovascular disease, diabetes mellitus, cancer, and chronic respiratory 

disease) is nearly two-thirds that of infectious disease. Aside from glucose testing and 

urinalysis, the tests most often offered focused on infectious disease. 

This comprehensive evaluation of the number, scope, and quality of clinical 

laboratories in Kampala is the first published survey of its kind in sub-Saharan Africa. 

A key finding from this study is that significant laboratory testing is taking place in 

Kampala, but it is possibly misaligned from the burden of disease and is likely of 

low quality. 

A-368 

Magnesium balance in patients with long term Proton Pump 

Inhibitor(PPI) therapy 

S. CHAKRABORTY 1 , C. BHATTACHARYA 2 . 1 

Dept. of 

Biochemistry,PEERLESS HOSPITAL & B K ROY RESEARCH CENTRE, 

KOLKATA, India, 2 Dept. of Medicine,PEERLESS HOSPITAL & B K ROY 

RESEARCH CENTRE, KOLKATA, India 

Background: Proton Pump Inhibitors (Omeprezole, Lansopresole, Rabeprezole, 

Pantoprezole etc.) are a group of very commonly used medications used for gastric 

acid suppression. Globally their use has increased many folds over the last decade. 

Recently the US-FDA has issued a warning regarding the risk of hypomagnesemia 

in patients receiving long term PPI therapy. The risk is even higher in patients with 

concomitant diuretics, patients with diabetes and early CKD. This black box warning 

of USFDA is due to a number of case reports and some case series which have been 

published. It has been suggested that PPI’s cause hypomagnesemia possibly as a 

result of decreased intestinal absorption. Unfortunately till date very few studies have 

been conducted to evaluate the influence of long tern PPI therapy on the magnesium 

homeostasis. Thus this study was conducted with the objective of evaluating the renal 

handling of magnesium in such patients and also to compare the serum magnesium 

levels of such patients with the normal population. 

Methods: The study was designed as a case control study consisting of adult patients 

on long term PPI therapy (more than 1 year) and age and sex matched healthy controls 

not on any medication. Patients on PPI’s with diabetes, chronic kidney disease or 

on diuretics were excluded. Serum Magnesium and Urinary Fractional Excretion 

of magnesium (FE-Mg) were measured using an automated clinical chemistry 

autoanalyser in both these groups. Study was conducted for one year followed by 

statistical analysis of data with GraphPad software. 

Results: The mean(SD) age of the long term PPI group was 47.5(5.9) and 45.9 (6.0) 

in the control population with no statistical difference between the two groups.The 

mean duration of PPI use was 15(2.0)months Among study patients, long term PPI 

users (n = 43,Male 20 Female 23) had a mean(SD) Mg level of 1.80 (0.17) mg/dL, 

and non-users (n = 43,Male 21,Female 22) 2.06 (0.30) mg/dL, p = 0.001. PPI use 

was associated with lower serum Mg levels (95% CI = - 0.30 to - 0.19).The FE-Mg 

of long term PPI users had a mean (SD) of 1.37(0.65) % and the control population 

2.72(0.88), p = 0.001.Among the PPI group, 9 patients (20%) had a serum Mg less 

than the lower limit of our population reference interval (1.7 mg/dl) none of them 

were clinically symptomatic for hypomagnesemia.The serum magnesium levels 

showed a negative correlation with the duration of PPI therapy( r= 0.502 , p 0.01). 

Conclusion: PPI use is associated with slightly lower serum Mg levels than the 

normal population. The FE-Mg of the PPI group is significantly reduced suggesting 

increased renal conservation of magnesium in order to maintain near normal serum 

levels.It seems that if patients with impaired renal handling of Mg (diabetes, CKD or 

those on diuretics) receive long term PPI therapy they might possibly be at a greater 

risk of clinically significant hypomagnesemia. Clinically evident hypomagnesemia 

is possibly the tip of the iceberg below which lies the vast spectrum of subclinical 

hypomagnesemia and thus magnesium levels need to be monitored periodically and 

supplemented if required in patients on long term PPI therapy. 

A-371 

Association of Tumor Necrosis Factor-Alpha (TNFA) Promoter 

Polymorphisms with plasma TNF-α levels and susceptibility to 

Diabetic Nephropathy in North Indian Population 

J. K. GAMBHIR, S. Gupta, O. Kalra, M. Mehndiratta, K. Shukla, S. 

Aggarwal, R. Shukla. University College of Medical Sciences, Delhi, India 

BACKGROUND: The traditional concept of diabetic nephropathy (DN) as a 

metabolic disease is now being replaced by chronic low-grade inflammatory disease. 

Tumor necrosis factor-alpha (TNF-α) is a proinflammatory cytokine which may play 

an important role in the pathogenesis and clinical outcome of DN. Therefore, this work 

was planned to evaluate whether -863C/A (rs1800630) and -1031T/C (rs1799964) 

polymorphisms in TNFA gene are associated with plasma TNF-α levels and diabetic 

nephropathy among Type 2 diabetic subjects from North India. 

METHODS: We screened 100 healthy controls (HC), 100 Type 2 diabetic subjects 

without nephropathy (DM) AND 100 subjects with DN for these polymorphisms using 

the PCR-RFLP methods. Plasma TNF-α levels were measured by ELISA. Analysis 

of variance and logistic regression were used to associate individual polymorphisms 

with plasma TNF-α levels and DN. 


A113



RESULTS: The allelic frequencies of -863C/A were 0.86/0.14 in HC, 0.72/0.23 in 

DM and 0.84/0.16 in DN, and that of -1031T/C were 0.89/0.11 in HC, 0.95/0.05 in 

DM and 0.80/0.20 in DN. The carriers of -863A allele had significantly lower plasma 

TNF-α levels (p 300 

pg/ml, previous partiroidectomy or transplant, treatment with anti-inflammatory 

or immunosuppressant drugs. Twenty-five HD patients (mean age, 62 years; mean 

HD time, 12 months; 56% diabetics) were included in the study. All of them were 

previously treated with intravenous calcitriol, and after a 4-weeks wash-out period, 

oral paricalcitol (1 mcg/day) was administered for 12 weeks. 

Results: Basal values of serum calcium (Ca), phosphorus (P), Ca-P product, and 

iPTH were 9.1 mg/dl, 4.8 mg/dl, 44.2 mg 2 /dl 2 and 317 pg/ml, respectively. At the 

end of the study, these parameters did not change, except for iPTH, which decreased 

significantly to 302 pg/ml (p



A-375 

Bone Specific Alkaline Phosphatase and Cardiovascular Morbidity 

among Patients on Maintenance Hemodialysis 


Cairo, Egypt 

Background: Vascular calcification is common in individuals with chronic kidney 

disease (CKD) and significantly correlated to the high cardiovascular death risk. In 

advanced CKD, stages 3 through 5, secondary hyperparathyroidism (SHPT), along 

with renal osteodystrophy, are common and may be associated with abnormal mineral 

metabolism and / or abnormal serum or tissue mineral levels, vascular calcification, and 

poor survival, especially among those who undergo maintenance dialysis treatment. 

Serum alkaline phosphatase (ALP) is a biochemical marker of bone turnover and is 

used to monitor metabolic bone disease associated with renal insufficiency. Higher 

levels of serum ALP were associated with vascular calcification in hemodialysis 

patients MHD. Bone-specific ALP is a byproduct of osteoblasts and is a more specific 

measure of bone formation as well as bone turnover and is increased in MHD patients, 

probably as a result of high turnover bone disease. Atherosclerosis, in addition to 

being a disease of lipid accumulation, also represents a chronic inflammatory process. 

Inflammatory markers such as high-sensitivity C-reactive protein (hsCRP) may 

provide an adjunctive method for global assessment of cardiovascular risk. 

Objectives of this work: 

1. Estimate the clinical utility of serum biomarkers of bone metabolism like ALP, 

bALP, intact parathyroid hormone, calcium, and phosphorus as potential markers and 

indicators in diagnosis of renal osteodystrophy in MHD patients aiming to improve 

their clinical outcomes. 

2. Evaluate the association between renal osteodystrophy and progression of vascular 

calcification detected by echocardiography and carotid Duplex in MHD patients. 

3. Testing the role of CRP and hsCRP in mediating the increased cardiovascular risk 

in MHD patients. 

Patients and methods: Seventy MHD patients and 15 healthy volunteers were 

enrolled in the study. All patients and controls were subjected to echocardiography, 

carotid duplex and predialysis blood sampling for estimation of routine blood 

chemistry (Calcium, Phosphorus, urea, creatinine, glucose, albumin, ALT, AST, ALP, 

cholesterol, triglyceride, HDLc ) using autoanalyzer, intact parathormone 

(iPTH) and hsCRP by a solid-phase chemiluminescent enzyme-labeled immunometric 

assay. Bone specific alkaline phosphatase (bALP) was measured by using a 

radioimmunometric assay. 

Results: Plasma levels of ALP, bALP, iPTH, CRP, hs-CRP, urea, creatinine, glucose, 

phosphorus, were significantly higher in MHD group compared to control group. 

Statistical analysis revealed highly significance statistical difference in EDD, ESD, 

EF, IVS, PWT, IMT in MHD group compared to the control group. Mitral valve 

calcification was found in 27.4% and aortic valve calcification was found in 71.4% 

of hemodialyzed patients. B-ALP sensitivity, specificity and positive predictive value 

of the test at a cut off > 10 IU/L were found to be 89%, 67% and 79% respectively. 

Conclusion: The results of this study demonstrate that plasma bALP can be measured 

with a reliable immunoassay in hemodialysis patients. It represents a highly sensitive 

and specific biochemical marker of skeletal remodeling in these patients, even 

better when associated with plasma iPTH levels. Abnormal mineral metabolism and 

inflammation are pivotal factors for the increased cardiovascular risk in CKD patients. 

A-376 

Albumin-to-creatinine Ratio in Early-morning Urine versus 24 hour 

Urine Albumin in Kidney Transplant Patients. 

I. López-Pelayo, A. Sáez Benito-Godino, J. Gutiérrez-Romero, M. Calero- 

Ruiz, M. Samper-Toscano, J. Vergara-Chozas, M. Bailén-García. Hospital 

Puerta del Mar, Cádiz, Spain 

Background: it is generally accepted that the best measure of albuminuria is that 

based on a 24h urine collection, but the variability of results obtained make this view 

questionable. The objective of this study was to determine if albumin-to-creatinine 

ratio (ACR) in early-morning urine (EMU) is interchangeable with 24h albuminuria 

(Alb24h) in kidney transplant patients at various cut-offs. 

Methods: we included 170 kidney transplant patients controlled at the Nephrology 

Department, with EMU and 24h urine samples. We measured ACR and 24h albumin 

on Cobas 6000 (Roche Diagnostics). Patients transplanted the previous six months 

or with diuresis less than 500 ml were excluded. Statistical analyses: Spearman´s 

rank correlation and Passing-Bablock regression test for different cut-offs (30, 300 

and 700 mg/24h). The ability of ACR to predict abnormal Alb24h at these cut-offs 

was determined from Receiver Operator Characteristic (ROC) curve analysis and 

calculating sensitivities, specificities and likelihood ratios (LR). 

Results: for cut-offs of 30, 300 and 700 mg/dl, the Spearman´s coefficients were 

0.668; 0.709 and 0.889 respectively (p300 mg/24h) and Y=-276.8+0.94*X 

(Cut-off>700 mg/24h). 95%Confidence Interval were (-273.4 to -17.6), (0.763 to 

1.044) and (-795.3 to 58.1), (0.735 to 1.323) respectively. ROC curve analysis was 

described in table 1. 

Conclusion: this study shows a good correlation between both samples. ACR 

underestimates Alb24h and is progressively greater as the degree of albuminuria 

increased. Linear regression allows estimating Alb24h from ACR for concentrations 

higher than 300 mg/24h, with two different equations depending on the cut-off 

considered. We could use the same cut-offs for ACR than for Alb24h to facilitate 

clinical purpose. We finally conclude that we can not use EMU to predict albumin 

excretion in the range of major clinical interest. 

A-377 

High Serum Creatinine Variability Prior to Intravenous Contrast 

Medium Administration May Confound a Diagnosis of Contrast- 

Induced Nephropathy 

J. S. McDonald, R. J. McDonald, E. E. Williamson, D. F. Kallmes. Mayo 

Clinic, Rochester, MN 

Background: Administration of iodinated contrast media has been associated with the 

development of acute kidney injury (AKI), termed “contrast-induced nephropathy”, 

however contrast-independent sources of AKI can confound a diagnosis of contrastinduced 

nephropathy. We sought to determine the effect of serum creatinine (SCr) 

variability prior to contrast exposure on the incidence of AKI. 

Methods: All contrast-enhanced and unenhanced abdominal, pelvic, and thoracic CT 

scans performed at our institution between 2000-2010 were identified. Patients were 

stratified by baseline SCr into < 1.5 mg/dL, 1.5 - 2.0 mg/dL, and > 2.0 mg/dL mg/dL 

subgroups. Patients with high pre-scan SCr variability (delta > 0.5 mg/dL in the 7 days 

prior to scan) were identified and subdivided into increasing SCr or decreasing SCr 

subgroups. The effect of pre-scan SCr on the incidence of post-scan AKI (SCr ≥ 0.5 

mg/dL over baseline in the 1-3 days post-scan) was assessed using Fisher’s Exact test. 

Results: A total of 49,421 scans performed on 29,422 patients met inclusion criteria, 

of which 10,677 (22%) had high pre-scan SCr variability. Incidence of high SCr 

variability increased with increasing baseline SCr (11% for baseline < 1.5 mg/dL, 

42% for baseline 1.5-2.0 mg/dL, 75% for baseline > 2.0 mg/dL). Of the 4370 patients 

who developed AKI, 2417 (55%) had high pre-scan SCr variability. Patients who 

developed post-scan AKI were more than four times likely to have high pre-scan SCr 

variability compared to patients who did not develop AKI (23% versus 5%, OR= 5.51 

(95% CI 5.17-5.88), p



A-378 

Procalcitonin as a Biomarker of Bacterial Infection in Acute Liver 

Failure 

J. A. Balko 1 , L. S. Hynan 1 , N. Attar 1 , C. Sanders 1 , W. J. Korzun 2 , W. M. Lee 1 . 

1 

UT Southwestern Medical Center, Dallas, TX, 2 Virginia Commonweatlh 

University, Richmond, VA 

Background: Because acute liver failure (ALF) patients share many clinical features 

with severe sepsis and septic shock, identifying bacterial infection in ALF is difficult. 

Procalcitonin (PCT) is a precursor form of calcitonin normally produced in the 

parafollicular C cells of the thyroid gland. In bacterial infection or sepsis, PCT is 

produced by other cell types; elevated levels of PCT are useful in detecting bacterial 

infection. We examined PCT as a biomarker of bacterial infections in patients with 

ALF. 

Methods: We classified 1863 patients enrolled in the US ALF Study based on the 

patient’s severity of disease by standard definitions of systemic inflammatory 

response syndrome (SIRS), severe sepsis, and septic shock. We randomly selected 

115 patients: without SIRS (n = 30); SIRS (n = 29); severe sepsis (n = 40); and septic 

shock (n = 16). Twenty subjects with chronic liver disease (primary biliary cirrhosis 

or viral hepatitis, CLD) were randomly chosen from UT Southwestern Liver Disease 

Data /Sample repositories and classified as not infected. The area under the receiveroperator 

characteristic curve (AUROC) was determined after separating PCT values 

by the absence (n = 79) or presence (n = 56) of documented bacterial infection. Sera 

were tested for PCT using the Siemens ADVIA Centaur BRAHMS PCT assay, a 

sandwich, chemiluminescent immunoassay. PCT values 2.00 are indicative of 

severe sepsis (consistent with bacterial infection). 

Results: All ALF median PCT values were near or above the 2.0 ng/mL cut-off, with 

a trend but no significant difference between groups (p = 0.169): without SIRS - 1.57 

ng/mL, SIRS - 2.29 ng/mL, severe sepsis - 2.51 ng/mL, and septic shock - 5.89 ng/mL. 

When CLD (control, no infection) subjects were compared to the ALF groups, there 

was a significant difference (p =



and Total Thyroxine) exceeded the proposed goal at one decision level. Instrument 

consistency results of Thyroid Stimulating Hormone and Total Thyroxine exceeded 

the desirable goals at two decision levels, while Follicle Stimulating Hormone, 

Prolactin and Vitamin B12 exceeded the proposed goal at one decision level. 

Conclusions: New techniques for setting analytical performance goals have been 

proposed. This investigation indicated that Beckman Coulter, DxI 800 immunoassay 

system meets most of these resultant goals. 

A-381 

Comparison of maternal and umbilical cord blood soluble lectin-like 

oxidized low density lipoprotein receptor 1 levels and the frequency 

of the two gene polymorphisms in early- and late-onset preeclampsia 

A. Tüten 1 , H. Erman 2 , B. Aydemir 3 , G. Guntas Korkmaz 4 , A. Kiziler 5 , V. 

Sözer 6 , R. Gelişgen 7 , M. Albayrak 8 , S. Acıkgoz 1 , G. Simsek 9 , G. Simsek 9 , H. 

Uzun 10 . 1 Departments of Obstetrics and Gynecology, Istanbul University, 

Cerrahpasa Medical Faculty, Istanbul, Turkey., Istanbul, Turkey, 

2 

Department of Biochemistry ,Istanbul University, Cerrahpasa Medical 

Faculty, Istanbul, Turkey, Istanbul, Turkey, 3 Department of Biophysics, 

Medical Faculty, Sakarya University, Sakarya, Turkey, 4 

Kırklareli 

University, School of Health, Kırklareli, Turkey, Kırklareli, Turkey, 

5 

Department of Biophysics, Medical Faculty, Namık Kemal University, 

Tekirdag, Turkey, Tekirdag, Turkey, 6 Department of Biochemistry, Yildiz 

Technical University, Istanbul, Turkey, Istanbul, Turkey, 7 Departments of 

Biochemistry, Istanbul University, Cerrahpasa Medical Faculty, Istanbul, 

Turkey., Istanbul, Turkey, 8 Department of Obstetrics and Gynecology, 

Duzce University School of Medicine, Duzce, Turkey, Duzce, Turkey, 

9 

Departments of Physiology, Istanbul University, Cerrahpasa Medical 

Faculty, Istanbul, Turkey., Istanbul, Turkey, 10 Department of Biochemistry, 

Istanbul University, Cerrahpasa Medical Faculty, Istanbul, Turkey, 

Istanbul, Turkey 

Background: The main purpose of this study was to determine the maternal and 

umblical cord blood soluble lectin-like oxidized low-density lipoprotein receptor 1 

(sLOX-1) and oxidized LDL (oxLDL) levels in early and late-onset preeclampsia. 

Additionally, we aimed to investigate whether LOX-1 3’UTR188CT and LOX-1 

K167N polymorphysms could effect the development of preeclampsia in Turkish 

population. 

Methods: A population based case-control study was conducted in pregnant women 

with early- (24-32 weeks’ gestation; n=19) and late-onset (35-42 weeks’ gestation; 

n=22) preeclampsia compared to gestational age-matched healthy normotensive 

pregnant women (n=44). Groups were compared for the maternal and umblical cord 

serum soluble sLOX-1 and plasma oxidized LDL (oxLDL) levels. Additionally, 

the frequency of the two LOX-1 gen polymorphysms, 3’UTR188CT and K167N, 

determined by PCR-RFLP technique were compared between 113 preeclamptic and 

96 uncomplicated pregnant women. 

Results: The mean maternal and umblical cord serum sLOX-1 and plasma oxLDL 

levels were significantly increased in early- and late-onset preeclampsia compared to 

control pregnant women (p10 5 cfu/mL. The 

Sysmex UF-1000i demonstrated increased SP over urine Gram stain, and would allow 

for a 55% reduction in urine cultures. 

A-387 

Appropriate Hb A1c testing frequency is not associated with proper 

treatment changes. 

J. Noguez, R. Molinaro. Emory University, Atlanta, GA 

Background: It is recommended that Hb A 1c 

testing be performed at least twice per 

year on patients who are meeting treatment goals and demonstrate stable glycemic 

control. For those who have had treatment changes or are not meeting glycemic 

goals, quarterly testing is suggested. While Hb A 1c 

utilization and adherence to 

testing frequency recommendations is important, so is the adjustment of treatment 

when changes in Hb A 1c 

are considered significant. The objective of this study was to 

assess clinician practice by monitoring Hb A 1c 

testing and medical chart review with 

clinician survey. 

Methods: Using retrospective data analysis, we determined whether recommendations 

are followed for Hb A 1c 

testing frequency, and in those cases, whether appropriate 

treatment changes are made based on calculated Hb A 1c 

reference change values. 

Hb A 1c 

values (n=32,112) over a one-year period were extracted from the laboratory 

information system and the data filtered to include only patients who were tested at 

least twice within the time frame of our study. This data (n=4,380) was partitioned 

into patients that were tested at the recommended frequency and those that were not. 

Patients tested at the recommended frequency were further partitioned into those who 

demonstrated glycemic control (HbA 1c 



This study revealed that



middle frontal gyrus and the verbal fluency scores (r = -0.377, p = 0.028), the positive 

correlation of FA discrepancy in left extra-nuclear with MMSE scores were also 

identified (r = 0.382, p = 0.026) in CC genotype group. 

Conclusion: Nondemented healthy carriers of the CLU gene risk variant showed 

complex FA discrepancy when compared with T allele carriers, some of which related 

with cognitive measures. These changes can be considered as abnormal imaging 

phenotypes for the risk genetic type. 

A-392 

Elevated ET-1/NO and TXA2/PGI2 in cirrhosis patients with ascites 

and type 1 hepatorenal syndrome 

N. Xin, H. Yong, W. Bin, H. Hualan, M. Qiang, S. Haolan, L. Tongxing, 

G. Baoxiu, H. Jun, L. Guixing. Department of Laboratory Medicine, West 

China Hospital, Sichuan University, chengdu, China 

Background: Hepatorenal syndrome (HRS) is a severe complication of End Stage 

Liver Disease (ESLD) but the pathogenetic mechanism of it is still elusive at present. 

Recent studies indicate that severe renal vasoconstriction is associated with the 

development of HRS. The aim of this study is to investigate the mechanisms of renal 

vasoconstriction in HRS by exploring serum levels of endothelin-1(ET-1), nitric oxide 

(NO), thromboxane A 2 

(TXA 2 

) and prostacyclin I 2 

(PGI 2 

), which have antagonistic 

vasoactive effect on kidney, in cirrhosis patients with ascites and type 1 hepatorenal 

syndrome. 

Methods: Between January 2009 and May 2011, 38 cirrhosis inpatients with ascites 

and type 1 HRS (HRS group) and 41 cirrhosis inpatients with ascites but normal 

renal function (Non-HRS group) in our hospital were enrolled in this study. Clinical 

characteristics of the subjects were recorded and serum samples of the two groups 

were obtained for laboratory analysis of ET-1, NO and stable metabolites of TXA 2 

and 

PGI 2 

, TXB 2 

and 6-keto-PGF 1α 

. 

Results: No significant difference (P>0.05) was found in age, gender, etiology and 

severity of the underlying liver disease between the two groups. However, the patients 

of HRS group had higher systemic inflammatory response syndrome (SIRS) score 

than the non-HRS group (P0.05). Serum TNF-α, TNFR1 and TNFR2 levels on day 7 and month 

1 were also significantly higher AR (+) group compared to AR (-) (p=0.012, p=0.049 

for TNF-α, p=0.001, p=0.002 for TNFR1, p=0.001, p=0.002 for TNFR2). 

Conclusion: Furthermore, our preliminary findings suggest that serum TNF-α, TNFR 

I and TNFR 2 levels might be considered useful markers of predicting graft function 

after renal transplantation. The sequential monitoring of these parameters may 

identify the patients at the risk in the early period post-transplant. Prospective studies 

are needed to clarify the usefulness of these parameters for identifying risks of AR. 

A-394 

Risk stratification with Adrenomedullin in emergency patients with 

acute dyspnea 

J. Searle, A. C. Slagman, C. Müller, D. Meyer zum Büschenfelde, 

J. von Recum, J. O. Vollert, M. Stockburger, M. Möckel. Charité - 

Universitätsmedizin Berlin, Berlin, Germany 

Background: Acute dyspnea can be caused by severe cardiac and non-cardiac 

diagnoses and is associated with high in-hospital mortality. Adrenomedullin is a 

peptide hormone with hypotensive, natriuretic and positive inotropic effects, and is 

released upon increased cardiac pressure- and volume load. The objective of this 

analysis is to evaluate MR-proADM as a marker for short-term risk-stratification in 

patients with acute dyspnea. 

Methods: Consecutive, adult patients with dyspnea (n=305) were enrolled in the 

ED, patients with anemia were excluded. Blood samples were drawn at admission. 

Outcome was assessed after 3 months. MR-proADM was measured from frozen 

samples at the end of recruitment. 

Results: Patients had a median age of 67 (58-74) years, 63.4% were male. AHF was 

the most frequent underlying diagnosis (15.7%), 13.8% were diagnosed with COPD 

or Asthma, 7.5% with pneumonia. Median ADM was 0.9 (0.63-1.43) nmol/L. Patients 

with acute and chronic heart failure had the highest ADM values (1.54 (1.03-2.47) and 

(1.52 (1.28-2.20) nmol/L, respectively). 

After 3 months, 6.6% (n=20) of the patients had died. Non-survivors had significantly 

higher ADM values (1.52 / 0.84-2.6 nmol/L) than survivors (p



A-395 

Levels of apelin-13 and total oxidant / antioxidant status in sera of 

Alzheimer patients 

Z. DENİZ YILDIZ, N. -. EREN, F. GOKYIGIT, F. TURGAY, L. 

GUNDOGDU CELEBİ. şişli etfal trainig and research hospital, İstanbul, 

Turkey 

Objective: In this study, serum levels of Apelin-13, a cytokine derived from 

adipocytes and a potential diagnostic biomarker for AD, and its relationship with TAS 

and TOS due to its anti-ROS properties were investigated. 

Materials anD Methods: The study included 31 patients diagnosed with AD (13 

male/18 female) and 30 individuals (9 male/21 female) as a control group of healthy 

subjects without dementia. The control group included healthy volunteers who had 

similar demographic characteristics with patients. The mean age of patients and control 

group were 72.73 ± 6.17, 75.54 ± 5.27 years, respectively. Apelin-13 measurement 

process has been completed in SEAC RADIM Company ALISEI analyser by using 

Bachem Human Apelin 13 (Cat No. S-1416) ELISA Kit. TAS and TOS measurements 

have been completed by using full-automated colorimetric method developed by Erel 

(Rel Assay Diagnostics, Turkey). 

Results: In our study, a statistically significant difference was not found between the 

patients and the control group for the TOS levels (p> 0.05). TAS measurements of 

the patient group were significantly lower than that of the control group (p



with existing ELISA method. Cut-off point differentiation (20 CU for BIO-FASH 

analyzer or ELISA Units for QUANTA-Lyser) between Positive/ Negative samples 

remain unchanged between both methods. Semi-Quant reportable numbers with 

respect to cut-off agreed well within the negative samples, but not well with positive 

samples. Overall, the automation and simplification of the assay makes it ideal for non 

specialized staff and high throughput. 

A-399 

Clinical and Analytical Evaluation of the ARCHITECT HAVAB-G 

Assay 

D. T. Shaar 1 , P. Moreno 1 , S. Du 1 , J. Huang 1 , J. Yen 1 , D. Brotherton 1 , S. 

Worobec 1 , P. Schwebel 1 , W. Castellani 2 , M. Petruso 3 , M. E. Boyle 4 . 1 Abbott 

Diagnostics, Abbott Park, IL, 2 MS Hershey Medical Center, Hershey, PA, 

3 

Nationwide Laboratory Services, Fort Lauderdale, FL, 4 University of 

Colorado Hospital, Aurora, CO 

Objective: To evaluate the performance of the ARCHITECT ® HAVAB-G assay in a 

diagnostic population. 

Method: ARCHITECT HAVAB-G is a chemiluminescent microparticle immunoassay 

for the qualitative detection of IgG antibody to hepatitis A virus (IgG anti-HAV). 

A 5-day system reproducibility study was performed based on guidance from the 

Clinical and Laboratory Standards Institute (CLSI) document EP15-A2. For method 

comparison, ARCHITECT HAVAB-G results were compared to the final HAV IgG 

status, which was determined with AxSYM HAVAB 2.0 (total HAV assay) and 

ARCHITECT HAVAB-M (HAV IgM assay). Percent agreement of positive results 

(positive percent agreement or PPA) and percent agreement of negative results 

(negative percent agreement or NPA) were calculated for the following populations: 

a) individuals at increased risk of HAV infection and individuals with signs and 

symptoms of hepatitis infection, b) apparently healthy individuals, c) Hepatitis A 

vaccine recipients, and d) surplus pediatric specimens. 

Results: The ARCHITECT HAVAB-G assay demonstrated a %CV range of 4.3-4.9 

for within-laboratory imprecision at clinically relevant analyte levels. In the method 

comparison study, the positive percent agreement (PPA) was as follows: individuals at 

increased risk of HAV infection and individuals with signs and symptoms of hepatitis 

infection 95.30% (385/404), apparently healthy individuals 98.69% (151/153), 

Hepatitis A vaccine recipients 100.00% (68/68), and surplus pediatric specimens 

97.62% (82/84). The negative percent agreement (NPA) was as follows: individuals at 

increased risk of HAV infection and individuals with signs and symptoms of hepatitis 

infection 97.84% (363/371) apparently healthy individuals 99.18% (364/367), 

Hepatitis A vaccine recipients 100.00% (2/2), and surplus pediatric specimens 97.81% 

(223/228). 

Conclusion: The ARCHITECT HAVAB-G assay provides detection of IgG antibody 

to Hepatitis A virus. The presence of IgG anti-HAV implies a past HAV infection 

(recent or distant) or vaccination against HAV. Detectable levels above the assay cutoff 

imply immunity to HAV infection. 

A-400 

Multimarker Logistic Regression Models Predict Sepsis Prior to Onset 

of Overt Clinical Symptoms 

J. M. Colón-Franco, D. A. Anderson, S. Litt, S. Srinivasa Gowda, T. W. 

Rice, A. P. Wheeler, W. D. Dupont, A. Woodworth. Vanderbilt University 

Medical Center, Nashville, TN 

Background: Sepsis is a life-threatening condition characterized by systemic 

inflammatory response syndrome (SIRS) along with a documented infection. Rapid 

diagnosis and early initiation of therapy significantly reduces mortality, but diagnosis 

during early stages of disease is difficult because many clinical conditions present 

with SIRS. No single biochemical or clinical marker can accurately identify early 

sepsis among patients with SIRS. 

Objective: To develop prediction models able to identify sepsis up to two days before 

overt clinical presentation of SIRS in Medical Intensive Care Unit (MICU) patients 

and to compare their diagnostic utilities to the only FDA approved sepsis biomarker, 

procalcitonin (PCT) 

Methods: This retrospective cohort study enrolled 201 MICU patients with SIRS who 

were identified by an electronic system that scans electronic medical records (EMRs) 

and alerts when patients meet ≥2 SIRS criteria (temperature >38°C or 90 beats/min, respiratory rate >20 breaths/min and white cell count >12x10 9 or 



A-404 

Enhanced Liver Fibrosis (ELF) Panel as a Predictor of Liver Fibrosis 

in Chronic Hepatitis C Patients 

F. Fernandes 1 , A. Dellavance 2 , L. E. Andrade 2 , F. Campos 1 , G. H. Pereira 3 , 

C. Terra 1 , J. Pereira 3 , F. Figueiredo 1 , R. Perez 1 , M. L. Ferraz 2 . 1 Hospital 

Universitário Pedro Enesto - UERJ, Rio de Janeiro, Brazil, 2 Fleury 

Laboratory, São Paulo, Brazil, 3 Hospital Federal de Bonsucesso, Rio de 

Janeiro, Brazil 

A-403 

The clinical Laboratory can demonstrate value by leveraging 

technology to reduce Hospital Acquired Infections (HAIs) 

D. L. Uettwiller-Geiger. John T. Mather Memorial Hospital, Port Jefferson, 

NY 

Background: Hospital acquired infections (HAIs) are a major cause of morbidity, 

mortality, increased length of stay and excessive healthcare costs. The federal Centers 

for Disease Control and Prevention (CDC) estimates that, each year there are 1.7 

million HAIs, causing about 100,000 deaths annually. 

Objectives: To implement a rapid testing program to cost effectively detect Methicillin 

Resistant Staphylococcus Aureus (MRSA) and Clostridium difficile (C. difficile) in 

colonized and/or infected patients using new technologies. The availability of rapid 

testing on demand and in real time provides clinicians with key test results within 

one hour instead of days. An effective infection control program along with strong 

laboratory support will reduce the number of HAIs and the associated morbidity and 

mortality. 

Methods: A program for MRSA was implemented in March 2008 using rapid 

polymerase chain reaction (PCR) on the Cepheid GeneXpert® System. The system 

uses a single test cartridge delivering test results in less than an hour. In May 2010, the 

C. difficile program was implemented using the C. DIFF Quik Chek Complete from 

Alere, manufactured by TechLab Inc. The technology uses antibodies to identify and 

confirm the presence of toxigenic C. difficile by detecting toxins A and B in a single 

assay device and glutamate dehydrogenase (GDH) antigen, delivering test results in 

< 45 minutes. 

Results: Our testing strategy for MRSA focused on high risk populations of 

intensive care units, cardiac care unit, and Orthopedics. In 2007, before rapid PCR 

MRSA screening, the infection rate was .90/1000 discharges and five years after 

implementation of the rapid PCR MRSA screening program the infection rate in 

2012 was .23/1000. Comparing MRSA infection rates from 2007 to 2012 there was a 

76% reduction with a corresponding 76% reduction in associated infection costs. The 

five year PCR screening cost was $448,400. Based on the average cost of medical 

care for a MRSA infection of $35,000 dollars per infected patient, we decreased the 

cost of infection by $1,511,600 during the five year period and the length of stay 

for the critical care units decreased by 21%. In 2009, the C. difficile infection rate 

was .95/1000 and three years after implementation of the simultaneous testing the 

infection rate in 2012 was .34/1000. Comparing C. difficile infection rates from 2009 

to 2012 there was a 63% reduction with a corresponding 63% reduction in associated 

infection costs. The three year C. difficile testing cost was $86,460. Based on the 

average cost of medical care for a C. difficile infection of $35,000 dollars per infected 

patient, we decreased the cost of infection by $1,453,540 during this three year period. 

Total cost avoidance/savings due to the decrease in MRSA and C. difficile infections 

was $2,965,140. 

Conclusions: Our Laboratory’s rapid testing programs for MRSA and C.difficile using 

new technologies demonstrate the Laboratory’s value by supporting our infection 

control measures and strategies that permit rapid identification and interventions that 

assure patient safety, improve bed management, decrease length of stay, and saves 

millions of dollars, while enhancing patient outcomes and significantly reducing 

hospital acquired infections. 

Relevance: Fibrosis is the most important issue in the assessment of chronic 

hepatitis C (CHC), with treatment and prognostic relevance. Liver biopsy remains 

the gold standard for staging fibrosis, despite its many drawbacks. In recent years 

much has been researched in the field of non-invasive serological markers of liver 

fibrosis. Among these one of the most promising is ELF panel which comprises 

hyaluronic acid (HA), tissue inhibitor of matrix metalloproteinases-1 (TIMP-1) and 

aminoterminal propeptide of procollagen type III (PIIINP). To date, there is scarce 

data on ELF performance as a non-invasive marker of fibrosis in patients with CHC. 

Objective: To evaluate the performance of ELF as a non-invasive marker of fibrosis 

in CHC patients. 

Material and Methods: A hundred and twenty patients with CHC that were 

consecutively submitted to liver biopsy were included. Exclusion criteria: human 

immunodeficiency virus and hepatitis B co-infection, daily alcohol intake of more 

than 40g, cholestasis, chronic kidney failure, right-sided heart failure, fibrogenic 

drugs use, less than six portal tracts or concomitant pathology in the liver biopsy. The 

blood sample was collected within an interval of at most 3 months from the biopsy. 

The serum was frozen at - 70° C in an interval no longer than 3 hours. PIIINP, HA, and 

TIMP-1 were measured in all patients by a CE-marked, random-access, automated 

clinical immunoassay system that uses magnetic particle separation technology with 

direct chemiluminescence (ADVIA Centaur®, Siemens Healthcare Diagnostics, 

Tarrytown, NY, USA). The ELF score was calculated using the algorithm: ELF 

= 2.278 + 0.851 ln(HA) + 0.751 ln(PIIINP) + 0.394 ln(TIMP-1). Cut-off points 

proposed by the manufacturer were applied: < 7.7 absent or mild fibrosis, ≥ 7.7 and 

< 9.8 moderate fibrosis and ≥ 9.8 severe fibrosis. Biopsies were reviewed by one 

experienced pathologist. The study was approved by the local Ethics Committee. 

Statistical analyses were performed using SPSS 17.0 (SPSS Inc., Chicago IL). 

Results: Thirty-four percent of the patients were men, mean age 53 (SD ± 11.3) years 

old. The distribution of fibrosis stages according to METAVIR was: stage 0 - 2%; 

stage 1 - 52%; stage 2 - 30%; stage 3 - 9% and stage 4 - 7% . According to ELF 

cut-off points we had: three (2%) patients with absent or mild fibrosis (F0-1), seventyfour 

(61%) with moderate fibrosis (F2-3) and forty-four (37%) with cirrhosis (F4). 

When compared to histological analysis ELF overestimated fibrosis in 76% of cases 

and underestimated in one case. The Spearman correlation coefficient of ELF with 

the histological staging was 0.57 (p



Objective: to perform a full analytical validation, including cut-off establishment, 

precision, accuracy and method comparison was performed on the NOVA View 

instrument with NOVA Lite® HEp-2 ANA kit with DAPI reagents for the detection of 

ANA before implementing it in the routine use at DASA lab. 

Methods: The cutoff light intensity unit (LIU) was determined on 120 control 

samples. Accuracy was assessed by comparison study on 236 consecutive samples 

sent to the lab for ANA screening. Positive/negative and pattern agreements were 

evaluated between manual (i.e. direct fluoresent microscopic) reading and digital 

image reading. Within-run and between run precision was determined on 43 samples 

tested in 5 consecutive runs, and on 4 samples tested in 5 replicates, respectively. 

Results: The cutoff was established at 56 LIU, providing 91.6% positive/negative 

agreement between results generated based on LIU and those obtained by reading the 

images on the monitor. In the method comparison study, positive/negative agreement 

between manual reading and digital image reading was 91.3%. Agreement between 

ANA patterns of positive samples was 98.4%. In the between-run precision study the 

43 samples were processed and analyzed by NOVA View on five consecutive days, 

and the agreement between the results was assessed in pair-wise comparisons. For the 

16 samples that were around the cutoff (112 LIU), it was 96.0-100%. Moreover, LIU values showed excellent 

correlation between the runs (R 2 : 0.885-0.964). Four samples (three positive and one 

negative) were run in five replicates on the same slides to assess within-run precision. 

Results obtained on replicate wells were compared to each other. All replicates of the 

same samples showed identical results (negative or positive, respectively, and same 

pattern) that were also identical to the target results. 

Conclusion: The technical difficulties of processing and reading IIF slides (manual 

reading, need for experienced, trained technologists and dark room) make IIF methods 

difficult to fit in the workflow of modern, automated laboratories. NOVA View 

streamlines and automates the process, eliminates the need for a dark room, separates 

image acquisition from interpretation, and stores the images for future reference. Our 

results demonstrated very good agreement between manual reading and digital image 

reading of ANA slides with excellent repeatability and reproducibility, proving that 

NOVA View is a suitable tool for IIF ANA screening. 

A-408 

Frequency of cytogenetic abnormalities in 126 patients with suspected 

of Turner Syndrome 

E. M. Vicente, L. Caputo, R. Kuhbauche, A. Cobacho, O. Denardin, N. 

Gaburo. DASA, Sao Paulo, Brazil 

Background: The Turner Syndrome (TS) was first described by Otto Ullrich in 

1930, followed by Henry Turner in 1938. The syndrome has an estimated frequency 

of 1:2,130 live births and presents clinically evident lymphedema of hands and feet 

in the neonatal period, short stature, hypoplastic nails, short metacarpals, gonadal 

dysgenesis, leading to delayed pubertal development, primary amenorrhea and 

infertility, and other dysmorphic signs. The variability of clinical manifestations 

hampers clinical diagnosis of TS. Only in 1959, Ford and colleagues described a 

chromosomal abnormality (45,X karyotype) relating to some phenotypic features 

of syndrome. Currently it is considered that the definitive diagnosis of TS ought 

to be made by cytogenetic analysis. The karyotypes findings in TS are monosomy, 

mosaicism with or without structural changes on the X chromosome and mosaicism 

with the presence of the Y chromosome. The karyotype may detect deletions of the 

short arm of the X chromosome (Xp11.2-p22.1) and deletions of the long arm of 

the X chromosome (Xq13-q14); the short stature is associated with deletions of 

Xp with ovarian dysgenesis and amenorrhea with Xq deletion. The Y chromosome 

in suspected TS requires special attention because of the possibility of developing 

gonadoblastoma or dysgerminoma by patients. 

Objective: Establish the frequency of chromosomal abnormalities in a Brazilian TS 

patient group and verify if the karyotypes findings are consistent with the literature. 

Methods: Revision of chromosomal abnormalities found in 126 patients with 

clinically suspected TS from January 2010 to December 2012 in a private laboratory 

in the state of São Paulo, establishing the frequency of each finding. We analyzed 

30-50 metaphases by patient with resolution of 400 bands and banding staining G. 

Results: The results were described according to the ISCN 2009. The findings were 

45,X in 37.3% of cases; mos45, X/46,X,i(X)(q10) in 15.9%; mos45,X/46,XX in 11.9%; 

mos45, XX / 46, XY in 8%; 46,X,i(X)(q10) in 5.5% and mos45,X/46,X,+mar in 5.5%. 

Except for the karyotype typical ST, 45,X, which in literature occurs in around 50% 

of suspected cases, all findings are consistent with those already described by other 

authors. According to age, the karyotypes more frequent in patients older than 30 years 

were mos45, X/46, XX (53%). However, the majority of chromosomal abnormalities 

(71.4%) were concentrated on patients 10-20 years old, with a predominance of 45, 

X karyotype (74.5%). The presence of the Y sex chromosome was detected in the 

majority of cases (80%) also in the group 21-30 years old. 

Conclusion: The performance of C-banding cytogenetic is a tool that helps in 

confirming the presence of Y chromosome or marker chromosome. Generally, in 

cases 45, X should be guide the clinical importance of studying the presence of low 

or cryptic mosaicism: increasing the number of metaphases analyzed or analyzing 

different tissues. Laboratory confirmation of TS is essential for the indication of 

surgical or hormonal treatment and appropriate. 

A-410 

Associations between autoimmune thyroid disease prognosis and 

functional polymorphisms of susceptibility genes, CTLA4, PTPN22, 

CD40, FCRL3, and ZFAT, previously revealed in Genome-wide 

association studies 

M. WATANABE, N. Inoue, H. Yamada, K. Takemura, F. Hayashi, N. 

Yamakawa, M. Akahane, Y. Shimizuishi, Y. Hidaka, Y. Iwatani. Osaka 

University Graduate School of Medicine, Suita, Japan 

Background: Genome-wide association studies have revealed several susceptibility 

genes among patients with autoimmune thyroid disease (AITD), including CTLA4, 

PTPN22, FCRL3, and ZFAT. However, any possible association between these genes 

and AITD prognosis remains unknown. The objective of this study was to identify 

associations between polymorphisms of these genes and AITD prognosis. 

Methods: We genotyped functional polymorphisms, including CTLA4 CT60 

(rs30807243), CTLA4 +49A/G (rs231775), CTLA4 -1147C/T (rs16840252), CTLA4 

-318C/T (rs5472909), PTPN22 -1123C/G (rs2488457), PTPN22 SNP37 (rs3789604), 

CD40 -1C/T (rs1883832), FCRL3 -169C/T (rs7528684), ZFAT Ex9b-SNP10 

(rs16905194), and ZFAT Ex9b-SNP2 (rs1036819), in 197 AITD patients carefully 

selected from 456 registered AITD patients, and 86 control subjects. The restriction 

fragment length polymorphism method was used for genotyping. 

Results: The CD40 -1CC genotype and C allele were significantly more frequent in 

patients with Graves’ disease (GD) in remission than in those with intractable GD 

(P=0.041 and P=0.031, respectively). The FCRL3 -169TT genotype was significantly 

less frequent in patients with intractable GD than in those with GD in remission 

(P=0.0324). For a ZFAT Ex9b-SNP10 polymorphism, the TT genotype and T allele 

were significantly more frequent in patients with severe Hashimoto’s disease (HD) 

than in those with mild HD (P=0.0029 and P=0.0049, respectively). For a CTLA4 

CT60 polymorphism, the antithyrotropin receptor antibody levels at the onset of GD 

were significantly higher in those with the GG genotype than in those with other 

genotypes (P=0.0117). Results are summarized in Table. 

Conclusion: CD40 and FCRL3 gene polymorphisms were associated with GD 

intractability, and ZFAT polymorphism was associated with HD severity but not its 

development. 


A123



A-411 

Diabetes Risk Stratification by a Multivariate Index Comprising Only 

Parameters Derived from a Single NMR Spectrum of Plasma 

J. Otvos, I. Shalaurova, K. Mercier, T. O’Connell. LipoScience, Raleigh, 

NC 

Background: Risk of progression to Type 2 diabetes is assessed primarily by fasting 

glucose measurements, with concentrations 100-125 mg/dL identifying those with 

“pre-diabetes”. However, many high-risk individuals have glucose levels 0.05). However, we have found weak but significant 

correlation between HBsAg and age (p0.05). Due to HBsAg synthesis and HBV DNA replication from different pathway 

in hepatocytes that the two markers, HBsAg and HBV-DNA, are not significantly 

correlated in patients with hepatitis virus infected. Maybe mutations of HBV DNA 

caused the protein structure changes which used the Abbott ARCHITECT i2000 

System can not measure the concentration of HBsAg. 

Conclusion: In summary, our study indicates that HBsAg levels and HBV DNA 

concentrations in patients with hepatitis are not significantly correlated. 

A-416 

Serum Beta 2-Microglobulin and Cystatin C As Early Markers for 

Renal Dysfunction 

M. T. Rodriguez 1 , G. B. Dayrit 1 , S. V. Lumanga 1 , R. W. Lo 2 . 1 Trinity 

University of Asia, Quezon City, Philippines, 2 St. Luke’s Medical Center, 

Quezon City, Philippines 

Background: Nephropathy is one of the major complications of diabetes mellitus and 

causes premature deaths among diabetic patients. The alarming rise in the mortality 

rate of diabetics globally due to this complication is the foremost concern of this 

undertaking. This study aimed to determine the serum levels of beta 2-microglobulin 

and Cystatin C among diabetics, as early markers of kidney dysfunction. It sought 

to find if Cystatin C, a low molecular weight plasma protein which is normally 

being filtered by the glomeruli, totally reabsorbed and catabolized in the proximal 

convoluted tubule of the kidneys, can detect renal insufficiency earlier than blood urea 

nitrogen and serum creatinine. Beta 2-microglobulin (b2m), another protein in which 

plasma level is also being maintained by the kidneys, was also included in this study. 

Pearson coefficient correlation was used for statistical analysis. 

Method: One hundred diabetic participants without renal dysfunction were selected 

by purposive sampling. A control group composed of nondiabetics with the same 

gender and age bracket as the test group was also included. Fasting blood glucose, 

blood urea nitrogen (BUN), serum creatinine, b2m and Cystatin C were measured 

using the reagents from Abbott Diagnostics and its equipment, the Architect c4000. 

Results: Computed r-values of -0.118 (0.224) for fasting glucose and 0.195 (0.052) 

for urea nitrogen imply that the two parameters are not significantly related to the level 

of serum cystatin. However, computed r-value of 0.526 (0.000) for creatinine indicates 

that when creatinine level increases cystatin also increases, while the 0.766 (0.000) 

for b2m shows that there is a great possibility that when b2m is elevated, the cystatin 

of diabetic patients is also high. Also, serum levels of cystatin were elevated in 27% 

of the total diabetic participants, while 19% have increased beta 2-microglobulin, that 

is, in the presence of normal blood urea nitrogen and serum creatinine. Moreover, 

using Bevc formula (90.63 x cystatin C-1.192), 25% of the diabetic participants have 

eGFR below 90 mL/min/1.73m2, a vivid reflection of mild to moderate decrease in 

renal function. 

Conclusion: The findings suggest that serum beta 2-microglobulin and cystatin C 

are early markers for kidney dysfunction in cases of incipient diabetic nephropathy, 

as seen in increased levels of these serum proteins, with normal levels of the routine 

kidney markers’ BUN and creatinine. Further, the results also imply that the inclusion 

of new B (beta 2-microglobulin) and C (cystatin C) kidney function tests which could 

identify mild renal insufficiency would surely become a cornerstone of diabetes care. 

A-419 

Karyotype analysis in patients with recurrent miscarriages 

A. Castilho 1 , N. Gaburo 1 , m. J. Camilo 1 , D. Abreu 2 . 1 DASA, Sao Paulo 

Brasil, Brazil, 2 DASA, Rio de Janeiro, Brazil, Brazil 

Background: Recurrent miscarriages are usually associated with genetic factors. 

Thus, couples should always be investigated after the third abortion when there 

was no other factor such as trauma or thrombophilias. Furthermore, 6% of couples 




with recurrent abortion often have chromosomal abnormalities such as balanced 

translocations, or aneuploidy polymorphisms. In these cases, when a parent is a 

carrier of chromosomal rearrangement, the probability an abortion occurrence varies 

between is 25 to 50%. 

Objective: The aim of this study was identify the chromosomal abnormalities in 

patients with recurrent abortions attended in our service from March 2012 to January 

2013 using the conventional cytogenetic methodology. 

Methods: We evaluated 623 patients with clinical indication of recurrent abortion 

(389 female and 234 male). The mean age was 37 years (25-50 years) for men and 

35 years (22-46 years) among women. Cytogenetic analysis was performed on 

metaphase chromosomes obtained by lymphocytes culture from peripheral blood and 

using Case Data Manager System (Applied Spectral Imaging Ltd.). 

Results: Twenty three samples (3.7%) presented chromosomal alterations of which 

10 (1.60%) showed structural changes such as balanced translocations and 13 (2.1%) 

had karyotype polymorphisms. Among the polymorphisms, the alterations observed 

were: pericentric inversion of chromosome 9 in seven patients (53.8%), increased 

satellite on chromosome 22 in three patients (23.1%), increased heterochromatin on 

chromosome 9 in two cases (15.4%) and increased heterochromatin on chromosome 

1 in one patient (7,7%). Among patients who had chromosomal abnormalities, seven 

were female and three were male. Regarding to polymorphism seven patients were 

female patients and six (6) were male patients. 

Conclusion: In this study, chromosomal abnormalities and polymorphisms showed 

similar frequency. Cytogenetic analysis is an important tool in aid of diagnosis and 

prognosis definition, helping to define the procedure for genetic counseling, given that 

the presence of chromosomal abnormality may lead to the development of abnormal 

zygote resulting in miscarriage as consequence. 

A-420 

Oxidative stress index and levels of paraoxonase -1 in people with 

coronary artery disease identified by multislice computed tomography 

n. -. eren 1 , S. Yayla 1 , S. Cigerli 1 , C. Kırma 2 , E. Senem 1 . 1 şişli etfal trainig 

and research hospital, İstanbul, Turkey, 2 Kosuyolu trainig and research 

hospital, İstanbul, Turkey 

Key Word: Coronary artery desease, oxidative stress,Paraoxanase family 

Background: Recent studies with the aim of reducing the high mortality rates in 

Coronary Artery Disease (CAD) and determining the degree of coronary stenosis 

before the symptoms suggest that biochemical assestments play a prominent role. 

Methods: In our study,we performed Multislice Computed Tomography (MSCT) to 

76 people and we determined that 43 people of them had coronary artery disease. 

Total antioxidant status (TAS), total oxidant status (TOS), oxidative stress index 

(OSI), paraoxonase (PON1) and arylesterase (ARE) levels of all subjects included 

in the study were analyzed. TAS, TOS; was measured by the method of Erel (Rel 

Assay Diagnostics, Turkey). PON and aryl esterase enzyme activities was determined 

spectrophotometrically (Rel Assay Diagnostics, Turkey). 

Results: In our study, mean values of TAS in patients with CAD (1.83 ± 0.46) was 

statistically significantly lower (p = 0.029) than in patients without CAD(2.05 ± 

0.36). Mean values of TOS (28.68 ± 15.6, 11.25 ± 5.05) was significantly higher, 

respectively (p = 0.001). Median values of OSI which is obtained from the rate of 

TOS to TAS were significantly higher in patients with CAD (p = 0.001). According to 

Agatstron classification, TAS levels in the cases without calcified plaque (2.05 ± 0.36) 

were significantly higher (p = 0.042) than in patients with high-calcified plaque (1.75 

± 0.46). TOS levels in patients with light+mid-level and high-level of calcified plaque 

(11.25 ± 5.05, 27.23 ± 15.67, 30.12 ± 15.77) were significantly lower (p = 0.001), 

respectively and ODI levels were significantly lower in patients with calcified plaque 

(p = 0.001), were detected. OSI values in patients with coronary artery disease were 

significantly higher than patients without CAD. According to vessel situations, the 

same findings were analyzed. These results show that the processes of oxidative stress 

is responsible in the formation of plaque in coronary arteries. There is no significant 

difference between the groups at PON levels (p> 0.05). ARE levels of patients without 

calcified plaque were found significantly higher than patients with light + mediumlevel 

and high-level calcified plaque (p = 0.001). 

Conclusions: Our study showed that there is no significant difference between patients 

with and without CAD at levels of oxidative stress and arylesterase activity. This 

difference suggests that coronary artery disease was subjected to a severe oxidative 

stress. We conclude that oxidative stress levels and arylesterase activity could be used 

as an indicator for the development of calcified plaque and stenosis state. 

A-421 

Evaluation of a new workflow for syphilis screening using Brazilian 

guidelines 

D. Panisa, V. Alastico, I. C. Almeida, S. Mendonça, O. Denardin, N. 

Gaburo. DASA, Sao Paulo, Brazil 

Background: Treponema pallidum, the agent of syphilis infection leads to the 

production of specific (treponemal) and non-specific (non-treponemal) antibodies. In 

our service, the screening for syphilis infection was done using RPR (rapid plasma 

reagin), a non-treponemal assay. If positive, ELISA and FTA-Abs (treponemal tests) 

were performed. The increased number of syphilis tests requested an automated 

methodology for initial screening as CMIA (Chemiluminescent microparticle 

immunoassay), a high sensitivity treponemal test. 

Objective: Implement a new workflow for screening and diagnosis of syphilis starting 

the process with a treponemal test (CMIA) followed by a non treponemal test (RPR). 

Methods: We analyzed serum samples from 1,000 patients using commercial kits 

Architect Syphilis TP for CMIA (Abbott, Tokyo, Japan) and RPR - Rapid Bras Plasm 

Reagin (Laborclin, Paraná, Brazil). Both tests were performed according to the 

manufacturer’s recommendations. For discrepant results between CMIA and RPR, 

two treponemic assays were also performed: Treponema pallidum hemagglutination- 

TPHA (Fujirebio, Tokyo, Japan) and FTA-Abs (Simedix, New Jersey, USA). In 

our study, we followed the Brazilian guidelines of the ordinance CCD-25 from 

07.18.2011.The results obtained were interpreted qualitatively as positive, negative 

and inconclusive. 

Results: The results are described in Table 1. 

Table 1. Results of tests performed for screening and diagnosis of syphilis. 

CMIA RPR TPHA FTA-abs Total 

+ + N.A N.A 44.80% 

+ - + + 9.10% 

+ - - - 4.20% 

- - N.A N.A 32.90% 

INC - + + 1.50% 

INC - + - 4.00% 

INC - - + 2.00% 

INC - - - 1.50% 

Legend: +: Positive result; -: Negative result; INC: inconclusive result; N.A: not 

applied. 

Conclusion: CMIA and RPR showed agreement of 77.7%. The CMIA test showed 

higher detection rate of positive samples than RPR, confirmed by TPHA and FTA-abs 

in 9.10% of samples. Inconclusive results in CMIA test (9.0%) may be attributed to 

the window period and false-positive results. We concluded that CMIA as initial test 

is highly sensitive and optimized and RPR should be still performed in CMIA positive 

samples. 

A-422 

Enhanced Liver Fibrosis (ELF) panel in the evaluation of several 

chronic liver diseases 

A. Dellavance 1 , F. F. Fernandes 2 , D. C. Baldo 1 , E. L. Neto 3 , E. Oliveira 4 , J. 

M. Camargo 1 , L. Borzacov 4 , R. M. Perez 2 , L. E. C. Andrade 4 , M. L. C. G. 

Ferraz 4 . 1 Fleury Medicine and Health, São Paulo, Brazil, 2 Universidade 

Federal do Rio de Janeiro, Rio de Janeiro, Brazil, 3 Universidade Federal 

de Pernambuco, Pernambuco, Brazil, 4 Universidade Federal de São 

Paulo, São Paulo, Brazil 

Background: Hepatic fibrosis characterizes the natural history of chronic liver diseases 

and is considered a marker of disease progression to cirrhosis and its complications. 

Liver biopsy is the gold standard for semi-quantitative staging of fibrosis, although its 

accuracy is questionable. In addition to being an invasive procedure that poses a risk 

to the patient, the hepatic fragment is not always representative of the overall fibrotic 

process. Some non-invasive alternatives have been proposed for detecting hepatic 

fibrosis, including serum biochemical markers and direct ultrasound imaging. The 

literature has recently emphasized the accuracy of the ELF (Enhanced Liver Fibrosis) 

score, which is based on the quantification of hyaluronic acid (HA), procollagen III 

amino terminal peptide (PIIINP), and tissue inhibitor of metalloproteinase 1 (TIMP- 

1) in serum samples. The aim of the present study is to evaluate the degree of liver 

fibrosis according to the ELF score in several chronic liver diseases. 


A125



Methods: We evaluated 592 serum samples, from patients with the following diseases: 

HCV (n=266); Autoimmune Hepatitis (n=110); Schistosomiasis (n=109); Pre-Clinical 

Primary Biliary Cirrhosis (n=49); Established Primary Biliary Cirrhosis (n=29) and 

Delta Hepatitis (n=29). Serum samples were frozen at -70ºC within an interval no 

longer than 3 hours after blood collecting. PIIINP, HA, and TIMP-1 were measured in 

all patients by a CE-marked, random-access, automated clinical immunoassay system 

that uses magnetic particle separation technology with direct chemiluminescence 

(ADVIA Centaur®, Siemens Healthcare Diagnostics, Tarrytown, NY, USA). The 

ELF score was calculated using the algorithm: ELF = 2.278 + 0.851 ln(HA) + 0.751 

ln(PIIINP) + 0.394 ln(TIMP-1). Cut-off points proposed by the manufacturer were 

applied: < 7.7 absent or mild fibrosis, ≥ 7.7 and < 9.8 moderate fibrosis and ≥ 9.8 

severe fibrosis. 

Results: ELF score was able to detect some degree of fibrosis in the majority of 

individuals with all forms of chronic liver diseases in this study. However, there 

was considerable variability in the severity of liver fibrosis according to the etiology 

of liver disease. Autoimmune Hepatitis exhibited the highest and Delta Hepatitis 

exhibited the lowest frequency of severe ELF score (53.63%; mean 11.8±1.18 and 

6.9%; mean 10.62±0.82; respectively). Established Primary Biliary Cirrhosis, 

Chronic Hepatitis C and Schistosomiasis were intermediate in frequency of severe 

ELF score (31.0%; mean 10.65±0.48; 30.8%; mean 10.7±0.89 and 27.7%; mean 

10.59±0.65, respectively). Interestingly, the group of patients with Pre-Biochemical 

stages of Primary Biliary Cirrhosis showed a considerably better ELF score profile 

(14.3%; mean 7.0± 0.49). However, it was clear that even these individuals already 

presented some degree of liver fibrosis, not associated with alterations in serum levels 

of alkaline phosphatase. 

Conclusion: This preliminary evaluation showed the promising potential of the noninvasive 

ELF method for estimating the degree of liver fibrosis in distinct chronic 

liver diseases. The spectrum of fibrosis severity observed reflects the expected 

heterogeneity in the fibrotic component in the several forms of chronic liver disease. 

A-423 

Prognostic accuracy for all-cause mortality of a biomarkers panel 

in elderly hospitalized patients with suspected lower respiratory 

tract infection focused on procalcitonin and mid-regional proadrenomedullin 

M. Zaninotto 1 , M. M. Mion 1 , G. Bragato 1 , D. Faggian 1 , M. Miolo 2 , A. 

Dainese 3 , P. Carraro 2 , A. Pilotto 3 , M. Plebani 1 . 1 Department of Laboratory 

Medicine, University-Hospital, Padova, Italy, 2 Department of Laboratory 

Medicine, Azienda ULSS 16, S. Antonio Hospital, Padova, Italy, 3 Geriatrics 

Unit, Azienda ULSS 16 Padova, S. Antonio Hospital, Padova, Italy 

Background: The aim of the study was to assess the prognostic accuracy for all-cause 

mortality of a panel of routine and new biomarkers (mid-regional pro-adrenomedullin, 

MR-proADM; procalcitonin, PCT) in a population of elderly subjects hospitalized for 

suspected lower respiratory tract infection (LRTI). MR-proADM is a new diagnostic 

parameter for outcome prediction in patients (pts) with acute congestive hearth failure 

and/or with dyspnea in general; furthermore it is particularly strong in predicting 

short-term prognosis within 30 days after assessment. PCT increases early and 

specifically in response to clinically relevant bacterial infections and sepsis; it is an 

important aid in the differentiation between bacterial infection and other causes of 

inflammatory reaction. 

Methods: From 20/2/12 to 23/7/12, 50 patients were hospitalized to the Geriatrics 

Unit of our hospital with a suspect of LRTI [24 females (F), 26 males (M); age: 

range, median=67-102, 86 years]. At the follow-up monitoring (3/10/12), 28 pts 

(56%) survived (group “alive”) (14 F, 14 M), and 22 pts (44%) died (group “dead”) 

(10 M, 12 F). The mean hospital stay was 9 days (range, median=1-30, 7). Death 

occurred on average 26 days after discharge (range, median=0-162, 12). We 

evaluated, Clinical characteristics: 1-Primary discharge diagnosis; 2-Concomitant 

discharge diagnosis; 3-Fever (>37° C), CF and O2 saturation; 4-Multidimensional 

prognostic index, MPI: a validated frailty instrument, significantly correlated with 

short and long-term mortality in hospitalized older pts (grade of risk: low -L-, ≤0.33; 

moderate -M-, 0.34-0.66; severe -S-, ≥ 0.66). Biochemical parameters: A- Routine 

biomarkers: WBC, CRP, ESR, CRE; B- New biomarkers: MR-proADM and PCT 

(automated immunofluorescent assay, Thermo Fisher), manufacturer declared URL 

in healthy subjects, respectively: 0.55 nmol/L (97.5 % percentile) and 0.064 μg/L (95 

% percentile). Routine biomarkers were evaluated at hospitalization, while PCT and 

MR-proADM have been monitored at 4 different time points: admission (T 0), 24 

hours (T 1), 72 hours (T 2) and than 5-6 days (T 3). 

Results: 1-Primary discharge diagnosis (n pts, %): LRTI (26, 52%), cardiac 

diseases (12, 24%), respiratory diseases other than LRTI (4, 8%), other (8, 16%). 

2-Concomitant discharge diagnosis (n pts, %): LRTI (13, 26%), cardiac diseases (29, 

58%), neurologic disorders (18, 36%), muscle disorders (16, 32%), gastroenteric 

disease (8, 16%), pulmonary insufficiency and BPCO (6, 12%), other (20, 40%). 

3-Fever: “alive” vs “dead”=61 vs 32%; 4-MPI “alive” vs “dead” (Mann Whitney, 

p=0.08): L+M=54%, S=46% (“alive”); L+M=32%, S=68% (“died”). A-Mann 

Whitney (p): n.s. for all parameters. B- “alive” vs “dead”, Mann Whitney (p): MRproADM 

(0.01), PCT (0.07). The first two points (T0 and T1) were found to be more 

related with the clinical course. 

Conclusions: The most frequent primary and concomitant discharge diagnosis was 

LRTI and cardiac diseases, respectively. Among clinical characteristics fever differed 

significantly between “alive” and “dead” pts. MPI levels as well as MR-proADM 

and PCT concentrations showed a different distribution between “alive” and “dead” 

pts, even if not always statistically significant; MPI results the most important frailty 

instrument for the studied population, even if MR-proADM and PCT are two strong 

additional aid in predicting death. 

A-424 

THE ROLE OF CALPROTECTIN AND GHRELIN IN DIAGNOSIS 

OF POST ERCP PANCREATITIS 


Cairo, Egypt 

Acute pancreatitis is a common and dreaded complication of endoscopic retrograde 

cholangiopancreatography (ERCP) patients. The study identified the incidence of 

post ERCP pancreatitis and role of serum calprotectin and ghrelin in its diagnosis. 

One hundred forty two patients underwent ERCP-related procedures were studied. 

Serum amylase, lipase, calprotectin and ghrelin concentrations were measured 24 

hours after the procedure using ELISA, kinetic and colorimetric methods. Thirty 

two healthy controls were enrolled. In post ERCP group, mean level of amylase 

was 146.03+57.40 U/L, lipase 328.37+133.95 U/L, calprotectin 3.26+2.99 U/L and 

gherkin 2.56+1.76 mg/l. In controls mean level of amylase was 58.13+/-15.96U/L, 

lipase 181.63+/- 51.94 U/L, calprotectin 0.49+/-0.17U/L and ghrelin 2.59+/-0.19 

mg/l. A statistical significant increase was reported (p

TDM/Toxicology/DAU 


A-425 




Detection and Quantification of Synthetic Cathinones by LC/Triple 

Quadrupole Mass Spectrometry 

F. Mbeunkui, J. V. Wiegel, R. B. Dixon. Physicians Choice Laboratory 

Services, Charlotte, NC 

Background: Many of the new psychoactive substances remain unfamiliar to health 

care providers. Synthetic cathinones, commonly called “bath salts,” have resulted 

in emergency department visits nationwide for severe agitation, sympathomimetic 

toxicity, and death. The objective of this study was to develop a sensitive, specific 

and rapid liquid chromatography-tandem mass spectrometry method to detect and 

quantify synthetic cathinones in urine samples. 

Methods: Urine samples were prepared by solid phase extraction in a 96-deepwell 

SPE-plate after pretreatment with β-glucuronidase enzyme. Urine samples 

were analyzed by LC-MS/MS using an Agilent LC/Triple quadrupole instrument. 

Chromatographic separation was carried out in a Poroshell 120-SB-C18 column with 

99.9% water, 0.05% formic acid and 0.05% ammonium formate as mobile phase A; 

and 99.95% acetonitrile and 0.05% formic acid as mobile phase B. The column was 

eluted with a 2 min gradient from 5-95% B. Mass spectral data were obtained in 

positive electrospray mode. Detection and quantitation were performed by MRM of 

two transitions for each analyte and one transition for each internal standard. 

Results:Calibration curves generated for synthetic cathinones (10-640 ng/mL) with 

duplicate injections using 1/x weighting showed a good linearity (R2 ≥ 0.99). The 

average accuracy at 10 ng/mL was 99.7%. The limit of quantification was 10 ng/mL 

for all compounds and the limit of detection was 4 ng/mL for all compounds except 

for methylenedioxypyrovalerone and methylone (3 ng/mL). The matrix effect was 

found to be less than 20% of the nominal values for all compounds. This method was 

applied to the screening and quantification of synthetic cathinones in patient urine 

samples from suspected patients. Six samples out of nearly 500 investigated were 

tested positive for synthetic cathinones (methylone 70-245 ng/mL and methcathinone 

15-170 ng/mL). 

Conclusion:The validated LC-MS/MS method described here offers highly sensitive 

and rapid detection and quantification of synthetic cathinones in urine. 

A-427 

Development and validation of a HPLC-UV method for the 

quantification of three anti fungal agents in human serum 

L. R. Sanches, L. G. B. Toni, J. Pasternak, A. C. L. Faulhaber, T. Romanatto, 

E. V. Almeida, C. E. S. Ferreira. Hospital Albert Einstein, São Paulo, Brazil 

Background: Invasive fungal infections are one of the most common causes of 

morbidity and mortality in immunocompromised patients. In recent years, the 

antifungal therapy has expanded and the clinicians have the opportunity to choose 

from several antifungal classes but they need accurate methods for drugs monitoring 

during the treatment. Simultaneous determination of different antifungal is desirable 

as a way to obtain fast results using small samples. 

Methods: The purpose of this study was to develop and validate an ultraperformance 

liquid chromatography with ultraviolet detection (HPLC-UV) method to 

simultaneously monitor the concentration of voriconazole (VOR), itraconazole (ITR) 

and posaconazole (POS) in human serum. Samples were prepared using a liquid-liquid 

extraction with diethyl ether (0.5 and 2.5 mL, respectively). HPLC-UV analysis were 

performed using an Agilent 1290 Infinity System equipped with Eclipse Plus C18 (50 

mm x 2.1 mm; 1.8 μm) column. The analysis was achieved with a gradient elution 

using water and methanol (60:40, v/v) as the mobile phase at 0.7 mL/min flow rate. 

The internal standard (voriconazole compound related D, USP 1718041) was used at 4 

μg/mL. The wavelength and the injection volume were 256 nm and 4 μL respectively. 

Results: The method validation assays were performed according to the currently 

accepted RE 899 Anvisa Bioanalytical Validation Guide. The linearity range validated 

for VOR was 0.25 to 16 μg/mL and 0.25 to 8 μg/mL for ITR and POS. Weighted least 

square linear regressions using the weighting factor of 1/y 2 resulted in correlation 

coefficients above 0.99. The average accuracy ranged from 108% to 113% to VOR, 

86% to 100% to ITR and 111% to 113% to POS and the coefficient of variation (CV) 

interday precise ranged from 4.5% to 6.8%, 4.5% to 4.7% and 4.9 to 6.2 to VOR, ITR 

and POS respectively. The CV intra-day precise ranged from 1.7 to 6.2, 1.1 to 9.5 

and 0.6 to 8.6 to VOR, ITR and POS respectively. The limit of quantification (LOQ) 

and the limit of detection (LOD) were 0.25 μg/mL and 0.125 μg/mL, respectively for 

all analytes. The extraction recovery was 71.3%, 78.7% and 90.3% for VOR, ITR 

and POS respectively. The analyte stability was assessed under storage conditions as 

follows: room temperature for 4 and 24 hours, 4 o C for 3 days, -20 o C followed by 

thawing at room temperature (3 cicles) and post preparative stability. The hemolyzed 

and lipemic samples showed interference in selectivity assay just for POS. 

Conclusion: The validation results indicate that the method is accurate, precise, 

sensitive, selective and reproducible. 

A-429 

Development of a Rapid LC/MS/MS Method for 46 Drugs of Abuse 

Screening in Urine 

L. Yang 1 , G. Ball 2 , G. Hoag 1 . 1 Vancouver Island Health Authority and 

Faculty of Medicine, University of British Columbia, Victoria, BC, Canada, 

2 

Vancouver Island Health Authority, Victoria, BC, Canada 

Background: Drugs of abuse screening in urine is used to monitor compliance 

and evaluate patients in the emergency room. Immunoassays are commonly used 

for screening but have a limited scope of target compounds and lack sensitivity 

and specificity. Liquid chromatography tandem mass spectrometry (LC/MS/MS) 

can provide high sensitivity and specificity to targeted drug screening and has been 

increasingly used in clinical laboratories. The objective is to develop a rapid LC/MS/ 

MS screening method to replace our current immunoassay screening method for drugs 

of abuse (DOA) and provide confirmations. 

Methods: Sample preparation involves adding 100 μL of methanol with internal 

standards morphrine-d3 and diazepam-d5 to 100 μL of urine or controls, followed 

by vortex mixing and centrifugation. Then, 100μL of supernatant is diluted with 

400 μL of water and 20 μL of the dilution is injected for analysis by a Shimadzu 

Prominence HPLC system and AB SCIEX 4000 QTRAP mass spectrometer with 

electrospray ionization in positive polarity. We set up a targeted urine drug screen for 

46 drugs or drug metabolites using our modified AB SCIEX iMethod with gradient 

elution (6.6 min run time). The method consists of a multiple reaction monitoring 

(MRM) survey scan and an information-dependant acquisition (IDA) triggered 

dependent enhanced product ion scan (EPI). A MRM survey scan is used to identify 

potential drugs. The EPI spectrum can be searched against a drug screen library for 

compound confirmation. Generally, we use the combination spectral purity match 

(>70%), a retention time window (± 0.1 min) and medication use by the patient to 


A127



report positive results. For ten drugs (Amphetamine, Benzoylecgonine, MDEA, 

Methadone, Methamphetamine, Morphine, Nortriptyline, Oxazepam, Oxycodone, 

and THC-COOH) with an established immunoassay cut-off, we determined an area 

count corresponding to a level equal to minus 50% of the immunoassay cutoff by 

spiking urines with standards at the defined concentrations. 

Results: The reproducibility of the method in terms of purity values is determined 

by analyzing DOA urine toxicology liquid controls containing the ten drugs. Intraassay 

and inter-assay precision were 1-12% and 1-14%, respectively. Assay carryover 

is less than 0.1% for nine drugs and 1.2% for nortriptyline at 10x cutoff level. A 

comparison of LC/MS/MS method with immunoassay (Nova Century kit and DXC800 

analyzer) method is performed by analyzing patient samples (n=108). The agreements 

with immunoassay method within drug classes are 100% for opiates, oxycodone, 

methadone and cocaine, 98% for amphetamines (two positive in immunoassay were 

negative in LC/MS/MS), 92% for benzodiazepines (eight negative in immunoassay 

were positive for 7-amino-clonazepam or lorazepam in LC/MS/MS, confirmed by 

patient medication review), 88% for marijuana (13 positives in immunoassay were 

negative in LC/MS/MS, MRM signals were positive but EPI quality was not sufficient 

for confirmation) and 84% for tricyclic antidepressants (17 positives in immunoassay 

were negative in LC/MS/MS). 

Conclusion: A rapid and reliable LC/MS/MS method to detect and identify 46 drugs 

or drug metabolites in urine with minimal sample preparation is developed. Specific 

identification does not require confirmatory testing. The assay can be used for target 

drug screening in clinical laboratories. 

A-430 

Timing Is Everything: A Quality Assurance Study of Specimen 

Collection and Immunosuppressant Therapeutic Drug Monitoring 

T. K. Jackson 1 , P. A. Andrews 1 , H. K. Lee 2 . 1 Geisel School of Medicine 

at Dartmouth, Lebanon, NH, 2 Geisel School of Medicine at Dartmouth & 

Dartmouth-Hitchcock Medical Center, Lebanon, NH 

Background: Cyclosporine, tacrolimus or sirolimus are given to transplant patients 

to minimize rejection. It is important to monitor these drug levels - too much can 

result in toxicity and too little can result in transplant rejection. The optimal specimen 

collection time is just prior to the next dose, as the therapeutic ranges are those of 

trough levels. As a Quality Assurance study, patient results have been reviewed and 

specimen collection times were investigated for appropriateness. 

Objective: We aimed to determine how often a drug level that fell outside of the 

established therapeutic range was associated with improper timing of specimen 

collection and utilize this information to educate patients, nurses and practitioners. 

Methods: Retrospective review of cyclosporine, tacrolimus, and sirolimus results 

over a twelve month period was performed. A total of 4626 results were reviewed. 

Less than 30 or >400 ng/mL for cyclosporine, and 15 ng/mL for tacrolimus 

and sirolimus were considered to be out of range. Patient data was entered onto a 

spreadsheet with the name, date and time of specimen collection, location, provider’s 

name, and test result. The patients’ charts were then reviewed to correlate dosing 

information. 

Results: For cyclosporine, out of 685 total test results, 79 (11.5%) fell outside the 

therapeutic range. Of those, 34% were too low, and 66% were too high. For tacrolimus, 

out of 3716 test results, 326 (8.8%) fell outside the therapeutic range. Of those, 63% 

were too low, and 37% were too high. For sirolimus, out of 225 total test results, 41 

(18.2%) fell outside the therapeutic range. Of those, 98% were too low, and 2% were 

too high. The majority of results falling outside the therapeutic ranges were found to 

be appropriate (dose changes and correct specimen collection times). Out of those that 

were inappropriate, the main reasons found for low test results were no prescription 

for the drug, patient non-compliance, no dose given/taken, and improper specimen 

collection time. The majority of those for tacrolimus and sirolimus were outpatients, 

74% and 82% respectively. The main reasons found for high test results include the 

patients having been given/taken the dose and line contamination. The majority of 

those for tacrolimus, 77%, were outpatient. The majority of those for cyclosporine, 

83%, were inpatient. 

Conclusions: Reporting immunosuppressant results that are inaccurate due to 

inappropriate specimen collection times can lead to incorrect dose calculation. 

Testing for a drug that is not being prescribed to a patient due to ordering errors, or 

retesting for the same drug due to inappropriate collection times lead to increasing 

cost for the patients and waste of resources for the testing laboratory. Results of this 

study suggested the need for educating patients in outpatient settings and providers in 

inpatient settings of appropriate specimen collection times to ensure accurate results 

for dosing purposes. A dosing policy is being developed in collaboration with the 

pharmacy department and education sessions for outpatients and inpatient providers 

are in progress to address this issue. 

A-431 

Reference Interval Determination for Anabasine in Urine: A Biomarker 

of Active Tobacco Use 

B. B. Suh-Lailam 1 , H. Carlisle 2 , T. Ohman 2 , G. A. McMillin 1 . 1 University of 

Utah, Salt Lake City, UT, 2 ARUP Laboratories, Salt Lake City, UT 

Background: Laboratory detection of nicotine exposure is important for establishing 

eligibility for organ transplant and elective surgery. Nicotine testing is also used to 

verify compliance with nicotine replacement therapies (NRT), smoking cessation 

programs, and for life insurance purposes. Nicotine metabolites, such as cotinine 

(COT) and trans-3’-hydroxycotinine (3-OHCOT), are used as biomarkers of nicotine 

exposure. For some clinical applications, it is important to distinguish between active 

use of tobacco products versus NRT. Anabasine is a tobacco alkaloid that has been 

used as a biomarker of active tobacco use. However, the use of anabasine as an 

insecticide, and its presence in consumables other than nicotine products, suggests 

that anabasine may not be specific to tobacco use. 

Objective: To determine the reference interval for anabasine in the urine of nonsmokers, 

and compare it to the range of anabasine concentrations observed in the 

presence of nicotine metabolites. 

Methods: Urine samples were collected from 120 self-proclaimed, consenting nonsmokers 

(60 males and 60 females, 20-68 years old). COT, 3-OHCOT and anabasine 

were detected by LC-MS/MS. Briefly, an aliquot of urine was added to a mixture of 

deuterium labeled analogs of COT, 3-OHCOT and anabasine as internal standards 

(IS), and subjected to solid phase extraction. The samples were analyzed by APCI 

ionization and multiple reaction monitoring; two transitions were monitored per 

analyte and IS. The reference interval was compared to the range of anabasine 

concentrations determined for 2594 consecutive urine specimens that tested positive 

for nicotine and/or metabolites, at ARUP Laboratories, during a 1 year period. 

Results: Urine anabasine concentrations for the 120 non-smoking individuals 

ranged from 0.1-5.6 ng/mL, with a mean of 1.0 ng/mL and a median of 0.8 ng/mL. 

No statistically significant difference was observed between males and females. A 

reference interval was determined using non-parametric methods. The upper 95th 

percentile was determined to be 2.86 with a 95% confidence interval (CI) of 1.07 to 

4.65. Applying a cutoff concentration of 3 ng/mL, 1161 of the 2594 nicotine-containing 

urine specimens (45%) were anabasine-positive while 1433 were anabasine-negative. 

At a cutoff of 3 ng/mL, the Youden score was 99.16%, the ROC area was 0.9994 and 

CI was 0.9981 to 1.0000. Anabasine distribution in urine samples that were positive 

for at least one nicotine metabolite ranged from 3-1698 ng/mL, with a mean of 13.5 

ng/mL and a median of 8.0 ng/mL. These values were notably higher than that of 

the reference (nicotine-negative) population, and may reflect tobacco users. However, 

concentrations of anabasine between 3-6 ng/mL may or may not reflect active use of 

tobacco, due to potential overlap with the distribution of anabasine concentrations 

observed in the reference population. The nicotine-positive samples that were 

anabasine-negative (



quantify arsenic species. The objective of this study was to evaluate the clinical and 

analytical performance of a urine total arsenic screen with reflex to fractionation in 

identifying patients with arsenic exposure. 

Methods: A retrospective analysis of results from urine total arsenic with reflex to 

fractionation was conducted. Total arsenic samples were analyzed on Perkin-Elmer 

SCIEX ELAN 9000 or DRC II ICP-MS instruments. Arsenic fractionation was 

conducted using an Agilent Technologies 1200 Series HPLC with a model #7700x 

ICP-MS instrument. The reflex criterion was a total arsenic concentration ≥35 mcg/L. 

The positivity rate was used to evaluate clinical performance. Quantitative agreement 

between total arsenic and the sum of fractionated species (arsenobetaine, As(III), 

As(V), MMA and DMA) was used to evaluate analytical performance. The percent 

difference between methods was calculated as 100*[(total arsenic) - (sum of arsenic 

species)]/(total arsenic). 

Results: Of 12,595 urine total arsenic results, 1110 (8.8%) were reflexed to 

fractionation. Of the samples reflexed, 102 (9.2%, 0.8% of total arsenic samples) were 

clinically positive (sum of inorganic and methylated arsenic species ≥35 mcg/L) and 

949 (85.5%) were analytically positive (sum of inorganic, methylated and organic 

arsenic species ≥35 mcg/L). Since only the clinically concerning (inorganic and 

methylated) and major organic (arsenobetaine) arsenic species are quantified upon 

fractionation, some discrepancy between total arsenic concentration and the sum of 

fractionated species was expected. The slope and correlation coefficient (r 2 ) of the 

linear regression of the sum of fractionated species versus total arsenic were 0.97 

and 0.99, respectively, indicating linearity and correlation between the methods. The 

percent difference between total arsenic and the sum of fractionated arsenic ranged 

from -97.0% to 100%. The median of the distribution was 7.5%, and the 25 th and 75 th 

percentiles were -0.7% and 17.4%, respectively. The mean bias in a Bland-Altman 

difference plot (total arsenic - sum of fractionated arsenic) was 5.4 mcg/L and the 

limits of agreement were -36.7 and 47.5 mcg/L, which indicated a slight positive bias 

of the total arsenic concentration compared to the sum of fractionated arsenic species. 

Conclusion: Less than 10% of urine total arsenic samples assayed were reflexed to 

fractionation to quantify the arsenic species present, resulting in an overall clinical 

positivity rate of



μL of serum diluted with 5% H 3 

PO 4 

, and mixed with the internal standard solution 

was loaded into Oasis HLB 30 mg 96-Well Plate (Waters). The final eluents were 

evaporated and reconstituted for analysis. The validation procedure included linearity, 

analytical recovery, precision, lower limit of quantitation (LLOQ) and method 

comparison. 

Results: Solid Phase Extraction (SPE) procedure was developed to reduce matrix 

effects and troubleshoot operational robustness. 5% and 40% methanol were chosen 

as sequential washing solvents for removing endogenous interferences and 85% 

methanol was selected as elution solvent. The overall percent of recovery (n = 5) of the 

SPE extraction process ranged from 71.1 % (cortisone) to 85.3 % (dexamethasone). 

The study of matrix effects by single analyte was acceptable, in the range between 

-11% (cortisone) to 3.7% (prednisone). The method was linear up to 600 ng/mL for 

cortisol, cortisone, methylprednisolone and prednisolone and up to 400 ng/mL for 

dexamethasone and prednisone; with R 2 values greater than 0.998 for all compounds 

using a 1/x weighting linear regression. The overall analytical recovery within the 

measurement range was from 91.0 to 110.6%. The coefficients of variation intra-assay 

(n=10) and inter-assay (testing duplicates of each QC samples on 10 different days) 

were all less than 5% at three concentration levels. No carry-over was observed with 

this method. The LLOQ (lowest concentration that could be assayed with CV ≤ 15) 

was determined to be 0.5 ng/mL for cortisone; 1 ng/mL for cortisol and 2 ng/mL 

for dexamethasone, methylprednisolone, prednisone and prednisolone. The signal to 

noise ratio at the LLOQ was > 14:1 for all compounds. Excellent comparison was 

found with the reference LC-MS/MS method established in Department of Laboratory 

Medicine and Pathology, Mayo Clinic using 20 patient samples and covering the 

reportable range. Deming regression analysis gave a range of slopes (0.672 to 1.147) 

and correlation coefficients (r= 0.989 to 0.998). 

Conclusions: Our laboratory developed and validated a selective, sensitive, 

reproducible and robust analytical method for therapeutic monitoring of corticosteroids 

in human serum by combining a selective SPE for sample preparation with a highly 

sensitive LC-MS/MS analysis. 

A-436 

Antiarrhythmic Drugs Reverse Bath Salts Induced Tachycardia In 

Vivo 

T. J. Pitcher, H. A. Jortani, W. W. Tucker, H. A. Jortani, T. Kampfrath, S. A. 

Jortani. University of Louisville, Louisville, KY 

Introduction: Designer stimulant drugs are an emerging public health problem that is 

confounded by the lack of rapid diagnostics and specific treatment regiments. Among 

the many types of designer drugs on the market, synthetic cathinones (“bath salts”) 

have become increasingly popular. Typically bath salts are consumed by insufflation, 

ingestion or application to mucous membranes and are known to cause severe adverse 

effects including tachycardia, hypertension and respiratory distress. However, little is 

known regarding pharmacodynamic properties of bath salts in humans, specifically 

regarding their cardiogenic effects. The objective of this study was to evaluate the 

effects of bath salts on the hearts of Daphnia magna and determine if elevations 

in heart rate could be reversed using antiarrhythmic drugs. We hypothesize that 

cathinones will significantly increase the heart rate of daphnia, but this effect will be 

reversed using antiarrhythmic drugs. 

Methods: The physiologic effects of three synthetic cathinones (provided by UTAK 

Laboratories Inc.) were evaluated using the D. magna heart rate model. D. magna 

have a myogenic heart similar to vertebrates and have been used as a bioassay to 

evaluate effects of various compounds on heart rate and environmental toxicity. The 

drugs mephedrone, 3,4 methylenedioxypyrovalerone (MDPV) and methylone were 

evaluated. Additionally, antiarrhythmic drugs (Diltiazem and Verapamil) were also 

characterized and used to determine if they could counteract the tachycardia caused 

by synthetic cathinones. Briefly, D. magna were incubated for 30 seconds in a solution 

containing multiple concentrations of cathinones (0.14-141 μM), antiarrhythmic drugs 

(0.4-2.9 μM), and combinations of the two drugs. Following exposure, groups of five 

D. magna were transferred to slides and the heart rates were determined using a video 

microscopy and subsequent time-delayed video analysis. The effective concentration 

required to affect the heart rate 50% (EC 50 

) were determined and the t-test was used to 

demonstrate significant changes. 

Results: Dose-response analysis of five concentrations of bath salts demonstrated that 

the cathinones were able to significantly increase the heart rate of D. magna by 150% 

from 310 to 451bpm, with an EC 50 

of 1.9 μM. However, increasing concentrations of 

the cathinones above 14 μM did not significantly increase the heart rates, indicating 

saturation of the cardiac receptors. In contrast, antiarrhythmic drugs such as Verapamil 

exhibited the opposite effect, decreasing the heart rate by 50% from 310 to 158bpm, 

with an EC 50 

of 1.5 μM. When the D. magna were exposed to the 14 μM of a mixture 

of cathinones, followed by treatment with 2.1 μM Verapamil, the tachycardia caused 

by the cathinones was significantly reduced from 451 to 326 (P



A-438 

Development of a gas chromatography-mass spectrometry (GC-MS) 

-based qualitative “bath salts” assay in urine 

L. Liu 1 , S. Giannoutsos 1 , A. Karunamurthy 1 , J. A. Rymer 1 , R. 

Venkataramanan 2 , K. Tamama 1 . 1 University of Pittsburgh School of 

Medicine, Pittsburgh, PA, 2 University of Pittsburgh, Pittsburgh, PA 

Background: “Bath salts” refer to the new emerging stimulant drugs that contain 

synthetic cathinones. They are the latest addition to the list of abuse drugs and are 

gaining popularity. At present more than 100 compounds have appeared on the 

underground market and have caused acute toxicity and even death. Due to the 

lack of standard screening methods for these compounds, it is important for clinical 

toxicology laboratories to develop accurate screening methods to detect these drugs. 

The aim of this study is to develop and evaluate a urinary gas chromatography-mass 

spectrometry (GC-MS) test for common constituents of “bath salts” in our clinical 

toxicology laboratory. 

Methods: Pyrovalerone, methylone, methedrone, butylone, 3-fluoromethcathinone 

and 4-fluoromethcathinone obtained from Cayman Chemical (Ann Arbor, MI) were 

used in this study. Blank urine samples spiked with 5, 50, 500, and 5000 ng/mL of 

these compounds underwent liquid-liquid extraction with activated charcoal and 

methylene chloride under neutral and alkaline conditions. Derivatization of amine 

with pentafluoropropionic anhydride (PFPA) and ethyl acetate was performed at 70 

C for 20 minutes. The samples were then evaporated under nitrogen gas flow and 

redissolved in methanol before injection. Chromatography separation was carried 

out on an Agilent HP-5MS capillary GC column (30 m x 0.25 mm x 0.25 μm). The 

GC was operated in splitless injection mode with inlet temperature of 250 C and a 

flow rate of 1 ml/min. Analytes were detected on an Agilent Technologies 5975 mass 

spectrometer operated in full scan using electron ionization. Total run time was 42.75 

minutes. Compounds were identified through spectral match by using Mass Spectra of 

Designer Drugs 2012 (Wiley, Hoboken, NJ) and Cayman Spectral Library (Cayman 

Chemical). 

Results: The limit of detection of each compound with and without derivatization was 

defined in this system. Butylone, methylone, methedrone, 3-fluoromethcathinone and 

4-fluoromethcathinone were detected at 500 ng/mL without derivatizatin and at 50 

ng/mL with derivatization. Pyrovalerone was detected at 50 ng/mL with and without 

derivatization. The retention time of each compound is distinguishable from common 

urinary constituents, such as urea or creatinine. None of these six compounds had 

cross reactivity with in-house EMIT II immunoassay of amphetamine and other drug 

screens. These drugs are also shown to be stable in urine samples. With this GC-MSbased 

platform, we were able to identify methylone without derivatization in a patient 

urine sample. 

Conclusion: A qualitative GC-MS screening method for bath salts in urine was 

developed and evaluated. Using this method, “bath salts” in patient urine samples 

can be detected at clinically relevant concentrations. This will provide valuable 

information regarding the usage and clinical effect of these new abuse drugs. 

A-439 

Predicted ability of dosage rate-dependent reference ranges for urine 

hydrocodone measurements to distinguish between results from 

different dosage rates 

L. J. McCloskey, D. F. Stickle. Jefferson University Hospitals, Philadelphia, 

PA 

Background: Quantitative urine testing to assess pain medication prescription 

compliance is not well established. Couto et al. [J Clin Pharm Ther 2011;36:200- 

7] measured distributions of urine concentrations of hydrocodone from among 

volunteers given hydrocodone in dosage rates of 20 (A), 60 (B) and 120 (C) mg/d. 

These data are useful in establishing central 95% reference ranges for urines from 

these three basis dosage rates. We evaluated additionally the extent to which reference 

ranges for these groups could exclude results derived from alternative dosage rates. 

Methods: Urine concentration distributions for A-C were well fitted by log-normal 

distributions using a log scale median (x m 

) and a log scale standard deviation (s) 

(r 2 >0.99). Both x m 

and s were linear with hydrocodone dosage rate (R, mg/d) on a 

log scale: x m 

= 0.9327 log(R) + 2.341 (r 2 = 0.9984) (Eqn.1); s = -0.1151 log(R) + 

0.3492 (r 2 = 0.9898) (Eqn.2). Using Equations 1 and 2, predicted urine hydrocodone 

distributions for arbitrary dosage rates other than A, B or C were calculated. As a 

function of presumed alternative hydrocodone dosage rates, overlaps of the predicted 

distributions with central 95% reference ranges for basis dosage rates A-C were 

calculated. 

Results: See Figure. Using curve B as an example (basis dosage rate = 60 mg/d): 

for an alternative dosage rate of 150 mg/d, approximately 20% of the predicted urine 

concentration distribution is still within (overlaps with) the central 95% reference 

range of the basis distribution. For all three basis dosage rates A-C, an alternative 

higher dosage rate that is at least 2-fold greater is required before exclusion (nonoverlap) 

of at least 80% of the predicted urine concentration distribution occurs. 

Conclusions: Predicted overlaps of distributions as in Figure should enable clinicians 

to judge whether capabilities of quantitative urine hydrocodone testing to discriminate 

between varying dosage rates are adequate to meet intended clinical objectives. 

A-440 

2011 Detroit Area Survey of “Spice” Products 

J. M. Wilson 1 , J. Bargeon 2 , K. S. Leonard 1 , M. P. Smith 1 . 1 William Beaumont 

Hospital, Royal Oak, MI, 2 Children’s Hospital of Michigan Poison Control 

Center, Detroit, MI 

On November 24, 2010 the Drug Enforcement Administration (DEA) listed JWH- 

018, JWH-073, JWH-200, CP-47,497 and CP-47,497 C8 as temporary Schedule I 

substances [75 FR 71635]. These entities, frequently identified as “Spice” and “K2” 

were developed as agonists at human endocannabinoidCB-1 and CB-2 receptors. 

Promoted as “legal highs”, products of this type consist of vegetation to which has 

been added an application of a single or multiple chemical(s). In the summer of 

2011 we undertook a survey of samples acquired in the Detroit Metropolitan area 

to assess the impact of the federal law. The results of this survey are displayed in 

table 1. Analysis was conducted on a Hewlett-Packard 5972 MSD equipped with a 

DB-5 MS, 30 m. capillary column with 0.25 mm id with a 0.25 micron film thickness. 

Samples were prepared by immersing a product portion in methanol and injecting 1 

L of supernate after centrifugation. Of note is the absence of a controlled substance, 

the frequent presence of AM-2201(9 of 12) and that four of the products contained 

multiple substances. A review of the literature provided estimates of affinity constants 

at the CB-1 receptor for Tetrahydrocannabinol (THC), JWH-018, JWH-073, JWH- 

200 and CP-47,497 as 41.0, 9.0, 8.9, 42.0, and 9.5, respectively. Affinity constants, in 

parentheses, for the six synthetic chemicals identified were JWH-081 (1.2), JWH-122 

(0.7), JWH-210 (0.5), AM-2201 (1.0), and AM-2233 (1.8) indicating that the postregulatory 

group of products were, at minimum, more than twenty times more potent 

than THC and at least five times more potent than the strongest of the scheduled 

substances. 


A131



Table 1. 

Comercial Synthetic Cannabinoids 

JWH-022 JWH-081 JWH-122 JWH-210 AM 2201 AM 2233 

1 Astronaut Fuel 1 (Silver) X 

2 Astronaut Fuel 1 (White) X 

3 Bayou Blaster X X 

4 Diesel 3G X 

5 Ed Hardy X 

6 Funky Green Stuff X X X 

7 Kamel K2 X 

8 Legal Devil X 

9 Loud! X 

10 Professor’s Choice X 

11 Sonic Boom X X X 

12 Super Kush X X X X 

A-441 

Development of a Highly Sensitive Polyclonal Antibody for the 

Determination of Carbamazepine, Oxcarbazepine and Associated 

Active Metabolites 

J. Frew, S. Savage, P. McClintock, M. E. Benchikh, P. Lowry, R. I. 

McConnell, S. P. Fitzgerald. Randox Laboratories Limited, Crumlin, 


Introduction: Carbamazepine (CBZ) and oxcarbazepine are anti-convulsant and 

mood-stabilising drugs which are prescribed for the treatment of various conditions, 

including anxiety, attention-deficit disorder, bipolar disorder, schizophrenia and 

epilepsy. Carbamazepine is metabolised mainly to carbamazepine -10,11-epoxide 

(CBZ-E), 10,11-dihydro-10-hydroxycarbazepine (10-OH-CBZ) and the major 

urinary excretory product: 10,11-dihydro-10,11-dihydroxycarbazepine (10,11-diOH- 

CBZ). The therapeutic range is reported as 2-10μg/ml for total carbamazepine (free 

and protein bound) and 0.5-3.6μg/ml for free carbamazepine. The corresponding 

toxic values are given as greater than 12μg/ml and 4μg/ml, respectively. Toxic 

concentrations can provoke drowsiness, headaches, affect motor function and in 

extreme cases are fatal. Given this narrow therapeutic index allied to inter-patient 

variability in drug-responsiveness, it is extremely important to monitor the levels of 

the active drug in the patient’s serum during treatment to allow physicians to tailor 

treatments for each individual patient. Oxcarbazepine rapidly metabolises to 10-OH- 

CBZ and is also considered a candidate for Therapeutic Drug Monitoring (TDM). 

Relevance: The aim of this study was to develop a highly sensitive polyclonal antibody 

suitable for the determination of carbamazepine, oxcarbazepine and associated active 

metabolites. This is relevant for the development of efficient immunoassays for 

applications in TDM. 

Methodology: Carbamazepine was conjugated to bovine thyroglobulin (BTG) as a 

carrier. Adult sheep were immunized with the resulting immunogen on a monthly basis 

to provide target-specific polyclonal antisera. Immunoglobulin fraction was extracted 

and evaluated via competitive enzyme-linked immunosorbent assay (ELISA). The 

absorbance was read at 450nm. 

Results: The assay was standardized to carbamazepine and the specificity of 

the developed polyclonal antibody, expressed as % cross-reactivity, was: 299% 

(Oxcarbazepine), 68.3% (CBZ-E), 67.4% (10-OH-CBZ) and 14% (10,11-diOH- 

CBZ). It did not cross-react with amitriptyline ( 251.1 transition was 

monitored. 




Results: Analytical performance for whole blood and serum samples was very 

similar. Linearity was observed from 15.7 to 2000 ng/ml for both sample types. Total 

imprecision for whole blood HQ at 50 ng/ml, 500 ng/ml, and 1500 ng/ml was 9.6%, 

8.7%, and 8.5%, respectively; total imprecision for serum at the same concentrations 

was 2.6%, 1.9%, and 2.0%, respectively. Accuracy at these concentrations was within 

± 15% for both sample types. The lowest HQ concentration that resulted in a CV 

of 20% was 3.6 ng/ml for whole blood and 6.0 ng/ml for serum. Based on these 

values and the linearity of the method, the lower limit of quantitation was designated 

as 15.7 ng/ml for both sample types. The extraction efficiency and matrix factor for 

whole blood were 73% and 101%, respectively; for serum they were 103% and 101% 

respectively. 

Conclusions: We developed a robust and rapid TFLC-MS/MS method for the 

quantitation of HQ in whole blood and serum. The method shows similar analytical 

performance for both sample types. We are currently using the method to quantify 

HQ in paired whole blood and serum samples with the goal of rigorously and 

systematically evaluating the relationship between HQ levels in these sample types. 

A-445 

Analytical Performance of the SYVA EMIT 2000 Tacrolimus Assay on 

the Beckman DxC 800. 

J. Arias-Stella, C. Feldkamp, J. Zajechowski, L. Stezar, V. I. Luzzi. Henry 

Ford Hospital, Detroit, MI 

Background: Tacrolimus is an immunosuppressant used for prevention of organ 

rejection on transplant patients. It inhibits T-lymphocyte activation by binding to 

intracellular proteins and complexes to inhibit calcineurin phosphatase activity. 

Because high levels of this compound may be toxic and low levels inadequate to 

avoid organ rejection, therapeutic drug monitoring is essential for patient care. We 

investigated the analytical performance of SYVA EMIT 2000 Tacrolimus assay 

adapted for the Beckman DxC 800 in an effort to decrease the turn-around-time for 

results (TAT). 

Methods: The Beckman SYVA EMIT 2000 Tacrolimus assay is a homogenous 

competitive immunoassay with spectrophotometric detection performed on pretreated 

specimens. Correlation with a predicate method, imprecision, linearity and 

functional sensitivity were examined using human or commercially available whole 

blood specimens. We use liquid chromatography/mass spectrometry (LC/MS) as the 

predicate method for validation. For imprecision, commercially available control 

materials at 5.4, 12.3, and 27.6 ng/mL were used (n=14 for levels 1 and 2; n=8 for 

level 3). The data were analyzed using Microsoft Excel or EP Evaluator. The TAT was 

measured from the time the specimen arrived to the laboratory to the time the results 

were available in the electronic medical record. 

Results: Correlation with LC/MS demonstrated a slope of 0.93, and a correlation 

coefficient of 0.96 (n= 19) (figure). Imprecision (coefficient of variation, CV (%)) was 

15.2% at 5.5 ng/mL, 7.1% at 12.7 ng/mL, and 5.3% at 27.8 ng/mL. Average percent 

recovery between 2 ng/mL and 30 ng/mL was 100.4%. The functional sensitivity 

was 2 ng/mL. A precision profile showed a CV < 20% at 2 ng/mL. The average TAT 

decreased from 24 hours to less than 4 hours. 

Conclusions: The Beckman SYVA EMIT 2000 Tacrolimus assay analytical 

performance is within acceptable limits and enables the laboratory to offer a short 

TAT to support the current needs of our inpatient population. 

A-446 

Analytical validation studies of a 5-flurouracil assay; the use of the 

Siemens Advia® 1800 for personalized medicine in oncology. 

A. Teggert 1 , J. Dowd 1 , G. D. Lundell 2 , J. B. Courtney 2 , I. Baburina 2 , S. 

J. Salamone 2 . 1 James Cook University Hospital, Middlesbrough, United 

Kingdom, 2 Saladax Biomedical, Inc., Bethlehem, PA 

Introduction: Despite its 50 year history of use in the treatment of solid tumor 

cancers, the chemotherapeutic agent 5-fluorouracil (5-FU) remains the foundation 

drug in treatment regimens for colorectal cancer. The addition of other agents and 

changes in protocols has resulted in incremental improvements in treatment outcomes 

over the years, and now the focus on personalized medicine bring yet another 

opportunity for even better and cost-effective patient care. It has been demonstrated 

in phase II and III clinical studies that patient outcomes can be improved when 

5-FU dosing is personalized to achieve target systemic exposure through the use of 

therapeutic dose management (TDM) to measure 5-FU plasma concentration levels. 

These studies were performed using physical methods to quantitate 5-FU. The country 

specific availability of a 5-FU immunoassay gives clinical laboratories the potential to 

provide this important test in routine clinical settings. 

Objective: Validation of the Saladax Biomedical, Inc.(SBI) My5-FU ® 

assay on the 

Siemens Advia 1800. 

Methods: My5-FU is a homogenous, two-reagent, immunoassay based on 

nanoparticle agglutination. CLSI protocols and established procedures were used to 

evaluate precision, linearity, accuracy, sample carry-over and onboard reagent and 

calibration stability. Repeatability was tested on two days, n=20 for low, medium QC 

material and two plasma pools spiked with 5-FU. Within-laboratory (total) precision 

was evaluated with high, medium and low controls according to CLSI EP15-A. In 

the method comparison 50 clinical samples were run in duplicate over two days. 

Results were compared to the Beckman AU400® system, which had been previously 

validated for accuracy by comparison to a validated LC-MS/MS method. The My5- 

FU kit, and patient samples and pools were provided by SBI. 

Results: Within-run repeatability had coefficients of variation (CV) of 4.7% and 

4.5% for the low control (228ng/mL) and patient pool 1 (241ng/mL) and 2.2% for the 

medium control (465ng/mL) and 1.9% for patient pool 2 (712ng/mL). The CV for the 

total precision was 4.3%, 2.9%, and 1.4% for the low (228ng/mL), medium (466ng/ 

mL) and high (903ng/mL) controls respectively. The assay was linear throughout the 

test range (86-1800ng/mL): all mean results were within ±9% of the assigned values 

(median deviation -1.6%), the CV on the replicates was ≤5% (median 1.2%). The 

regression line through the points deviated



stability of at least a month. With excellent precision and accuracy of this application 

the Advia 1800 could be employed to provide results for the dose adjustment of 5-FU 

and potentially improve patient outcomes. 

A-447 

Ultrafast Quantitative Analysis of Benzodiazepines and Buprenorphine 

in Urine Using High-Throughput SPE/MS/MS 

N. Parikh, M. Youssef, M. Romm, K. Schlicht, V. Miller, W. LaMarr, C. 

Ozbal. Agilent Technologies, Wakefi eld, MA 

Introduction: Law Enforcement officials, employers and pathologists use forensic 

drug screening extensively today. The steady increase in sample volume has led 

to the need for greater analytical capacity within forensic toxicology laboratories, 

placing a strain on traditional technologies like GC/MS or LC/MS. In the present 

study, we evaluated the ability of an ultrafast SPE/MS/MS system to quantitatively 

measure a panel of benzodiazepines or Buprenorphine/Norbuprenorphine in urine 

at low ng/ml concentrations, with sample cycle times of



A-450 

A Robust, Reliable and Cost Efficient Method to Extract and Detect 

Synthetic Cannabinoids in Urine by LC/MSMS 

J. C. Wentworth, S. S. Tolliver, E. D. Lykissa. ExperTox Lab Services, Deer 

Park, TX 

Background: Synthetic cannabinoids (SCB) are a class of psychoactive chemically 

designed drugs, which when consumed mimic the effects of Cannabis by binding 

to the Cannabinoid A & B brain receptors with enhanced affinity and pronounced 

pharmacological effects. The literature has suggested the strong addictive properties 

of these potent psychotropic substances may be due to the lack of cannabidiol, 

which counters these properties in the natural occurring Cannabis. In terms of 

metabolism, SCB’s are extensively metabolized by the cytochrome P-450 enzymes, 

which ultimately results in a glucuronic acid conjugate. The goal of this study was 

to develop a quantitatively comprehensive LC/MS/MS method for the detection of 

synthetic cannabinoids and their metabolites in urine that would be relatively easy, 

quick, and inexpensive. 

Methods: Two-hundred microliters of donor urine sample, calibrators and controls 

undergo enzymatic hydrolysis with beta-glucuronidase, followed by an in-house 

perfected salting-out liquid-liquid extraction process. Three hundred microliters of 

acetonitrile is added, at which time the samples are vortex mixed and centrifuged 

for 10 min at 2500 rpm. One-hundred microliters of the supernatant is submitted for 

liquid chromatography-mass spectrometry-mass spectrometry (LC/MS/MS) analysis. 

Analytical analysis was conducted on Agilent Technologies 6430 Mass spectrometer 

coupled with a 1260 Infinity HPLC system. Ten microliters of specimen was injected 

onto a Restek biphenyl column (50 X 2.1mm, 3μm) with the initial mobile phase 

of 40:60 (5mM Ammonium Formate with 10% methanol: 0.1% formic acid in 

acetonitrile). After 1.0 min the mobile phase composition transitions to a ratio of 5:95, 

with a constant flow rate of 0.4 mL/ min. Dwell times were established at 50 ms, 

with a gas flow of 10 L/min and 50 psi nebulizer pressure. The method successfully 

and reliably identifies 11 different hydroxylated-indolic or hydroxylated-pentyl urine 

metabolites of JWH-018, JWH-019, JWH-073, JWH-122, JWH-200, JWH-210, 

JWH-250, JWH-398, RCS-4, AM-2201 and XLR-11; along with D9-JWH- 018 and 

D7-JWH-073 internal standards. The total runtime is 4.5 minutes. 

Results: The limits of detection and limit of quantitation were established at 0.2 ng/ 

ml and 0.5 ng/ml, respectively. Each patient sample is quantitated using a three-point 

calibration curve with an upper limit of quantitation of 50 ng/ml. 

Precision at the limit of quantitation had a mean CV of 6.45% (range: 2.52 - 

12.855%), while the mean at the upper limit of linearity equaled 4.86% (range: 

0.338-11.49%). The actual time to prepare the samples did not exceed 45 minutes, 

making the extraction procedure relatively quick and efficient. The amount of buffer 

and extraction solvent utilized are minimal, which has the two-fold benefit of having 

a low amount of waste material as well as a small amount of upfront material usage. 

Conclusion: The described methodology has proven to be reliable method for the 

detection of SCB’s that is robust, and relatively inexpensive. 

A-451 

Evaluation of Everolimus QMS assay by using Thermofisher Indiko, 

Beckman DXc and AU680 analyzers 

K. Garrison 1 , S. Wong 2 . 1 Wake Forest Baptist Health, Wisnton-Salem, NC, 

2 

Wake Forest School of Medicine, Wisnton-Salem, NC 

Background: Everolimus, a mTOR inhibitor immunosuppressant for renal transplant, 

is often used in combination with calcineurin inhibitors such as cyclosporine and 

tacrolimus. Therapeutic range is 3 -8 ng/mL, based on LC-MS assay of the parent 

drug. Everolimus is also used for the following cancer treatments: subependymal gaint 

cell astrocytoma, HER2-negative breast cancer, progressive neuroendocrine turmors 

of pancreatic origin, and renal cancer patients with failed Sunitinib or Sorafenib 

treatments. Everolimus monitoring may be achieved by LC-MS-MS, and recently, by 

the Thermofisher QMS turbidimetric immunoassay. This study initially established 

the clinical efficacy of the QMS everolimus assay by using Beckman DXc, followed 

by comparison to Thermofisher Indiko and Beckman AU 680. 

Methods: QMS everolimus is a turbidimetric immunoassay. Sample preparation was 

initiated by mixing 300 μL of samples - patient whole blood with 350 μL of methanol, 

and 50 μL of a precipitation reagent. After vortexing for 35 seconds and centrifugation 

for 8 minutes at 13,000 Xg, 350 μL of the supernatant was transferred to sample 

cups. Drug in the supernatant and drug coated on microparticle competed for limited 

number of antibody binding sites. If everolimus was absent in the sample supernatant, 

everolimus-coated microparticle was agglutinated in the presence of antibody 

reagent. If everolimus was present, agglutination was partially inhibited depending 

on everolimus concentration. Thus, agglutination rate was inversely proportional to 

everolimus concentrations, and was measured photometrically. Calibrators ranged 

from 0 to 20 ng/mL. 

Results: Linearity studies established: AU 680 - range of 0.1 to 19 ng/mL with a 

slope of 0.972, and an intercept of 0.05., DXc - 0.51 to 20 ng/mL, 1.023 and 0.19, and 

Indiko - 0.53 to 20 ng/mL, 1.014 and 0.12 respectively. Precision studies of 20 control 

samples showed the following mean concentrations and CVs: AU 680, 4.20 and 14.90 

ng/mL, and 3.1 and 3.5%., DXc, 4.72 and 15.56 ng/mL, and 3.6 and 2.6% ., Indiko, 

4.00 and 15.25 ng/mL, and 6.8 and 3.1% respectively. Calibration stabilities for DXc, 

AU680 and Indiko were shown to be 1, 5 and 5 days. Comparison studies of the three 

analyzers for 107 to 109 kidney transplant samples with concentration ranging from 

0.3 to 13.6 ng/mL showed the following slopes, intercepts and correlation: DXc vs 

AU 680, 1.000, -0.05 and 0.981., DXc vs Indiko, 1.073, 0.43, 0.945., and AU 680 vs 

Indiko, 1.076, 0.46, 0.962. 

Conclusion: Everolimus may be monitored by the QMS assay using three 

autoanalyzers with adequate sensitivity and acceptable precision. These three 

methods offered comparable everolimus determination suitable for monitoring renal 

transplant patients. 

A-452 

Monitoring Levetiracetam (Keppra) in Geriatric Patients using 

ARK Assay on ROCHE Modular P. 

R. Khoury, A. Gandhi, B. P. Salmon, P. Gudaitis, D. Gudaitis. Aculabs, Inc., 

East Brunswick, NJ 

Background: Epilepsy is a chronic disorder with recurring seizures; it is estimated 

that approximately 2 million people in the United States have epilepsy with 140,000 

new cases/year. There are several antiepileptic drugs on the market with the ultimate 

goal of complete cessation of seizures. Levetiracetam (Keppra®) is novel drug with 

mechanism of action by modulation of synaptic neurotransmitter release. Keppra has 

several advantages over other drugs which made the drug so popular: it is rapidly 

absorbed with almost 100% bioavalability, not bound to plasma protein, absence of 

enzyme induction, absence of interactions with other drugs, and partial metabolism 

outside the liver. Therapeutic drug monitoring of the Keppra level is important in 

conditions that cause change in the pharmacokinetic characteristics of the drug 

such as pregnancy, old age and poor kidney function. Also, monitoring helps assess 

compliance, optimizing regimen in certain patients, and dosing the newer extended 

release drug. HPLC is the method used by most laboratories, but new assays are 

making their way to routine clinical chemistry analyzers. 

Design: Specimens were collected from residents in Long-Term Care facilities 

with average age of 67.8 years; the majority of the patients were on combination 

of antiepileptic drugs. Levetiracetam was measured using the ARK assay, 

a homogeneous enzyme immunoassay based on competition between drug in 

the specimen and levetiracetam labeled with the enzyme glucose-6-phosphate 

dehydrogenase (G6PDH) for binding to the antibody reagent. We evaluated the assay 

sensitivity, accuracy, linearity, precision, reportable range, and samples from resident 

in Long-term Care facilities were used for the correlation with a reference using liquid 

chromatography/tandem mass spectrometry (LC/MS-MS). Statistical analysis was 

done using Analyse-it. 

Results: Assay sensitivity was 2 ug/mL, and the within-assay coefficients of variation 

were 3.8% and 2.1% for concentrations of 10.8 ug/mL and 45.26 ug/mL respectively. 

Analytical range was verified from 2-100 ug/mL with acceptable linearity. Correlation 

between ARK Levetiracetam assay on Modular P and LC/MS-MS was excellent 

with correlation coefficient of 0.9927, bias -1.12, slope of 0.953 and intercept of -0.08. 

Although the majority of the patients were within the therapeutic reference range, 

more than 3% of the patients were above the therapeutic ranges and required dose 

adjustment. 

Conclusion: Application of the ARK Levetiracetam Assay on Modular P is a fully 

automated, random access, high throughput test system, and gave the benefit of a 

making the assay available on a platform used in routine chemistry, thereby saving the 

cost of adding another instrument. It performed with high precision and acceptable 

sensitivity. The assay requires fewer steps, less reagent preparation and training than 

the LC/MS-MS assay, which gives it the advantage of saving technician time and 

salary. In addition, reducing turnaround time will lead to better patient care especially 

for the geriatric population where the majority of the patients are frail, on multiple 

medications, and have some degree of renal dysfunction. 


A135



A-453 

A Potential Proteomic Biomarker of Lovastatin-induced Macrophage 

Toxicity 

L. Zhang, X. Zhou, A. Zhou. Cleveland State University, Cleveland, OH 

Background: Lovastatin, a competitive inhibitor of 3-hydroxy-3-methylglutaryl 

coenzyme A (HMG-CoA) reductase, is commonly used in clinic to treat patients with 

hypercholesterolemia. Moreover, this compound has pleiotropic effects on regulation 

of cellular proliferation and induction of cell-cycle arrest in vitro. Evidence from 

cell culture experiments suggests a link between lovastatin and macrophage cell 

apoptosis. Therefore, protein profiling of macrophage cells in responding to lovastatin 

treatment may provide an insight to cellular and molecular biological changes. The 

aim of present study was to identify potential lovastatin-induced biomarker candidates 

for macrophage toxicity. 

Methods: In this work, a systematic bottom-up proteomic analysis was performed 

to investigate the differential expression of proteins under lovastatin dose-gradient 

treatments. RAW 264.7 mouse leukaemic monocyte macrophage cells in culture were 

used as an experimental model. After the cells were incubated for 24 hours at 37 ºC, 

lovastatin was added at different concentrations (0.1, 0.5, 1.0, 5.0, 10.0, 15.0, 20.0 

μM) and incubated for another 24 hours. The resulting cell lysates were subjected 

to SDS-PAGE separation, trypsin digestion, and liquid chromatography-tandem 

mass spectrometry analysis. The identified candidate biomarkers were validated 

using immunoblot assay. In addition, the bio-functions of macrophage cells with 

and without lovastatin treatment were characterized by measuring their phagocytic 

activity and migration inhibitory factor (MIF). 

Results: Lovastatin at high concentrations (>5 μM) induced accelerated macrophage 

apoptosis, increased phagocytic activity, and promoted macrophage migration. 

A number of differential proteins expressed in the lovastatin-treated samples were 

higher than those in the control samples. Especially, Filamina A (290 kDa) was found 

as an up-regulation biomarker candidate for lovastatin induced macrophage toxicity. 

Conclusions: Our results suggest that lovastatin could act as a macrophage toxic 

agent at high doses. Due to Filamin A’s functions in the control of cell mobility, cell 

ECM interactions, cell signaling, and DNA damage response, it may be a potential 

diagnostic and prognostic biomarker for macrophage toxicity. Further investigation at 

molecular levels to understand long term side effects for clinical safety of lovastatin 

is warranted. 

Keywords: 

Lovastatin; Macrophage; Filamin A 

A-454 

Comparison of a newly developed UPLC/MS/MS clinical research 

method with two immunoassay platforms for the analysis of 

methotrexate in serum 

M. P. Eastwood 1 , P. J. Monaghan 2 , Y. Thomson 2 , L. J. Calton 1 . 1 Waters 

Corporation, Greater Manchester, United Kingdom, 2 

The Christie 

Hospital, Greater Manchester, United Kingdom 

Background: Here we compare the use of an UltraPerformance liquid chromatography 

tandem mass spectrometry (UPLC/MS/MS) research method with the Abbott TDx 

(FPIA) and ARK Methotrexate (EMIT) immunoassays for the analysis of methotrexate 

in serum. Due to the limited linear range of the immunoassays, automated sample 

dilution is often required for analysis of samples from patients receiving high-dose 

therapy. 

Methods: Samples were anonymised and frozen prior to batch analysis at The Christie 

Hospital, Manchester, UK, using the Abbott TDx analyzer and ARK assay (using the 

Siemens ADVIA 1800 platform) (n=100), before comparison with UPLC/MS/MS. 

The newly developed UPLC/MS/MS method uses a simple protein precipitation 

extraction to prepare calibrators, QCs and samples for analysis. The analysis time per 

sample was approximately 2.5 minutes injection-to-injection. Precision performance 

(%CV) for inter- and intra-method imprecision for low (0.03μmol/L), mid (8.6μmol/L) 

and high (300μmol/L) QC samples was



were done by immunoassay that had previously been validated against both HPLC 

and GC. We calculated t½, Cl and Vd for both methadone and EDDP. All assays were 

done at the request of the attending physician. 

Result: From June 2002 to January 2013, 250 patient samples were analysed. On 78 

patients we also had the list of medications. Eight of these had no other medication 

and the remaining 70 had received an average of 3.5 medications (range 1 to 13). The 

most commonly prescribed drugs were amitriptyline (5) duloxetine (6), venlafaxine 

(6), bupropion (7), citalopram (8) ibuprofen (12) and oxybutynin (12). Methadone 

half-life could be calculated on 224 patients. T½ ranged from 6.6h to 167h (mean 

33.8h). Removing extreme values 60h, n=195, mean t½ = 29.1h was 

obtained. Half-life correlated significantly with dose in mg/kg (p



Conclusion: Our findings indicate that both Siemens and ARK immunoassays are 

suitable for MTx level monitoring in management of the patients treated with high 

dose MTx if the drug toxicity cut-off is set to 0.10 μmol/L. Protocols where MTx 

toxicity limit is set at



methamphetamine plus confirmation ions, and N-ethylamphetamine, for one 

vernix sample. The second vernix sample was positive for methadone, EDDP, and 

amitriptyline. Total analysis time, including sample incubation, was sub- 2 hours. 

Analysis of additional vernix samples is on-going to further assess correlation of 

DART-HRMS results to standard drug testing procedures. 

Conclusions: The DART-HRMS platform provides easy and fast sample analysis 

from a variety of biological matrices, including those (e.g.vernix) difficult to prepare 

by conventional means. This allows noninvasive and timely analysis of newborn drug 

exposure. While optimization of sample treatment is in progress, preliminary data 

indicates good agreement with clinical presentation and suggests this methodology 

could be useful in the clinical laboratory. 

A-464 

Should all screen-positive elevated blood lead (EBL) samples be 

retested before reporting? 

L. J. McCloskey 1 , J. D. Landmark 2 , D. F. Stickle 1 . 1 Jefferson University 

Hospitals, Philadelphia, PA, 2 University of Nebraska Medical Center, 

Omaha, NE 

Background: Common laboratory practice in lead (Pb) testing is to retest samples 

having initial results that are positive for elevated blood lead (EBL: [Pb] ≥5 μg/dL) 

before reporting. An unintended outcome of this practice is that it in fact reduces 

the overall screening sensitivity for EBL detection. This is for the simple reason that 

among all first-measurement positives, which includes both false positives (FP) and 

true positives (TP), the only possible change for TP upon retesting is reclassification as 

negative (decreasing the number of TP, and increasing the number of false negatives 

(FN)), due simply to assay imprecision. Accordingly, the screening sensitivity (S = 

TP/(TP+FN)) can only decrease when only first-measurement positives are retested. 

The scale on which this affects sensitivity for EBL detection can only be guessed at 

without performing detailed calculations that account for assay imprecision and the 

underlying patient population distribution for [Pb]. In order to assess this scale, we 

undertook such calculations by simulation of testing using a known patient population 

distribution for [Pb] and assuming an appropriate fixed value for assay imprecision. 

Methods: A basis patient [Pb] distribution was that of first-or-only measurements 

among pediatric subjects at the University of Nebraska Medical Center during a oneyear 

period (2011; n=10,333), for which 4.4% were classified as EBL (≥5 μg/dL). 

For sake of argument, this distribution was treated as a “true” results distribution. 

This distribution was “measured” by simulation, using a fixed standard deviation (s) 

of measurement, s=0.77 μg/dL. This s was chosen as a boundary value which would 

produce a sample pass rate of >99% for current proficiency testing requirements of 

±2 μg/dL accuracy. In simulated testing, each sample [Pb] was individually replaced 

by a value from the normal distribution [Pb]±2s, according to the probabilities of 

that normal distribution; this is as if each “true” [Pb] was measured by an assay with 

imprecision s. Simulated testing was conducted either without retesting (singletons, 

case A), with retesting when first test results were ≥EBL cutoff (≥5 μg/dL) (duplicates, 

case B), or with retesting only when first test results were ≥EBL cutoff +2s (≥6.5 μg/ 

dL) (duplicates, case C). The original basis distribution classifications (EBL, non- 

EBL) were compared to results of simulated testing to determine sensitivity, S, for 

EBL detection under conditions A, B, or C. Simulations were of 10,000 samples per 

run, replicated for 1000 runs. 

Results: For case A (singletons), S was 89.6±1.5 %. For case B (duplicates for firstmeasurement 

≥5 μg/dL), S was 87.3±1.6 %, a decrease of 2.3% in comparison to A. 

For case C (duplicates for first-measurement ≥6.5 μg/dL), S was 89.6±1.5%, identical 

to results for A. 

Conclusions: For this patient distribution, there was a penalty of retesting of samples 

that were first-measurement screen-positive for EBL, which decreased sensitivity for 

EBL detection by >2%. This penalty is an inherent aspect of assay imprecision when 

only first-measurement positives are retested. Retesting only of first-measurement 

positives that are at least 2s greater than the EBL cutoff can avoid this effect on S 

of retesting. 

A-465 

Method development for determining iohexol in human plasma by 

UPLC 

Y. Zou, S. Wang, Y. Li, Y. Liao, J. Tang, L. wang. Department of Laboratory 

Medicine, West China Hospital , Sichuan University, chengdu, China 

Objective: Iohexol(IHO) is a suitable marker for glomerular filtration rate (GFR) 

testing because its elimination occurs in glomerular without secretion or resorption 

in tubular. Therefore, iohexol clearance is widely used in clinical practice for GFR 

testing.This research aimed to develop a quickly and sensitively method to determine 

the human plasma iohexol by ultra-high Performance Liquid Chromatography 

(UPLC) . 

Methods:We used iohexol related compound C as the internal standard (IS). Protein 

precipitation and iohexol extraction from plasma sample (0.2ml) was carried out 

by adding 0.6ml acetonitrile followed by vortex mixing and centrifugation. The 

supernatant was reextracted using 3 ml trichloromethane,then the 5ul upper aqueous 

was analysed on Waters BEH C18 column(2.1*50mm,1.7um), IHO and IS were 

eluted by the mobile phase consist of 0.02mol/L PH4.50 ammonium acetate buffer(A) 

and acetonitrile(B) under 40℃ at a flow-rate of 0.3ml/min and monitored by UV 

absorption at 254 nm. 

Results:The Average extraction recovery of IHO and IS was 90.8% and 90.4%, 

respectively; good linearity(r 2 =0.9994) was observed througuout the range of 0.025- 

200 ug/ml and the Lower limit of detection was 12.5ng/ml, the retention time of 

IHO and IS were 1.12min and 1.85min, respectively; The intra-assay and inter-assay 

variations were lower than 2.22% and 2.37%, respectively, for all the examined 

concentrations; the overall accuracy of the method was 100.6%-103.4%; the stability 

of IHO in plasma was assessed, that coefficients of variance at room temperature for 

6h ,frozen/thawed at room temperature then refrozen at -20℃ for three cycles and 

stored at -20℃ for 29 days were less than 1.25%, 1.56% and 2.56% , respectively. 

Conclusions:This method was sensitive, accurate, simple and rapid.it not only has the 

capability of being used for determination of iohexol in clinical settings, but also can 

be useful for clinical plasma concentration measurement and pharmacokinetic study. 

Tab1 . The precision of IHO 

Intra-day 

Inter-day 

C(ug/ml) Measured(ug/ml) RSD(%) Measured(ug/ml) RSD(%) 

100 100.5±2.2 2.22 100.2±1.88 1.88 

6.25 6.46±0.09 1.44 6.28±0.12 0.57 

0.39 0.394±0.002 0.7 0.39±0.003 1.34 

0.1 0.102±0.002 1.95 0.1±0.002 2.37 

A-466 

Red Eyes, Flushed Face, Slurred Speech, and More: A Clinical 

Dilemma in a Complex Mental Illness Unit 

E. Wong, C. Stefan-Bodea. Centre for Addiction and Mental Health, 

Toronto, ON, Canada 

Background. A client of the Centre for Addiction and Mental Health in Toronto 

with outside privileges started returning late to the unit with signs of intoxication 

including red eyes, flushed face, slurred speech, lack of co-ordination while playing 

games at which he was normally good as well as disorganized thoughts, not being 

able to get his story straight as to where he was or when he signed out. Another client 

experienced quick change in mental status including verbally aggressive, paranoid, 

psychotic. Comprehensive urine drug screens were unremarkable.The possibility that 

these symptoms may have been due to use of herbal products containing synthetic 

cannabinoids, overall known as “Spice” but also available under a variety of names, 

was considered. We describe the identification of JHW-type synthetic cannabinoids 

metabolites in urine specimens using high resolution Orbitrap mass spectrometry 

approach, thus overcoming lack of commercially available standards. 

Materials and Methods. Urine specimens were analyzed using the Q-Exactive LC- 

MS mass spectrometer. A database with monoisotopic masses for various drugs and 

metabolites was created. Drug standards from Cerilliant were used to validate the 

mass accuracy, retention times and mass fragmentation spectra. LC separation was 

on Phenomenex Kinetex PFP column 100 x 2.1 mm, 2.6 μm, 100Å, using gradient 

elution and UPLC Accela pump. The cycle time was ~15 min with positive and 

negative polarity switching, and fragmentation in the HCD in the same run. Precursors 

were scanned from m/z 100 to 800 at 70,000 resolutions and HCD fragment ions 

between m/z 50 to 800 at 17,500 resolutions. Data was analyzed with XCalibur 

software adapted for high resolution. Non-threshold approach was used for reporting 

positive findings. 


A139



Results. Synthetic cannabinoids were reported to have very short half life being 

quickly metabolized to hydroxylated and/or carboxylated metabolites and then 

conjugated with glucuronic acid. Hence the actual parent drugs are not expected to 

be detected. Using mass-accuracy Orbitrap technology we identified the following 

metabolites in the patients’ specimens: JWH-018 N-(5-hydroxypentyl) glucuronide, 

JWH-073 N-Butanoic acid glucuronide, JWH-073-3-OH-glucuronide, Carboxy-THC 

glucuronide. We show total and extracted mass chromatograms at mass accuracy < 

5 ppm for each of these metabolites; for example, JWH-018 N-(5-hydroxypentyl) 

glucuronide 534.2122 vs 534.2123 in positive mode or 532.1977 vs. 532.1975 in 

negative mode. After confrunted with the laboratory results, one patient admitted to 

using Kryptonite herbal product, and the other one admitted to using IZMS herbal 

incense. 

Conclusion We describe a rapid and accurate approach for detection of JWH-018 

and JWH-073 metabolites and/or their conjugates in urine specimens. Given the 

large variety of synthetic cannabinoids that can be available on the drug market, the 

same approach can be used for any other compound regardless of reference standard 

availability. The use of synthetic cannabinoids use can lead to severe side effects, 

hence a laboratory testing for addiction and mental health setting has a significant 

value for patient management. 

A-467 

Performance characterization of a new topiramate immunoassay on a 

high-throughput analyzer 

J. M. El-Khoury, S. E. Lawson, K. E. Lembright, S. Wang. Cleveland 

Clinic, Cleveland, OH 

Background: Topiramate is an anticonvulsant used for the treatment of epilepsy 

and migraines, and various off-label applications such as posttraumatic stress and 

bipolar disorder. Therapeutic drug monitoring of topiramate is helpful for optimizing 

individual therapy, managing comedications, and assessing compliance. Our objective 

was to evaluate a topiramate immunoassay (ARK Diagnostics, Sunnyvale, CA) on a 

Siemens ADVIA 1200 (Siemens Healthcare Diagnostics, Deerfield, IL). 

Methods: Linearity was assessed by spiking a left-over patient serum sample to a 

topiramate level of 60 μg/mL followed by serial dilution with saline and analyzing 

the resulting specimens in triplicate. Intra-assay precision was evaluated by analyzing 

two quality control materials (low and high) included in the ARK reagent package for 

10 replicates a day while inter-day precision was assessed by analyzing three quality 

control materials once a day for 20 days. Accuracy was assessed by comparing results 

of the samples by the ARK immunoassay to a reference laboratory method (n=40, 

ARK Diagnostics on Roche P-modular analyzer) and to a fluorescence polarization 

immunoassay (FPIA) (n=29, Abbott Diagnostics TDX analyzer). 

Results: The assay was linear from 1.0 to 60 μg/mL with recoveries ranging from 

99.2% to 115.1%. No carryover was observed up to 100 μg/mL. Intra- and interassay 

precision were less than 8.7% for all concentrations tested. Two samples were 

lower than the quantitation limit of both FPIA and ADVIA and were not included in 

the correlation analysis. The assay compared favorably with FPIA (TDX) and the 

reference laboratory method (P-modular) as shown in figure 1. 

Conclusion: The ARK Diagnostics immunoassay on Advia 1200 offered reliable 

quantitation for topiramate. 

A-468 

Methanol Quantitation: Evaluating the CATACHEM Methanol 

Enzymatic Assay on an AU400e 

J. M. Juenke 1 , P. I. Brown 1 , K. L. Johnson-Davis 2 . 1 ARUP Institute for 

Clinical and Experimental Pathology, Salt Lake City, UT, 2 2Department 

of Pathology, University of Utah School of Medicine, Salt Lake City, UT 

Introduction: Methanol (MeOH) poisoning is an important and common 

toxicological problem that requires clinical diagnosis. MeOH is commonly found in 

windshield washing fluid, gas line antifreeze, model airplane fuel, solid cooking fuel, 

photocopying fluid, perfumes, and moonshine. MeOH is metabolized to formaldehyde, 

then formic acid. Formic acid is a mitochondrial toxin, working in a similar way as 

cyanide to obstruct oxidative phosphorylation. Ocular toxicity is prominent, causes 

visual effects including blurry vision, loss of color vision, ‘snowfield’ vision, or 

total blindness. Both pancreatitis and renal failure have also been reported. Rapid 

methanol quantification in serum is important to both the diagnosis of poisoning and 

guiding therapy. Serum methanol quantification is not widely available in the hospital 

setting due in large part to the lack of an automated assay. Methanol concentrations 

are determined using chromatographic techniques. An enzymatic assay for methanol 

available through CATACHEM has been able to screen and quantify methanol using 

an automated chemistry analyzer (AU400e). Objective: The MeOH enzymatic 

assay by CATACHEM was evaluated after implementing method parameters for the 

AU400e. 

Methodology: The assay is based on the affinity of the enzyme Alcohol Oxidase 

from bacteria to catalyze the oxidation of methanol to formaldehyde and H2O2, the 

formaldehyde thus produced is subsequently converted to formic acid by the action 

of formaldehyde dehydrogenase in the presence of NAD. This two point kinetic 

procedure is read at 340nm and the increase in absorbance is directly proportional to 

the concentration of methanol. 

Results: The linearity of the assay was evaluated by serial diluting a 100 mg/dL spike 

serum sample. The lower limit of quantitation 5 mg/dL was the lowest concentration 

at which all samples were accurate to 20% of the target concentration. The upper 

limit of quantitation of 145 mg/dL was tested using a patient sample that had been 

confirmed at 145 mg/dL tested in duplicate and was accurate to 20% of the target 

concentration. Precision was performed at four levels over three days (n=15) with 

all CV% less than 9%. Fifty nine samples were correlated with GC-FID, with 16 

samples giving greater than 5 mg/dL results yielding a Deming Regression Equation 

of y=1.08x+3.19, r=0.993, standard error= 3.58. 




Conclusions: The CATACHEM assay may be used to rapidly screen and quantitate 

methanol thereby preventing unnecessary medical treatment when methanol is absent. 

The assay may also be used to monitor decontamination efforts related to methanol 

treatment. 

A-469 

Development of an automated SPE procedure for the measurement of 

serum Celecoxib by LC-MS/MS 

D. W. S. Stephen, I. Clunie, A. J. Dunlop, W. G. Simpson. NHS Grampian, 

ABERDEEN, United Kingdom 

Background: Cyclooxygenase-2 (COX-2)-selective inhibitors, such as Celecoxib 

(Celebrex ® ), have recently found therapeutic benefit not only in the treatment of 

neuroinflammatory and neurodegenerative disorders but also as an alternative therapy 

for pain management. Management of severe pain is usually with opioid-based pain 

medications, such as Codeine or Morphine, but they have significant side effects 

including respiratory depression that has resulted in death. The non-steroidal antiinflammatory 

drug (NSAID), Celecoxib, is devoid of such opioid-related side effects. 

As the use of this alternative medication in pain management has increased, this 

laboratory has received interest in the monitoring of Celecoxib blood concentrations 

in patients receiving the drug to gauge adequacy of therapy whilst striving to avoid 

potential toxic side effects. We have developed a rapid LC-MS/MS method for the 

measurement of Celecoxib in blood samples prepared for analysis using an automated 

solid phase extraction (SPE) technique. 

Methods: Extraction of Celecoxib from serum samples was carried out by an HTS- 

PAL autosampler robot, using disposable ITSP C18 SPE cartridges. Celecoxib was 

quantified by LC-MS/MS via electrospray ionisation (ESI) using multiple reaction 

monitoring (MRM) and Celecoxib-d4 as internal standard. 

Results: The assay was linear over the analytical range 0.5-10,000 ng/mL. Lower 

limits of detection (LLOD) and quantification (LLOQ) of Celecoxib were 0.88 ng/mL 

and 3.34 ng/mL, respectively. Intra-assay (n = 5) and inter-assay (n = 5) imprecision 

of Celecoxib in all samples were 0.05% relative standard deviation (RSD) (r 2 for 

slope of calibration curve 0.9995) and 0.11% RSD (r 2 for slope of calibration curve 

0.9994), respectively. The analytical recovery of Celecoxib spiked into serum was 

>95%. Matrix effect in serum was 3.5% and extracted samples were stable for at least 

14 days at 10°C. 

Conclusion: The described validated LC-MS/MS method for the detection of 

Celecoxib in SPE-prepared serum is a quick and easy procedure for the measurement 

of this drug in samples taken for therapeutic drug monitoring purposes. The method 

can be readily introduced onto a laboratory LCMS system, a technology now available 

to and employed by many clinical laboratories. 

A-470 

Cross-reactivity Assessment of Bath salts in different Immunoassays 

T. Kampfrath, A. Sibio, S. Jortani. University of Louisville, Louisville, KY 

Background: Bath salts, a class of synthetic molecules known as cathinones, are 

the latest drugs of abuse becoming increasingly popular in the United States. They 

are very popular among younger abusers trying to avert detection by the standard 

drug screening procedures. With little information known on their risks and effects 

by the medical community, frequent overdoses, hallucinations, and even death have 

been reported. Currently, the different cathinones are analyzed by gas chromatography 

- mass spectrometry by referral and highly specialized laboratories. Since the 

structures of cathinones are similar to amphetamines, cross-reactivities with common 

immunoassays are expected. Herein, we report on the cross-reactivity analysis of 

three different synthetic cathinones in varies commercial immunoassays used in 

routine drug screening practice. 

Methods: The selected synthetic cathinones for cross-reactivity assessment were 

Mephedrone, MDPV (3,4-methylenedioxypyrovalerone), and Methylone. These 

substances are currently the most prevalent members of the bath salts in the United 

States and were kindly provided by Utak Laboratories Inc. (Valencia, CA). Those 

compounds were added to aliquots of pooled normal human urine at a concentration 

of 10000 ng/mL a typical concentration utilized for cross-reactivity studies with 

unrelated drugs. In addition, one sample contained a mixture of all three cathinones 

at a concentration of 10000 ng/mL each as street drugs are rather a mixture and rarely 

pure. The tested immunoassays were the Roche Integra (Roche Diagnostics GmbH), 

Triage® 8 Drugs of Abuse Panel (Inverness Medical, San Diego, CA) and Beckman 

Coulter Unicel DxC 800 (Brea, CA). 

Results: The Roche amphetamine screen was the only assay that we tested that 

showed cross-reactivity with bath salts. At first, we tested a mixture of Mephedrone, 

MDPV, and Methylone providing a positive result as indicated by a reaction rate of 

1642 while 1000 is set for the cutoff (equivalent in assay reactivity to 500 ng/mL). 

Next, we tested each cathinone separately at a concentration of 10000 ng/mL. Here, 

only mephedrone was able to cross-react and provide a positive result (1060), while 

MDPV (417) and methylone (651) were well below the cutoff limit. None of those 

compounds gave positive results at the 10000 ng/mL cutoff in the Triage® 8 panel 

(amphetamine, barbiturate, cocaine, opiate, benzodiazepine, THC, methadone, PCP) 

and in the Beckman Coulter Unicel DxC 800 (amphetamine, barbiturate, cocaine, 

opiate, benzodiazepine, THC, methadone). 

Conclusion: Out of the three popular bath salts tested, only mephedrone cross-reacted 

in the Roche’s amphetamine screen. Neither of the bath salts tested either alone or 

as a mixture cross-reacted in the Triage or Beckman amphetamine assays. All other 

immunoassay screens resulted in negative results when bath salts were added to the 

urine. Considering the long turn-around time for sending samples for testing bath 

salts, the observed cross-reactivity in the Roche’s amphetamine assay may be an 

advantage since the clinical management of amphetamine and bath salts overdoses 

are similar. 

A-471 

Direct analysis of 26 urinary opioids and metabolites by mixed-mode 

μElution SPE combined with UPLC/MS/MS - Improved performance 

vs. “Dilute-and-shoot” methodology. 

J. Danaceau, E. Chambers, K. Fountain, D. Mason. Waters Corporation, 

Milford, MA 

Background: The analysis of natural and synthetic opioid drugs continues to be an 

important area of analytical research. Typical methods to detect these drugs often 

require enzymatic hydrolysis prior to analysis. However, incomplete hydrolysis can 

result in inaccurate measurement. The method presented herein directly analyzes 

glucuronide metabolites, eliminating uncertainty associated with enzymatic 

hydrolysis. The presented work details a technique for analysis of 26 opioid drugs and 

their metabolites in urine using mixed-mode solid phase extraction (SPE) followed by 

revered-phase UPLC/MS/MS analysis. 

Methods: Urine samples (100 μL) were pretreated with equal parts 4% H 3 

PO 4 

and 

internal standard solution (dissolved in water). After conditioning mixed-mode SPE 

plates, pretreated urine samples were loaded onto the sorbent bed. After washing 

each well with water and MeOH, samples were then eluted with 60:40 ACN:MeOH 

containing 5% NH 4 

OH. Sample eluates were then evaporated to dryness, reconstituted 

in starting mobile phase and injected onto the LC/MS/MS system. 

Results and Conclusions: All analytes eluted in less than 5.5 minutes, and baseline 

separation was achieved for all isobaric compounds. All compounds demonstrated 

excellent linearity, accuracy and precision from 5-500 ng/mL. All calibration 

points fell within 10% of their target values, and %CVs were under 15%. Intraday 

imprecision for quality control samples at 7.5, 75, 250 and 400 ng/mL were all under 

10% CV with only one exception (morphine @ 7.5 ng/mL; %CV = 10.1%), and 

all QC samples deviated by less than 15% from target values. When compared to 

a simple dilution method, mixed-mode SPE resulted in significantly reduced matrix 

effects and improved linearity, accuracy and precision. Authentic urine samples, 

which had been previously analyzed by enzymatic hydrolysis, were also analyzed. 

Comparison of the two methods revealed good agreement for oxycodone and 

hydrocodone, which do not undergo glucuronidation. However, the method described 

here resulted in significantly higher calculated concentrations for total oxymorphone 

and hydromorphone, in agreement with previous reports of incomplete or inconsistent 

hydrolysis of their glucuronide metabolites, and emphasizing the importance of direct 

analysis of these metabolites. 

Disclaimer: This method is intended for clinical research use only, not for use in 

diagnostic procedures 


A141



A-472 

Effect of Piperine extract on Liver function in non-Transgenic Mice. 

J. R. Peela 1 , F. Elshaari 2 , E. Fathoom 2 , M. Elfrady 2 , A. M. Jarrari 2 , S. 

Shakila 1 , H. M. El Awamy 2 , R. Singh 3 , A. Belkheir 3 , S. D. Kolla 4 . 1 Faculty 

of Medicine,Quest International University Perak,, IPOH, Malaysia, 

2 

Department of Biochemistry,Faculty of Medicine,Benghazi University, 

Benghazi, Libyan Arab Jamahiriya, 3 Department of Pharmacognosy,Faculty 

of Pharmacy, Benghazi University, Benghazi, Libyan Arab Jamahiriya, 

4 

Department of Biochemistry,RangaRaya Medical College,NTR University 

of Health Sciences, Kakinada, India 

Background: Piperine extract is isolated form Piper nigrum, popularly known as 

black pepper. Many studies have shown its role in increasing the bioavailability of 

certain drugs especially antibiotics. The present study conducted in our laboratory to 

observe its effect on the assessment of liver function using liver enzymes as specific 

markers of liver function. 

Materials and Methods: 30 non-transgenic mice CF-1 albino mice (strain 023) 

used for this study have been obtained from animal house, faculty of medicine, 

Garyounis University, Begazhi, Libya. All of these mice were categorized into 

two groups. Piperine extract was isolated from Piper nigrum from the department 

of pharmacognosy, faculty of pharmacy, Garyounis University, Bengazhi, Libya. A 

group of 20 mice (test group) were administered the piperine extract for 3 weeks 

and another group of 10 mice (control group) used as controls. Mice from both 

the groups were given similar diet and exposed to similar living conditions. Blood 

for the estimation of liver enzymes, Alanine amino transaminase, Aspartate amino 

transaminase and Alkaline Phosphatase and serum total protein as an indicator of liver 

function, was drawn by cardiocentesis after anaesthetizing the mice with ketamine 

and halothane from test group and control group. Mice from the test group only were 

given the piperine extract orally (5mgs/kg body wt) along with their usual diet for a 

period of 3 weeks. Blood was drawn again from both the groups of mice after a period 

of 3 weeks using the same procedure. Analysis of liver enzymes, Alanine amino 

transaminase, Aspartate amino transaminase, Alkaline Phosphatase (ALP) and Total 

proteins in serum was done using authentic biochemical methods available. 

Results: There was a significant increase in the level of serum Alanine amino 

transferase in mice belonging to the test group than in that of the control group (p 

= 0.0002). Serum Aspartate amino transferase level was significantly increased (p 

= 0.046) in the test group than in that of the controls. Serum Alkaline phosphatase 

levels have also shown a significant increase (p = 0.0001) in test group than in the 

control group of mice. Serum total protein levels have shown a significant decrease (p 

= 0.011) in test group when compared to that in control group. 

Conclusion: Present study has shown a considerable effect on the liver function as 

indicated by a significant elevation in the liver enzymes in spite of its beneficial role 

as an enhancer of bioavailability of various drugs. This study has not only shown 

significant hepatocellular damage, it is also indicating an obstructive phenomenon 

as shown by a significant elevation in serum alkaline phosphatase levels. Further 

research is required to substantiate these findings. A dose dependent hepatic function 

study by feeding a serial dose of piperine is required to observe the effects of piperine 

as a hepatoprotective substance or a hepatotoxic substance. 

A-473 

An improved high performance liquid chromatography-fluorescence 

detection method for the analysis of Pimozide in human plasma 

samples 

A. Barassi, F. Ghilardi, C. A. L. Damele, R. Stefanelli, G. Melzi d’Eril. 

Dipartimento di Scienze per la Salute, Università degli Studi di Milano, 

Milano, Italy 

Background: Tourette Syndrome (TS) is a chronic neurodevelopmental disorder 

characterised by combined motor and vocal tics. Neuroleptic drugs are considered the 

first choice for the treatment of TS. Pimozide represents one of the alternative therapies 

and it is included in the atypical neuroleptic drugs. Since Pimozide has cardiotoxic 

and neurologic adverse effects, the therapeutic drug monitoring is essential. The aim 

of this study was to validate a sensitive, specific and reproducible method using highperformance 

liquid chromatography (HPLC) with fluorescence detection and both 

small volumes of plasma sample and reduced quantities of reagents. 

Methods: The Pimozide working solutions for calibration and controls were prepared 

from the stock solution by adequately diluting in distilled water:methyl alcohol 

(50:50, v/v). The extraction procedure consisted in mixing 500 μL of plasma with 0,5 

mL of sodium hydroxide 1 M and 2,5 mL of n-hexane-isoamyl alcohol (49/1, v/v), 

followed by upernatant evaporation under a continuous nitrogen flow. The samples 

were reconstituted with 200 μL of an ethanol:acetonitrile:water (10:45:45, v/v) 

mixture. The volume injected was 50 μL.The chromatographic separation of Pimozide 

and internal standard (IS), i.e. dextromethorphan hydrobromide monohydrate, was 

performed under isocratic conditions on a ZORBAX Eclipse XDB-C18 column 

(4,5 x 150 mm, 5 μm particle size, Agilent Tecnologies, USA) using the mixture 

acetonitrile:sodium dihydrogen phosphate 50 mM (65:35, v/v) as a mobile phase 

with a flow rate of 1 mL/min. The fluorescence detection was performed at excitation 

wavelength of 285 nm and emission wavelength of 320 nm. Working solutions of 

Pimozide and IS, were obtained from Sigma (Sigma-Aldrich, Germany). The method 

was validated according to the European Medicines Agency guidelines (EMA, 21 

July 2012). 

Results: IS and Pimozide retention times were at 2,66 and 11,56 min respectively. 

Linearity was confirmed into the range 0-100 ng/mL. No carry-over effect was 

observed. The precision evaluation, based on low, medium, high as well as the lower 

and upper limit of quantification, was satisfactory in the range tested, with relative 

standard deviation of 2,5-15,5% for intra-assay and 0,3-7,6% for inter-assay. The 

within-assay accuracy was found between -6,16 and +2,00 and the between-assay 

accuracy was between -5,14 and +5,90. Conclusion: This method was established, 

in course of validation, as precise, accurate, simple, rapid and useful for the limited 

volume of plasma and reagents employed. It is recommended for therapeuthic drug 

monitoring in TS patients. 

A-474 

Performance of the ARKTM Methotrexate Homogeneous 

Immunoassay on the Roche Cobas C-501. 

V. C. Dias 1 , K. Gaeler 1 , D. A. Colantonio 2 , W. Walsh 2 . 1 Department of 

Pathology and Laboratory Medicine, University of Calgary, Calgary 

Laboratory Services, Calgary AB,, Calgary, AB, Canada, 2 The Hospital for 

Sick Kids, Toronto, ON, Canada 

Background: Therapeutic monitoring of Methotrexate (MTX) is indicated in 

patients undergoing treatment of some sarcomas and neoplastic malignancies who 

are on high dose therapy ( >20 mg/kg body weight). In this institution, the monitoring 

protocol involves measuring MTX levels 4h post dose and at 24 h, 48 h, 72 h (and 

96 h if necessary). To avoid serious toxicity, “rescue” treatment with folonic acid 

is administered until serum methotrexate levels are < 0.1 umol/L by 72 h, or until 

delayed excretion criteria is reached at



A-475 

Drug testing in cerebral spinal fluid by mass accuracy mass 

spectrometry: implications for forensic analysis 

A. Rutledge 1 , E. Wong 2 , J. Zeidler 3 , C. Stefan 2 . 1 McMaster University, 

Hamilton, ON, Canada, 2 Centre for Addiction and Mental Health, 

Toronto, ON, Canada, 3 Hamilton Regional Laboratory Medicine Program, 

Hamilton, ON, Canada 

Background: A patient with no significant medical history received an epidural 

anesthesia injection and unexpectedly died a short time later. As part of the 

investigation, a cerebral spinal fluid (CSF) sample was collected and sent for testing. 

Epidurals commonly contain local anesthetics, opiates, and/or opioids, so these were 

the focus of the testing. 

Methods: The CSF sample was diluted ten-fold with water and internal standard 

(cyproheptadine and phenfluramine) was added. 15 μL were then injected into an ultra 

high pressure liquid chromatography (UPLC)-Q Exactive tandem mass spectrometer. 

The UPLC was performed with a pentafluorophenyl reverse-phase pre-column and 

column, using a gradient of 98% water/2% methanol to 5% water/95% methanol over 

15 minutes, containing 10 mmol/L ammonium formate throughout. The Q Exactive, 

manufactured by Thermo Fisher, combines the mass selection capabilities of a 

quadropole with the high resolution, accurate-mass detection of the Orbitrap TM . In this 

case, switching between negative and positive electrospray ionization was used, the 

quadropole was set to scan mass-to-charge ratios of 100-800, and compounds present 

in the sample within this mass range were detected by the Orbitrap, which determined 

their accurate masses within five parts per million. The Q Exactive has many advantages 

over typical liquid chromatography-tandem mass spectrometry systems. First of all, 

the required sample preparation is very quick, easy, and inexpensive, and because 

there is no extraction, there is no loss of compounds. In addition, the Q Exactive 

can effectively perform both targeted and non-targeted searches. For non-targeted 

drug screening, data from a single run of a sample can be reviewed an unlimited 

number of times, comparing the theorectical mono-isotopic accurate mass of a drug 

of interest to the extacted mass chromatogram from the sample for a match. This is 

only possible due to the high degree of accuracy achieved in mass determination with 

the Orbitrap. For targeted drug investigations, for example, to confirm matches from a 

non-targeted approach or to quantify results, a standard (pure solution of a compound 

of interest) can be included in the run to compare retention times, theoretical mass, 

and peak areas to the patient sample. This approach is important to ensure correct 

identification when there are isobaric compounds to be distinguished (e.g. morphine 

and hydromorphone), which cannot be done on mass alone. The data generated from 

running standards can also be added to a library to facilitate identification of that 

compound in future specimens. 

Results: In this case, morphine, bupivicaine, benzocaine, lidocaine, atropine, 

fentanyl, and ondansetron were identified as being present in the CSF sample by nontargeted 

screening. The concentration of fentanyl in the sample was estimated to be 

approximately 5 ng/mL when compared to a fentanyl standard. Another laboratory 

using gas chromatography-mass spectrometry also found morphine and bupivicaine 

in the sample, confirming some of the Q Exactive findings. 

Conclusion: This example demonstrates the vast power of the Q Exactive, which 

can be exploited for identification of drugs in a specimen, especially for forensic 

purposes. The sample preparation required is very simple and accurate identification, 

and potentially quantification, are easily attained. 

some older AEDs (e.g. valproic acid) increases the risk of congenital malformations. 

Therefore, therapeutic drug monitoring for AEDs should play an important role in the 

management of patients on these medicines who become pregnant. Here, we describe 

the measurement of a wide variety of AEDS in two groups, of pregnant women 

(epileptics and bipolar). 

Methods: We measured serum AED levels once per month through out pregnancy in 

both groups using a commercially available mass spectrometry kit (MassTox. TDM 

Series A) from Chromsystems (Munich). The assay system is capable of measuring 26 

different AEDs utilizing a single set of standards and a common extraction protocol. 

Samples are then chromatographed on one of 5 HPLC gradients and analysis by MS/ 

MS. For each drug we plotted the dose to plasma concentration curve and calculated 

apparent clearance and relative clearance. 

Results: Dose to plasma concentration correlations varied widely between the 

different drugs. Almost all the drugs showed an increased clearance in the second and 

third trimester. This was true even for the use of the AEDs in bipolar patients where 

the drugs are used at much lower concentration as adjunct therapy. 

Conclusions: This pilot study demonstrates the utility of therapeutic drug monitoring 

of antiepileptic medications throughout pregnancy and highlights the use of LC-MS/ 

MS in performing these measures. Additionally, the multiplexed MRM assay used 

in the study allows for the analysis of several different AEDs in a single run adding 

efficiencies of staffing and instrument times in the process. 

A-476 

Therapeutic Drug Monitoring of Antiepileptic Drugs During 

Pregnancy 

J. C. Ritchie 1 , P. Scott-Harrell 1 , C. Ramsey 1 , R. Lukacin 2 . 1 Emory University, 

Atlanta, GA, 2 Chromsystems Instrument & Chemicals, Munich, Germany 

Background: Epilepsy is the most frequent neurological disorder worldwide with a 

prevalence of approximately 0.5 % in western countries. Around one quarter of people 

with epilepsy are women of reproductive age and most of them use antiepileptic 

drugs (anticonvulsants, AEDs) for adequate control of their seizures. Additionally, 

anticonvulsants are also used for the treatment of a broad range of other medical 

conditions such as bipolar disorders, cancer, neuropathic pain, anxiety disorders and 

migraines. Recent clinical studies have revealed that physiologic changes during 

different stages of pregnancy may lead to altered pharmacokinetics (especially altered 

clearance) for AEDs and broad individual variations which can result in difficulty 

predicting appropriate drug dosages. It is also well known that fetal drug exposure to 


A143


Hematology/Coagulation 

A-477 




Role of GGT in diagnosis of pulmonary embolism 

Q. Niu, M. Yue, C. Zuo, J. Jia, H. Jiang. West China Hospital of Sichuan 

University, Chengdu, China 

Objective: Increased gama-glutamyl transferase (GGT) level is associated with 

increased oxidative stress, which is the main causes of metabolic syndrome and the 

development of cardiovascular disease. However, the role of GGT in pulmonary 

embolism (PE) is unknown. In this study, we aimed to investigate the relationship 

between GGT and acute PE, expecting to find a new biomarker for laboratory 

diagnosis of acute PE. 

Methods: A total of 62 patients [(20 with confirmed acute PE, 22 with acute 

pneumonia, 20 with acute myocardial infarction (AMI)] and 20 healthy subjects were 

evaluated. Acute pneumonia and AMI patients were included as disease control. GGT 

and D-Dimer were measured with Sysmex CA7000 automatic coagulation analyzer 

and Roche Cobas 8000 automatic biochemical analyzer, respectively. Kruskal-Wallis 

H test and Nemenyi test were performed to detect the differences among groups. 

Spearman’s correlation was used as a test of correlation between GGT and D-Dimer 

in PE patients. P Values less than 0.05 were considered significant. 

Results: GGT level in acute PE group was significantly higher [92.5(29.8~192.5)] 

than that of healthy control [16.0(13.0~24.0)] (P=0.000), as well as those of acute 

pneumonia group [29.0(17.0~54.8)] (P=0.011) and AMI group [29.5(18.8~44.8)] 

(P=0.008). PE patients with negative D-Dimer (D-Dimer



A-481 

Optimising The Use Of A Conversion Factor For Calculation Of Total 

Iron Binding Capacity From Transferrin 

M. Rehan, N. Caruso, J. Beattie, M. Pai, A. Don-Wauchope. McMaster 

University and Hamilton Regional Laboratory Medicine Program, 


Introduction Transferrin is the body’s primary iron-transport protein, and 

measurements of transferrin saturation (TS) are useful in the investigation of anemia 

and iron overload. Total iron binding capacity (TIBC) is the maximum amount of 

additional iron needed to saturate transferrin, and is an indirect way of assessing 

transferrin. Theoretically, 1 mol of transferrin binds 2 mol of ferric iron, yielding 

a ratio of TIBC (in μmol/L) to transferrin (in g/L) of 25.1. However, the literature 

reported mean ratio ranges from 17.6 to 29.2, depending upon the precision and bias 

of the analytic method. 

The Hamilton Regional Laboratory Medicine Program (HRLMP) recently moved from 

the Roche Modular platform, which measured serum and plasma iron and unsaturated 

iron binding capacity (UIBC; which when added to serum iron yields the TIBC) using 

a colorimetric assay, to the Abbott Architect platform, which measures plasma iron 

and transferrin using colorimetric and immuoturbidometric assays respectively. Our 

objective was to determine the ratio of TIBC to transferrin using these two analytic 

platforms, in order to calculate TIBC using an optimal conversion factor. 

Method Routine blood samples received at the HRLMP over a three week period 

(Oct/Nov 2012) were used to randomly select approximately 80 samples in each 

of three groups (low, high and within reference interval iron and ferritin). These 

were subsequently analyzed for iron and UIBC on the Roche Modular and iron and 

transferrin on the Abbott Architect. 

Three methods were used to establish a conversion factor to calculate TIBC 

from transferrin. First, weighted linear fit was used to calculate a constant and a 

proportional bias, which were added together to get a conversion factor. Second, 

each measured TIBC was divided by the corresponding measured transferrin to get 

individual conversion factors, which were then averaged. Third, the sum of all TIBCs 

was divided by the sum of all transferrins to get a conversion factor. 

Result 238 samples were available for analysis. Eleven samples were excluded due 

to missing values and 8 outliers were excluded after reviewing the scatter plot. The 

weighted linear fit, using transferrin on the x-axis and TIBC on the y-axis, showed 

proportional bias of 21.32 and constant bias of 1.81. The sum yielded a conversion 

factor of 23.1. Conversion factors of 22.2 and 21.2 were derived using the second and 

third method, respectively. 

Individual values of transferrin were then multiplied by each of the conversion factors 

to calculate TIBC. Descriptive statistics and box and whisker plots of the results were 

reviewed. The factor of 22.2 derived from individual patient results matched the 

Roche-derived TIBC most closely. 

Conclusion Our derived factor of 22.2 is optimal for calculating TIBC from 

transferrin, and will minimize the impact of our transition from Roche Modular to 

Abbott Architect platforms on clinically important results. There is no analytical 

standard to assess transferrin saturation and thus, we recommend that laboratories 

derive in-house conversion factors, instead of relying on theoretical ratios. 

A-482 

Measurement of zinc protoporphyrin and non-complexed 

protoporphyrin in human erythrocytes by liquid chromatography 

K. M. Kloke, M. J. Magera, P. A. Chezick, K. M. Raymond, S. Tortorelli. 

Mayo Clinic, Rochester, MN 

Background: Erythrocyte (RBC) porphyrins consist almost entirely of 

protoporphyrin. Increased RBC non-complexed (free) protoporphyrin (FPP) 

is characteristic of erythropoietic protoporphyria (EPP). In X-linked dominant 

protoporphyria (XLDPP), both FPP and zinc protoporphyrin (ZPP) are increased. Iron 

deficiency anemia is the most common cause of increased RBC ZPP with other causes 

being related to chronic intoxication caused by exposure to heavy metals, halogenated 

solvents, some pesticides and medications. Therefore, when total RBC porphyrins are 

elevated, fractionation and quantitation of ZPP and FPP is necessary to differentiate 

the inherited protoporphyrias from other potential causes of elevations. Current 

laboratory evaluations may consist of a total porphyrin determination, measurement of 

ZPP by hematofluorometry or a combination of two extractions: the first to determine 

the total porphyrin concentration via spectrophotometry and a second to determine 

ZPP and FPP utilizing high performance liquid chromatography (HPLC). Results 

from the total and the fractionation are combined to calculate the concentration of 

each protoporphyrin fraction. These differential and step-wise approaches often 

yield incomplete or inefficient and time-consuming characterizations. We describe 

a simplified method using a single extraction and measurement of ZPP and FPP by 

HPLC technology alone. This modified approach has lowered the amount of supplies 

and reagents used (~40%) and decreased technologist time required to prepare the 

samples (~50%). 

Methods: One hundred μL of washed erythrocytes was added to 200 μL of water 

to lyse the cells. Porphyrins were extracted from the sample using 1 mL of ethyl 

acetate: acetic acid (80:20, v:v). After vortexing and centrifugation, 25 μL of the 

supernatant was injected onto a HPLC system with fluorescence detection (Shimadzu 

Corporation, Columbia, Maryland). The excitation wavelength was set at 408 nm 

with an initial emission wavelength at 589 nm, switched to 632 nm after 6 minutes. 

The analytical time was 10 minutes for an isocratic elution using methanol: aqueous 

phosphate buffer, pH 3.5 (90:10, v:v). 

Results: Method performance was demonstrated through imprecision, linearity, 

recovery and specimen stability studies. Intra-run imprecision coefficients of 

variation (CVs) ranged from 2.0% to 5.7% for ZPP and 0% to 6.2% for FPP. Interrun 

imprecision CVs for ZPP ranged from 6.9% to 8.9% and 0% to 4.5% for FPP. 

Linearity studies were performed using standard solutions of known concentrations. 

Linearity was demonstrated for each analyte over the range 10 to 250 μg/dL, yielding 

the following relationships: y ZPP 

= 0.896x + 3.44, R 2 = 0.9979; y FPP 

= 1.053x + 

0.4772, R 2 = 0.9994. Recoveries averaged 79% for ZPP and 89% for FPP across the 

analytical measurement range. A stability study demonstrated that ZPP and FPP in 

washed erythrocyte specimens are stable without any significant change in analyte 

concentration at ambient, refrigerated and frozen (-20ºC) temperatures for up to 14 

days and through 3 freeze/thaw cycles. 

Conclusion: This streamlined evaluation by HPLC is a cost effective method 

modification providing simultaneous, rugged and reliable analysis of zinc 

protoporphyrin and non-complexed protoporphyrin in washed erythrocytes for the 

differential evaluation of an inheritable protoporphyria versus other causes. 

A-483 

Nitric oxide synthase (NOS) in thin films as a nitric oxide-generating 

coating to counteract thrombosis on medical devices 

B. Gunasekera, M. Bayachou. Cleveland State University, Cleveland, OH 

Thrombosis is a major problem on blood-contacting medical devices. Artificial 

coatings releasing small amounts of nitric oxide (NO) are known to counteract platelet 

adhesion, and the thrombosis cascade. Sources releasing NO have been proposed 

as coatings for blood-contacting devices. We proposed a novel approach using 

recombinant NOS in thin layers, which generate NO using substrates from blood 

or the bathing medium. We first introduced the Layer-by-layer (LbL) adsorption of 

inducible NOS oxygenase domain (iNOSoxy) on polyethylenimine (PEI) matrix. In 

the current work, we study the effect of pH and matrix structure on NOS loading onto 

LbL coatings. We also study the effects on the catalytic efficiency of immobilized 

NOS and the resulting NO fluxes. 

We examined how the pH of the protein solution modulates the amount of iNOSoxy 

adsorbed onto a PEI-coated surface. We also examined whether the charge density 

of PEI matrix can modulate enzyme loading. We used iNOSoxy solutions and both 

linear and branched PEI solutions to investigate the charge-driven immobilization. 

We used Fourier Transform infrared spectroscopy (FTIR) to characterize immobilized 

iNOSoxy films. 

Atomic force microscopy (AFM) suggests more iNOSoxy immobilized on films 

formed at pH 8.6 or using the branched version of the PEI matrix. 

We used catalytic reduction of exogenous NO mediated by immobilized iNOSoxy as 

a measure of activity. Results show higher activity for films immobilized at pH 8.6 

compared to pH 7. We monitored NO release using the Griess assay. Again, results 

show higher levels of NO released from films constructed with iNOSoxy solution 

at pH 8.6 compared to pH 7. Also, a higher average NO flux is observed from PEI/ 

iNOSoxy LbL films having the branched version of PEI as opposed to the linear form. 

We will discuss these findings in light of platelet adhesion from platelet-rich plasma 

on surfaces coated by the films. 


A145



A-484 

Serum free light chain (SFLC) ratio and serum protein electrophoresis 

(SPEP) as a substitute for 24-hour urine paraproteinuria in phase I 

myeloma patients. 

N. N. Shah 1 , J. Kaufman 2 , A. Langston 2 , E. Waller 2 , L. Boise 2 , R. Harvey 2 , 

S. Lonial 2 , A. Nooka 2 . 1 Emory University, Atlanta, GA, 2 Winship Cancer 

Institute, Emory University, Atlanta, GA 

Background: Paraprotein estimation in myeloma patients includes testing SPEP, 

immunofixation (SIFE), SFLC ratio, and 24-hour urine collection for UPEP and 

UIFE. 24-hour urine collection is a cumbersome process. Prior studies evaluating 

its substitution with SFLC ratio and SPEP had limitations of including variety of 

plasma cell dyscrasias and both newly diagnosed and relapsed/refractory myeloma. 

We evaluated if SFLC ratio and SPEP can substitute for 24-hour urine collection in 

a homogenous population of advanced myeloma patients, where a shift in secretion 

from intact immunoglobulin to SFLC (free light chain escape) is observed. 

Methodology: We analyzed 116 myeloma patients that enrolled in a phase I clinical 

trial between 08/2006-12/2012 with SPEP, SIFE, SFLC ratios, UPEP and UIFE. 

Sensitivity of testing for SFLC ratios, SPEP and SIFE were compared to UIFE. 

Subsequently, we assessed the linear relationship between SFLC dichotomized by 

abnormal ratio (1.65) vs. 24-hr paraproteinuria. We used SAS version 9.3 

for analysis. 

Results: The sensitivities of SPEP, SIFE and abnormal SFLC ratio assays were 77%, 

95% and 96%, respectively. The sensitivity of SFLC+SPEP/SFLC+SIFE increased 

to 100% enabling detection of paraprotein in all patients (Table 1). In our second 

analysis, the quantification of SFLC correlated with 24-hr urinary paraprotein 

estimation. With every log increase in lambda and kappa light chains, 24-hr urinary 

paraprotein log increased by 0.52 times (p



A-486 

Expansion of a Multisite, Advanced Analytical QC Program to include 

Prothrombin Time Testing using Sigma Statistics Based on Auto- 

Generated Peer Values. 

H. H. Harrison, D. Young, D. Sargent, J. Labarbera, C. Fereck, W. Fitt, D. 

Kimmich, D. Kremitske, M. Lopatka, S. Sharretts, K. Smeal, P. Dorion, R. 

Rolston, M. Wilkerson, E. Yu, J. Jones. Geisinger Medical Laboratories, 

Danville, PA 

Background:: We have previously described an electronically integrated method 

of QC standardization that includes application of the Westgard sigma statistics and 

OPspecs approach to selection of QC rules for chemistry analyzers across eleven 

Geisinger Medical Laboratories in central PA. The objective of the present project 

is expansion of this enterprise-wide advanced analytical QC (AAQC) approach to 

coagulation assays, namely prothrombin time. In contrast to chemistry QC data, the 

coagulation control materials have no publically available peer performance data. 

However, with thirteen coagulation instruments, there were sufficient data to autogenerate 

a peer group of target means within GML. 

Methods: In preparation we validated a systemwide reference range using the same 

lot of Neoplastine activation reagent, and then had all labs use the same lot of QC 

material. A single vendor (Diagnostica Stago) was source for the instrumentation, 

which included the Evolution (2), Compact (4), Satellite (1), and Start4 (7); and the 

control materials (Coag N and Coag ABN). 

Results: Three months of daily QC data were used to establish the baseline 

prothrombin time (sec) peer group targets and sigma values shown below: 

BASELINE PEER GROUP DATA: Oct ‘12 Nov ‘12 Dec ‘12 

COAG NORMAL: Mean 13.0 13.0 13.0 

Std Dev 0.40 0.41 .019 

CV 3.08% 3.15% 1.46% 

COAG ABNORMAL: Mean 36.9 36.9 36.6 

Std Dev 1.23 1.34 1.03 

CV 3.33% 3.63% 2.81% 

BASELINE SIGMA VALUES: (N=9) (N=11) (N=11) 

COAG NORMAL: Mean σ 7.8 8.4 8.5 

COAG ABNORMAL: Mean σ 7.3 7.3 6.9 

We found day-to-day variation of less than 4% for both controls. Site-specific mean 

deviations are all well within the 15% CLIA criterion for TEa, with only 3 of 62 in 

excess of 6.1%. 

Conclusion: Baseline sigma values achieved with the Stago instruments are 

consistently in excess of 4, the value used as the threshold for widening the initial 

QC warning to 1-3s. Accordingly we have adjusted the QC acceptance criteria for the 

prothrombin time assays and are now compiling the initial enterprise-wide data for 

1-3s events to test the hypothesis that, as with previously adjusted chemistry rules, the 

new QC rules will result in a reduction of 60 to 80% false QC “stops” and associated 

workflow disruption. 

A-487 

Quality Control Practices in Ontario Coagulation Laboratories 

B. Aslan 1 , A. Raby 1 , K. Moffat 2 , R. Selby 3 , R. Padmore 4 . 1 Ontario Medical 

Association, Quality Management Program – Laboratory Services (QMP- 

LS), Toronto, ON, Canada, 2 Hamilton Regional Laboratory Medicine 

Program, Hamilton, ON, Canada, 3 Sunnybrook Health Sciences Centre 

and University Health Network, Toronto, ON, Canada, 4 Ottawa Hospital 

- General Campus, Ottawa, ON, Canada 

Background: Quality control (QC) procedures are crucial in reporting accurate 

patient test results. QMP-LS provides an external quality assessment program for 

Ontario laboratories. In 2012, a patterns-of-practice survey was conducted to gather 

and share information on current quality control practices for coagulation testing and 

to assess and provide guidance on recommended practices. 

Methods: A web-based survey questionnaire was distributed to 174 laboratories that 

are licensed to perform prothrombin time (reported as an international normalized 

ratio) (PT/INR) and activated partial thromboplastin time (APTT) in Ontario. All 

laboratories responded. 

Results: All laboratories use commercial QC materials, obtained from the analyzer’s 

manufacturer (75%) or another source (32%). 12% also use an in-house QC 

comprised of pooled patient plasma. Most laboratories (PT/INR [69%] and APTT 

[68%]) run commercial QC at the beginning of each shift and 25% of laboratories 

run QC when the analyzer has not been in use for a certain length of time. A small 

number of participants (PT/INR [6%] and APTT [7%]) only run commercial QC at 

the beginning of the day. In addition, other participants (PT/INR [59%] and APTT 

[55%]) run QC following maintenance, reagent change, middle of each shift, and with 

every repeat sample. Laboratories determined the frequency of performing QC based 

on manufacturer recommendations (PT/INR [71%] and APTT [70%]). Other factors 

influencing the frequency of the QC run included stability of test (PT/INR/APTT 

[27%]), clinical impact of incorrect test result (PT/INR [25%] and APTT [24%]), 

and the number of samples potentially requiring repeat analysis (PT/INR [10%] and 

APTT [11%]). Of note, 72 (41%) laboratories reported other frequency determinants. 

Of these, 72% use Ontario Laboratory Accreditation (OLA) requirements, 6% use 

other guidelines, and 22% use either directive from the laboratory director, past 

practices and/or the length of the workday. All laboratories use preset QC limits for 

the assessment of QC results. These limits are based on precision goals provided 

by manufacturers (46%), standard deviation of the QC results (66%), published 

precision goals (26%), and QMP-LS allowable performance limits (20%). 51 % use 

combination of more than one sources. For the PT/INR, 107 laboratories reported 

precision goals as the coefficient of variation (% CV). Of these 59% use 5% CV while 

29% use less than, and 12% use greater than 5% CV. For APTT, 100 laboratories 

reported precision goals as % CV, 45% use 5% CV, 41% use less than 5% and 14% 

use between 6-25% CV. 

In the case of QC failure, 97% (n= 168) of the laboratories repeat the QC, if it passes 

results are reported, 95% (n=166) open new QC, 93% (n=161) look for trending, 

90% (n=156) discontinue testing, and 42% (n=73) repeat all patient samples from 

last acceptable QC. 

Conclusion: These data illustrate the wide variability in QC practices for coagulation 

testing in Ontario. In 2013, the QMP-LS Hematology Scientific Committee will 

publish a Consensus Practice Recommendation to help reduce the variation in practice 

and encourage best practices. 

A-491 

Novel haemostatic biomarkers in acute cardioembolic stroke 

I. Kitajima, K. Hirano, N. Tani, K. Tanaka. University of Toyama, Toyama, 

Japan 

Background: We studied the usefulness of haemostatic biomarkers in assessing the 

pathology of thrombus formation, subtype diagnosis, prognosis in the acute phase of 

cerebral infarction, and differences between various haemostatic biomarkers. 

Methods: Our study included 69 patients (50 men and 19 women; mean age 68±12.0 

years) with acute cerebral infarction who had been hospitalized within 2 days of 

stroke onset. Fibrin monomer complex (FMC), thrombin-antithrombin complex 

(TAT), D-dimer, and fibrin/fibrinogen degradation products (FDP) were assayed as 

haemostatic biomarkers on days 1, 2, 3 and 7 of hospitalization. FMC, D-dimer and 

FDP were assayed by turbidimetric immunoassay (TIA), and TAT was measured 

by time-resolved fluoroimmunoassay (TR-FIA). Changes over time in FMC, TAT, 

D-dimer and FDP were analyzed using the paired t test. p



A-492 

CBC PARAMETER PRECISION PROFILES FOR UNICEL DXH 

HEMATOLOGY SYSTEMS 

L. Tejidor, R. Magari, K. Lo, P. ONeil. Beckman Coulter, Miami, FL 

Introduction: Instrument validation includes the evaluation of system precision 

throughout the measuring range including medical decision levels. The concept of 

precision profiles is referenced in CLSI H26-A2, with CLSI EP5-A2 providing the 

fundamental definition for estimating repeatability. Hematology parameters have 

several medical decisions levels, making it necessary to characterize precision 

throughout the measuring range. Characterizing system precision also provides 

information for the determination of the lower limit of quantitation, and establishing 

claims at those levels. Using a method established by the authors (Magari, Lo, Tejidor) 

an assessment of the CBC parameters on the DxH Series of Hematology systems 

was evaluated providing an estimate of system precision throughout the parameter 

measuring range using precision profiles. 

Method: Blood samples from a multi-center study consisting of normal, abnormal and 

prepared samples covering the measuring range were used in the study. Ten replicates 

were collected for each sample. Precision profiles were based on the relationship 

between the mean for each sample and the coefficient of variation (CV%), and were 

modeled with a power functions as: 

CV = α Mean β + ε 

Where α and β were the parameters of the model and ε was the random error. SAS 

statistical software was used for analysis. Precision profiles were estimated for the 

CBC hematology parameters. Precision performances at different medical decision 

levels along with their 95% confidence upper bounds were also included. 

Results: Throughout the measuring range, the precision performance (CV%) was not 

constant for the CBC count parameters. PLT CV% increased to 15.8% at the lower 

limit of quantitation, 3.45 x 10 6 cells/uL. WBC CV% at an ultra-low level of 0.05 x 

10 3 cells / μL was 11.6% with an upper 95% confidence limit of 13.1%. WBC CV% 

at 396.4 x 10 3 cells / μL was 0.25% with an upper 95% confidence limit of 0.31%. 

Precision performance specifications were met for all CBC count parameters. 

Conclusion: Estimating the precision of hematology parameters across the measuring 

range using precision profiles provides an improved visualization of system precision 

for parameters at clinically relevant levels. Using a multitude of samplings, precision 

profiles provide a greater degree of confidence over the routine analysis consisting 

of a small number of replicates and reduces the potential for errors. The precision 

profiles provided represent typical responses for the CBC parameters as performed on 

DxH Series Hematology systems under routine laboratory conditions. Instrument and 

laboratory conditions are variables that should be considered as they may contribute 

to the actual precision performance results obtained. 

A-493 

Evaluation of Data Segmentation Results using Metrics on Beckman 

Coulter CytoDiff Application in HematoFlow Solution 

C. Ramirez, C. Godefroy, J. Riley, E. Gautherot, G. Bouvier-Borg, J. 

Naegelen, P. ONeil. Beckman Coulter, Miami, FL 

Background: The CytoDiff analysis software automates the analysis of the 10-part 

WBC differential provided by the flow cytometry system on the Beckman Coulter 

HematoFlow solution eliminating the need for manual gating. The CytoDiff CXP 

software provides new metrics that assess the degree of certainty in the automated 

population classification. 

Methods: The software encompasses two histogram based confidence metrics: a 

region separability score and a data distribution score. The region separability score is 

used to analyze the data along the boundary of a region and can be applied to detect 

poorly separated clusters of data. The data distribution scored is used to analyze the 

behavior of the data within the region and is useful to establish the similarity of the 

data to a known distribution (e.g. Gaussian). Low scores on data distribution might 

be caused by noise, debris or events originating from a bigger population rather than 

from a pure data cluster. 

Population based confidence metrics collect and summarize the information from 

independent metrics. Histogram based metrics for each of the regions involved in the 

identification of a population are combined to take into account their interdependency. 

Other metrics, such as estimated percent of aggregation, template matching score or 

the like are also incorporated in the population based metric. Metrics are weighted to 

account for their numerical significance. The CytoDiff software provides a population 

based confidence metric for each of the populations in the 10-part Differential. 

Results: 844 CytoDiff sample runs collected along with Manual reference were 

analyzed to characterize the behavior of the Blast confidence score metric when 

plotted against the difference between the reported CytoDiff Total Blast % and the 

Manual Reference Blast %. Polynomial models are used to capture the overall data 

behavior. 

The data shows a tendency for samples to have a low Blast confidence score as 

the numerical difference between the two methods increases. The data was divided 

according to the amount of Blast % reported in the Manual reference. 

Conclusion: The CytoDiff analysis software provides a set of metrics (i.e., numerical 

values) used in conjunction with other parameters to assess the certainty of the 

population classification, thus enhancing the laboratory’s review and auto-validation 

of process. 

CytoDiff is not available for in vitro diagnostic use in the United States. 

A-494 

The Stability of Anti Xa Activity on Frozen Plasma Samples For a One 

Year Period 

K. Finnegan, G. Hornstein, D. Kochhar, T. Smith. Stony Brook University, 

Stony Brook, NY 

Laboratories routinely freeze plasma samples for coagulation reflex testing; however, 

the stability of Anti-Xa activity has not been measured over the long-term. Heparin 

and LMWH are anticoagulants that can be monitored using an Anti-Xa assay. The 

study was initiated to validate the integrity of frozen samples, thawed and tested at day 

1, month 1, month 3, month 6 and one year when performing an Anti-Xa assay using 

a chromogenic method. One-hundred and three plasma samples were acquired from 

patients on heparin between ages 35 and 65 with Anti Xa values ranging from 0.1. to 

1.15 IU/ml. Using a pre-calibrated pipette, 0.5 mL aliquots were transferred to labeled 

micro-centrifuge tubes, and subsequently frozen at -70⁰C (with the exception of day 1 

which was tested upon arrival to the laboratory). On respective testing days, samples 

were thawed in a 37⁰C water bath for five minutes. The Anti Xa assay was performed 

on a STA Compact® with STA Rotachrom Heparin®; STA Heparin Control®; STA 

Quality HBPM/LMWH®; STA Hepanorm H (UFH) ®; and STA Calibrator HBPM/ 

LMWH®. Assays were performed in singlicate and the values were compared at day 

1, month 1, month 3, month 6 and one year by linear regression. Linear regression 

analysis demonstrated a strong correlation between day I and one year values (R 2 ). An 

R 2 value of .98, .96, .97, and .98 was observed when comparing results for day 1 with 

month 1, month 3, month 6, and one year respectively representing a strong linear 

association, or little change in the amount of active heparin. 

Linear Regression 

N Slope Intercept R 2 

Month 1 102 .969 -0.0149 .978 

Month 3 103 .972 -0.0011 .961 

Month 6 103 .980 0.0216 .974 

One Year 76 .976 -0.0027 .980 

Our Conclusion is that frozen plasma thawed and tested at day 1, month 1, month 3, 

month 6 and one year yields stable laboratory results when analyzing Anti-Xa activity. 

A-495 

Prognosis of Chronic Myelogenous Leukemia and Acute Lymphoblastic 

Leukemia patients with BCR-ABL Fusion Gene subtypes 

Y. Ye, J. Zhou, Y. Zhou, X. Song, Y. Zhou, J. Wang, l. Lin, B. Ying, X. Lu. 

West China hospital of Sichuan university, Chengdu, China 

Background: It is now reported that about 15-20% adult acute lymphoblastic leukemia 

(ALL) have the characteristic t(9;22)(q34;q11) cytogenetic other than 90-95% cases 

of chronic myeloid leukemia(CML) and different subtypes were found such as M-bcr, 

m-bcr and μ-bcr. It is known that CML patients show a higher prevalence of M-bcr 

and ALL patients show a higher prevalence of m-bcr, but the relationship between 

BCR-ABL subtypes in progression of CML and ALL is still not fully understood. In 

this study, clinico-biogical risk factors were collected and assessed in order to make a 

preliminary investigation on the relationship between BCR-ABL subtype and patient 

feature in different disease entities. 




Methods: 349 CML chronic phase(CML-CP) patients and 71 ALL patients before 

treatment detected as BCR-ABL fusion gene positive were involved in this study and 

were divided into M-bcr , m-bcr and mixed group. Clinico-biogical risk factors at 

diagnosis were collected and assessed in order to make a preliminary investigation 

on the relationship between BCR-ABL subtypes. To further analysis the relationship 

between BCR-ABL subtype and prognosis for CML and ALL patients, patients under 

imatinib treatment were followed with BCR-ABL relative concentration collected after 

3 months, 6 months, 9 months and 1 year. 

Results: Our results indicates that there are significant difference between CML-CP, 

CML-BP and ALL group (p 455 AU, on the base of cut-off value, determined by ROC analysis (area under the 

curve was 0.864, with 0.84 specificity and 0.78 sensitivity). We studied 54 patients 

with good response to chronic daily 75 mg clopidogrel and 81 mg aspirin therapy after 

coronary artery stenting and 50 patients with low response and HPR. Blood samples 


A149



were drawn into tubes containing hirudin at least 14 h after the loading or maintaining 

doses of clopidogrel. Genotyping of the CYP2C19*2 (681 G>A) and 2C19*17 (-806 

C>T) variants was done by TaqMan SNP assay. 

Results: Compared with normal response (ADP-test 220±80 AU), the thienopyridine 

treatment was switched from clopidogrel to prasugrel 10 mg/d (ADP-test 250±82 

AU) in 36 of 50 patients with HPR (ADP-test 660±95 AU). Three out of the nonresponder 

patients required higher maintaining dose of prasugrel (15 mg daily). At 

least one CYP2C19*2 allele was present in 53 of all 104 patients genotyped: the 

*2 allele frequency was higher in low response patients (HPR) than in patients with 

good response (37/100 (37.0 %) vs. 18/108 (16.7 %), Chi 2 11.04, p < 0.05). The 

CYP2C19*17 allele was found in 44 patients: the *17 allele frequency was similar in 

both groups studied (25/108 (23.1 %) vs. 23/100 (23.0 %), Chi 2 0.00, p = n.s.). 

Conclusion: Carriers of CYP2C19*2 allele have higher platelet reactivity and show 

good response to prasugrel than non-carriers. 

A-500 

A clotting AT assay insensitive to Heparin Cofactor II 

M. Goldford, N. Nnachi. r2 Diagnostics, Inc., South Bend, IN 

Background: ThromboTek AT, an APTT based factor assay, is a patented clotting 

AT assay under development as an alternative to expensive chromogenic AT assays. 

Because the penultimate reaction in any clotting assay is fibrinogen cleavage by 

generated thrombin, this study was undertaken to determine any possible interference 

from Heparin Cofactor II. HCII was shown in the early 1980’s to interfere in human 

thrombin based chromogenic AT assays of that era and caused a 10-15% overestimation 

of AT concentration. Most current AT assays use either bovine thrombin or bovine 

FXa to circumvent this concern. 

Methods: Two experimental approaches were taken. In the first, dilution series of 

pooled plasma were prepared with either IBS or IBS supplemented with 90 ug/mL 

of purified HCII, the physiologically normal concentration of HCII in plasma. In 

the second approach dilution series of pooled plasma in AT deficient plasma were 

prepared and supplemented with either a neutralizing antibody to human HCII or a 

non immune antibody. 

The experiment with added HCII was tested on the STA Compact, and included 

an arm wherein the samples were also tested with the bovine FXa based Stago 

STACHROM ATIII chromogenic assay. The experiment with added neutralizing 

antibody was tested on the Stago ST4. Regression and analysis of covariance of the 

data were performed with JMP version 7 by SAS. 

Results: The 95% confidence intervals of the slopes and intercepts of the added HCII 

experiment using the ThromboTek AT assay showed considerable overlap, suggesting 

coincident regression lines of the measured AT regardless of the experimental 

treatment. In contrast, while the 95% CI for the slopes of the STACROM ATIII assay 

also showed considerable overlap, the 95% CI of the intercepts were non overlapping, 

suggesting parallel slopes with a biased intercept of these regressions. The ANCOVAR 

p value of the treatment effect of HCII was 0.044 for the ThromboTek assay and 

0.0001 for the Stago assay. The 95% CI of the slopes and intercepts of the neutralizing 

antibody experiment with the ThromboTek assay also showed overlapping slopes and 

intercepts, again suggesting coincident regression lines. The ANCOVAR p value of 

the treatment effect of the antibody was 0.172. 

Conclusion: 

We see in the added HCII experiment that the ThromboTek AT assay shows no more 

sensitivity to HCII than the bovine FXa based STACHROM assay, and see no HCII 

effect in the neutralizing antibody experiment. We conclude that HCII does not 

interfere in the ThromboTek AT assay. 

A-501 

Comparability of the Bloodhound Integrated Hematology System to 

the Sysmex XE5000 

D. Zahniser 1 , J. Linder 2 , M. Zahniser 1 , D. Bracco 3 , T. Allen 3 , J. W. 

Winkelman 4 . 1 Constitution Medical Inc, Boston, MA, 2 University of 

Nebraska Medical Center, Omaha, NE, 3 Constitution Medical Inc, 

Westborough, MA, 4 Harvard Medical School, Boston, MA 

INTRODUCTION: The Bloodhound Integrated Hematology System (Constitution 

Medical Inc., Westborough, MA, USA) employs a proprietary method to perform an 

automated CBC, WBC differential and reticulocyte count by applying undiluted whole 

blood onto a microscope slide and staining the resultant monolayer. The instrument 

then uses multispectral image analysis to count and classify cells, and determine other 

CBC parameters. The Bloodhound Instrument does not use impedance, conductance 

or laser-based methods for cell measurement. For specimens “flagged” for potential 

abnormality, data and images from a 600 cell WBC differential count, as well as RBC, 

PLT and other cells are available for a technologist to view on a computer monitor 

if “flagged” for potential abnormality. This study assesses the comparability of the 

Bloodhound Instrument to a widely used automated hematology analyzer. 

METHOD: This study was performed on over one-thousand (1,183) whole blood 

samples including normal and abnormal specimens from patients seen at an academic 

medical center. Samples were processed on both a Sysmex XE-5000 (Sysmex 

Corporation, Kobe, Japan) and on a Bloodhound Instrument to assess comparability 

(r) between the two systems for thirteen (13) common parameters. This study was 

performed consistent with the ICSH Guidelines, and CLSI H26-A2 and CLSI EP9-A2 

standards 

RESULTS: Correlation of Bloodhound Instrument and Sysmex XE5000 

Parameter r Slope Bias 

WBC 0.99 1.04 0.07 

RBC 0.99 0.95 0.03 

HGB 0.99 1.02 -0.07 

MCV 0.90 1.06 -0.43 

HCT 0.97 1.04 -0.15 

MCH 0.99 0.99 -0.25 

PLT 0.98 0.99 -4.08 

MPV 0.85 0.99 -0.28 

NEUT 0.98 0.99 1.68 

LYMPH 0.98 0.96 -2.02 

MONO 0.82 0.89 0.57 

EO 0.97 0.97 0.04 

BASO 0.69 0.92 0.20 

CONCLUSION: The Bloodhound Instrument shows excellent comparability 

to a widely used automated hematology analyzer. The variation in results between 

these two instruments was similar to that typically seen between different instrument 

platforms for all of the common CBC parameters. These data indicate that the 

innovative technical approach of a slide-based CBC and WBC differential by 

the Bloodhound instrument performs well over a wide range of specimens types 

and compares favorably to existing technologies. *The Bloodhound Integrated 

Hematology System is under development and is not currently cleared by the Food 

and Drug Administration. 

A-502 

Imprecision Study of the Bloodhound Integrated Hematology 

System 

D. Bracco 1 , K. Horton 1 , D. Zahniser 1 , W. Swinehart 1 , M. Braga 1 , T. Allen 1 , 

J. W. Winkelman 2 , J. Linder 3 . 1 Constitution Medical Inc, Westborough, MA, 

2 

Harvard Medical School, Boston, MA, 3 University of Nebraska Medical 

Center, Omaha, NE 

INTRODUCTION: The Bloodhound Integrated Hematology System (Constitution 

Medical Inc., Westborough, MA, USA) employs a proprietary method to perform 

an automated CBC and WBC differential by applying undiluted whole blood onto 

a microscope slide, staining the slide then using multispectral image analysis to 

count and classify cells, including nRBC and reticulocytes, and determine other CBC 

parameters, such as HGB, HCT, MCV, MCH and MPV. This study evaluated the 

imprecision of the Bloodhound Instrument across a wide range of normal samples and 

in various abnormal samples at medically important decision thresholds 

METHOD: The study was run according the ICSH Guidelines to determine 

imprecision (%CV). Nine (9) whole blood samples with sufficient volumes were 

collected from the routine workload at an academic medical center for each of the 

following ranges: WBC (x10 3 /μL) 2.0- >25.0, RBC (x10 6 /μL) 3.0 - >5.5, HGB (g/ 

dL) 10- >16.0, PLT (x10 3 /μL) 50- >400. Additionally, three (3) abnormal whole blood 

samples were collected for each the following abnormal conditions in the ranges 

specified: Anemia- 6-10 g/dL HGB, Thrombocytopenia-



CONCLUSION: The imprecision of the Bloodhound instrument was very low 

for RBCs and their associated indices, WBCs and PLTs. Results for all parameters 

were well-within CLIA thresholds, and equal to or better than the published %CV 

of automated hematology analyzers that employ flow methods with impedance and/ 

or laser-based detection. The imprecision results for abnormal samples were also 

favorable considering the wide range of variability typically seen in these types of 

samples. In particular, the imprecision results for the anemic samples were excellent 

and showed that the Bloodhound Instrument is capable of producing consistent 

values in these medically important decision ranges. *The Bloodhound Integrated 

Hematology System is under development and is not currently cleared by the Food 

and Drug Administration. 

A-503 

Inter-instrument Reproducibility of the Bloodhound Integrated 

Hematology System 

W. Swinehart 1 , T. Allen 1 , D. Bracco 1 , D. Zahniser 1 , J. Linder 2 , J. W. 

Winkelman 3 . 1 Constitution Medical Inc, Westborough, MA, 2 University of 

Nebraska Medical Center, Omaha, NE, 3 Harvard Medical School, Boston, 

MA 

Introduction: Assessing the reproducibility of split samples across multiple 

hematology analyzers is essential to assure that the device produces clinically valid 

results. The Bloodhound Integrated Hematology System (Constitution Medical 

Inc., Westborough, MA, USA) is a recently developed analyzer that uses proprietary 

technology to perform a CBC, WBC differential and reticulocyte count by drawing 

undiluted whole blood into a dispensing needle that places a precise volume uniformly 

onto a microscope slide for analysis. This study evaluated reproducibility when the 

same whole blood sample was processed on three different Bloodhound Instruments. 

Methods: The experiment was run on three (3) instruments on two (2) different 

days, at ambient temperature. The analyzers were calibrated with whole blood, and 

controlled with stabilized material (Streck, Omaha, NE). Forty (40) normal, and three 

(3) whole blood samples from patients with leukopenia, anemia and thrombocytopenia 

were collected in K 2 

ethylenediaminetetraacetic acid (EDTA) and processed on the 

Bloodhound instruments within eight (8) hours of collection. This study employed 

statistical methods outlined in the Clinical and Laboratory Standards Institute (CLSI) 

EP5-A2 standard to determine pooled within-run repeatability, inter-instrument 

reproducibility and total imprecision 

Results: Summary Imprecision Data for normal subjects (%CV (95% CI) 

Parameter Repeatability Reproducibility Imprecision 

WBC 3.15(2.89-3.46) 0.95 (0.47-9.62) 3.54(3.19-3.99) 

RBC 1.01(0.93-1.11) 0.086 (0.026--) 1.24(1.13-1.36) 

PLT 3.38 (3.10-3.71) 2.14(1.09-15.70) 4.58 (3.71-5.98 

HGB 1.23 (1.13-1.35) 0.38 (0.18-6.18) 1.64(1.47-1.85) 

HCT 1.37 (1.25-1.50) 0.48 (0.23-5.84) 1.79(1.60-2.04) 

MCV 1.02 (0.94-1.12) 0.440 (0.22-4.33) 1.383(1.210-1.61) 

MCH 0.66 (0.61-0.73) 0.31 (0.15-3.19) 0.97(0.85-1.14) 

#Neut 4.04 (3.698-4.424) 1.04(0.50-12.37) 4.45(4.04-4.94) 

#Lymph 8.72 (8.00-9.58) 0.81(0.31-810.64) 8.815(8.164-9.58) 

#Mono 14.415(13.23-15.83) 0.000 (---) 14.67(13.59-15.95) 

#Eos 32.79(30.10-36.01) 2.01 (0.671--) 31.78 (29.5-34.46) 

For abnormal samples the same parameters of within-run repeatability, interinstrument 

reproducibility and total imprecision were assessed on 3 instruments (%CV 

(95% CI): WBC repeatability 4.81 (3.64-7.12) reproducibility 9.11(4.66-65.53) total 

imprecision 10.43 (5.96-37.07); RBC repeatability 1.26 (0.95-1.86) reproducibility 

1.29 (0.66-8.87) total imprecision 1.69 (1.07-3.96); PLT repeatability 24.42 (18.45- 

36.12) reproducibility 4.47 (1.33--) total imprecision 24.18 (18.81-33.87) 

Conclusions: The inter-instrument reproducibility of the Bloodhound Instrument 

is consistent across the three (3) instruments included in the study. The results 

demonstrate that the Bloodhound Instrument has excellent reproducibility for 

commonly measured parameters in the CBC. 

*The Bloodhound Integrated Hematology System is under development and is not 

currently cleared by the Food and Drug Administration. 

A-504 

Platelet Counting by Multi-Spectral Analysis with the Bloodhound 

Integrated Hematology System Versus Flow Cytometry and the 

Sysmex XE-5000 

D. Bracco 1 , M. Braga 1 , D. Hawkins 2 , J. W. Winkelman 3 , J. Linder 4 , J. Tabor 1 , 

D. Zahniser 1 . 1 Constitution Medical Inc., Westborough, MA, 2 University 

of Minnesota, Minneapolis, MN, 3 Harvard Medical School, Boston, MA, 

4 

University of Nebraska Medical Center, Omaha, NE 

INTRODUCTION: Accurate platelet counting in a CBC especially important 

for transfusion decisions. The Bloodhound Integrated Hematology System 

(Constitution Medical Inc., Westborough, MA) (Bloodhound Instrument) is a recently 

developed automated hematology analyzer that performs a CBC and WBC differential 

and reticulocyte determination by applying whole blood onto a microscope slide, 

staining, then performing multispectral imaging. This study evaluated the accuracy 

of automated platelet (PLT) counts from the Bloodhound Instrument compared to 

those of established instrumentation (Sysmex XE-5000, Kobe, Japan) and by flow 

cytometry (Cytomics FC 500, Beckman Coulter, Miami, FL). 

METHOD: Residual samples were collected in K2 EDTA blood collection tubes and 

processed within eight (8) hours of venipuncture. Platelet counts ranging from 0-50 to 

> 600 (x 10 3 /μL) were determined on both hematology analyzers using split samples. 

Flow-based platelet counting was done with monoclonal antibodies(Anti-Human 

CD41-FITC and Anti-Human CD61-FITC, BioLegend, San Diego, CA). 

RESULTS: Results were analyzed using a weighted Deming regression of both 

automated hematology instruments against flow cytometry. Confidence intervals for 

intercept and slope of the regressions were determined using jack-knifing, and Bland- 

Altman plots were constructed. 

Summary Statistics for Sysmex XE-5000 and Bloodhound Instrument 

Instrument Correlation Parameter Estimate 95% CI 

Sysmex 0.972 Intercept 1.424 0.078 2.771 

Slope 1.016 0.972 1.059 

Bloodhound 0.990 Intercept 8.076 0.980 15.172 

Slope 0.961 0.910 1.011 

Both analyzers had positive intercepts indicating an upward bias at very low platelet 

levels. Regression slopes were not statistically significantly different, and showed 

high correlations with flow cytometry. The Bland-Altman plots showed no significant 

bias between the Bloodhound Instrument and flow cytometry. The bias was constant 

with no upward or downward swings associated with high or low PLT counts. 

CONCLUSION: When compared to a flow cytometry reference method, PLT counts 

from the Bloodhound Instrument demonstrate high correlation across a wide range of 

concentrations. The Bloodhound Instrument also has excellent PLT count correlation 

with the Sysmex XE-5000, a widely used hematology analyzer. 

*The Bloodhound Integrated Hematology System is under development and is not 

currently cleared by the Food and Drug Administration. 

A-505 

Performance evaluation of Actin FSL reagent for Activated Partial 

Thromboplastin Time (APTT) detection. 

M. P. REZENDE, C. PEREIRA, R. IANNACCARO. DASA S/A, SÃO 

PAULO, Brazil 

Background: The Activated Partial Thromboplastin Time (APTT) is an in vitro 

screening procedure, primarily used to evaluate coagulation system abnormalities 

in the intrinsic pathway. Its result may indicate altered functional deficiency of 

factors VIII, V, X, XI and II. Furthermore, APTT is an universally recognized test 

which monitor unfractionated heparin therapy that makes clotting time prolongation 

proportional to the heparin level. The presence of nonspecific suppressive substances 

such as lupus anticoagulant may cause a prolonged APTT. The detection depends on 

the composition of APTT phospholipids contained in the reagent. APTT determination 

is a valuable clinical screening with wide possibilities of use in diagnosing coagulation 

disorders and monitoring patient’s therapy prone to bleeding or thrombosis. 

Plasma Incubation with the optimal quantity of phospholipids (vegetable and/or 

animal) and an activator (ellagic acid) leads to factors activation of the endogenous 

clotting system. The coagulation process is initiated with the addition of calcium 

chloride and the time is measured until the formation of the fibrin clot. 


A151



Methods: Two reagents were used for this study: Actin and Actin FSL which 

have reference ranges as follows: 22,7 to 31,8 seconds and 25,0 to 31,3 seconds, 

respectively. Fresh samples were simultaneously processed within four hours after 

blood drawn in both protocols in two hospital laboratories. In Hospital Campo Limpo, 

fifty samples (n=50) were tested using Siemens Sysmex ® CA-1500 System and in 

Hospital Marcia Maria Braido, seventeen samples (n=17) were tested using Siemens 

Sysmex ® CA-560 System. 

Results: Comparative results analysis using linear regression are the following for 

Hospital Campo Limpo, Mean of 28,04 seconds (Actin) and 28,79 seconds (Actin 

FSL), slope is 0,64, intercept is 10,79 and correlation (r) is 0,93; and for Hospital 

Marcia Maria Braido, mean is 33,36 seconds (Actin) and 32,11 seconds (Actin FSL), 

slope is 0,74, intercept is 7,19 and correlation (r) is 0,98. 

Conclusion: Study concludes Actin and Actin FSL have good correlation when 

tested in both systems. Moreover, Actin FSL performance was satisfactory for both 

instruments, Siemens Sysmex CA-560 and Siemens Sysmex CA-1500. The Actin FSL 

reagent is more sensitive for the detection of Lupus-like inhibitors and its use adds 

value to the APTT test as a screening tool. 

A-506 

Cleavage site Arg1018 by thrombin plays minimal role during 

activation of coagulation factor V 

M. Na 1 , J. Wiencek 2 , J. Hirbawi 3 , M. Kalafatis 2 . 1 Cleveland State University, 

Westlake, OH, 2 Cleveland State University, Cleveland, OH, 3 Cleveland 

clinic, Cleveland, OH 

Background:Coagulation fV is a single chain quiescent procofactor . Thrombin 

generation is the key event involved in the coagulation cascade. The proteolytic 

conversion of prothrombin (Pro) to thrombin is catalyzed by the prothrombinase 

complex. This stoichiometric complex is composed of the cofactor factor Va (fVa), 

the enzyme factor Xa (fXa) associated on a membrane surface in the presence of 

divalent metal ions. FV is activated by thrombin following three sequential cleavages 

at Arg 709 , Arg 1018 , and Arg 1545 to generate the active cofactor (fVa) composed of heavy 

and light chain. It was previously reported that activation of FV following cleavage 

at Arg 1545 by thrombin requires prior cleavage at Arg1 018 . To ascertain the role of 

thrombin mediated cleavage at Arg 1018 during activation of fV , we used site directed 

mutagenesis to create several recombinant fV molecules with the activation sites 

mutated to Glutamine (RtoQ). 

Methods: We have also used a recombinant mutant factor V molecule with the 

region 1000-1008 from the B region deleted (fV ∆B9 ). We have created recombinant fV 

molecules as follows: fV WT (wild type), fV QQR (only cleavage at Arg 1545 is available), 

fV RQQ (only cleavage at Arg 709 available), fV QRQ , (only cleavage at Arg 1018 available), 

fV RQR (cleavages at Arg 709 and Arg 1545 available), fV QQQ (no cleavage available), 

fV ∆B9/RQR , and fV ∆B9/QRQ . The recombinant molecules were expressed in COS-7 cells, 

purified to homogeneity and assayed for clotting activity as well as in prothrombinase 

assays using purified reagents. Western blotting followed by staining with specific 

monoclonal antibodies to the heavy and light chain of the cofactor was used to 

evaluate the integrity of the recombinant fV/fVa molecules. 

Results:Two-stage clotting assays revealed that the clotting activities of fVa QQR , 

fVa RQQ , and fVa QRQ were reduced while fV QQQ was devoid of clotting activity. In 

addition, fVa RQR and fVa ΔB9/RQR have similar clotting activities as fVa WT . In contrast, 

fVa QRQ , and fVa ΔB9/QRQ are impaired in their clotting activities, similar to the activity 

expressed by fV QQQ . Kinetic analyses demonstrated that fVa RQR and fVa ΔB9/RQR have 

similar affinities for fXa, while fVa QRQ , and fVa ΔB9/QRQ were impaired in their interaction 

with fXa. The kcat values for prothrombinase assembled with fVa RQR and fVa ΔB9/RQR 

were similar to the kcat obtained with prothrombinase assembled with fVa WT , while 

prothrombinase assembled with fVa QRQ and fVa ΔB9/QRQ had 2-fold and 7-fold reduced 

catalytic efficiency respectively, when compared to the kcat values obtained with 

prothrombinase assembled with fVa WT . Finally, the kcat value for prothrombinase 

assembled with fVa QQR was approximately 50% lower than the kcat obtained with 

prothrombinase assembled with fVa WT . 

Conclusion:Our data demonstrates that cleavage site Arg 1018 is not a prerequisite for 

activation of factor V. We conclude that the data presented explains that Arg 1018 has 

no effect on heavy and light chain formation but only removes any steric hindrance 

present in the structure and improves the catalytic efficiency of the prothrombinase 

complex. 

A-507 

Intra-assay precision, inter-assay precision, and reliability of five 

platelet function methods used to monitor the effect of aspirin and 

clopidogrel on platelet function 

C. D. Koch, A. M. Wockenfus, R. S. Miller, N. V. Tolan, D. Chen, R. K. 

Pruthi, A. S. Jaffe, B. S. Karon. Mayo Clinic, Rochester, MN 

Introduction: Protocols for implantable cardiac devices often call for monitoring and 

titration of antiplatelet agents to avoid device thrombosis. We evaluated five platelet 

function methods for precision and reliability in measuring platelet function in healthy 

volunteers and volunteers on daily aspirin or clopidogrel therapy. 

Methods: We studied TEG® 5000 PlateletMapping® (Haemonetics, Braintree MA), 

light transmission aggregometry (LTA) using a PAP-8E (Bio/Data Corporation, 

Horsham PA), PLT VASP/P2Y12 flow cytometry (Biocytex, Marseille France) using 

a FACSCalibur Cytometer (Becton Dickinson, Franklin Lakes NJ), whole blood 

impedance aggregometry using Multiplate 5.0 (DiaPharma Group, Westchester OH), 

and VerifyNow (Accumetrics, San Diego CA). Blood samples from forty healthy 

volunteers were obtained for duplicate testing by all methods. To assess platelet 

function variability from blood draws and sample processing, twenty four healthy 

volunteers had blood drawn again within 24 hours for repeat duplicate measurement. 

Thirteen volunteers on daily aspirin therapy, and ten volunteers on daily clopidogrel 

therapy, also had blood drawn twice within 24 hours for testing. Intra-assay precision 

(CV) was calculated from the standard deviation of all duplicate results; while interassay 

CV was calculated from the SD of all four (duplicate results from two blood 

draws) results among donors with repeat blood draws. Reliability index (R), the 

ratio of between person to total (within plus between person) variability was also 

calculated. R indices of 0.41-0.60 indicate moderate, 0.61-0.80 substantial, and 0.81- 

1.00 high test reliability. 

Results: Intra-assay CV was < 15% except for TEG PlateletMapping on healthy 

donors and Multiplate on aspirin-treated donors. Inter-assay precision and reliability 

(R) calculated from 9-13 repeat donors were: 

ADP Inhibitor Effect 

Aspirin Effect 

Clopidogrel- 

Aspirin-Treated 

Healthy Donors 

Healthy Donors 

Treated Donors 

Donors 

Mean Inter- Mean Inter- Mean Inter- Mean Inter- 

Assay CV R Assay CV R Assay CV R Assay CV R 

(%) 

(%) 

(%) 

(%) 

VASP 4.7 0.64 26.3 0.83 - - - - 

VerifyNow 5.2 0.89 12.9 0.92 2.4 0.23 4.8 0.78 

Multiplate 8.3 0.61 14.2 0.89 9.7 0.48 24.7 0.68 

LTA 6.2 0.66 11.2 0.89 7.2 0.60 37.8 0.25 

TEG PM 50.1 0.35 17.2 0.93 92.2 0.06 5.0 0.26 

Conclusions: VASP, VerifyNow, Multiplate and LTA had substantial or high reliability 

for measuring the effect of ADP inhibitors; while only Multiplate had even moderate 

reliability for measuring aspirin effect. TEG PlateletMapping is not a reliable method 

to measure individual response to antiplatelet agents. 

A-508 

Detection of JAK2 V617F and JAK2 exon 12 mutations in chronic 

myeloid leukemia patients and their role in disease progression. 

R. MIR 1 , I. Ahmad 2 , M. Zuberi 2 , J. Javid 1 , S. Farooq 2 , S. Guru 2 , P. Ray 2 , 

P. Yadav 2 , N. Gupta 2 , M. Masroor 2 , A. saxena 2 . 1 University of Delhi, NEW 

DELHI, India, 2 Maulana Azad Medical college, NEW DELHI, India 

OBJECTIVE: The JAK2 V617 mutation in exon 14 and other novel JAK2 exon12 

mutations (K539L, F537-K539delL, H538QK539L ) are acquired alterations that 

induce constitutive cytokine-independent activation of the JAK-STAT pathway in 

myeloproliferative disorders. The discovery of these mutations provides a novel 

mechanism for activation of signal transduction in hematopoietic malignancies. The 

aim of this study was to investigate the presence of V617F and other JAK2 mutations 

along with BCR-ABL translocation/Philadelphia chromosome in Indian patients of 

Chronic Myeloid Leukemia (CML)and to study their association with early disease 

progression to advanced stages (accelerated phase or blast crisis) and poor disease 

outcome. 

METHODOLOGY: 100 newly diagnosed BCR-ABL translocation or Philadelphia 

chromosome positive cases of CML in chronic phase/accelerated phase/blast crisis 

were tested for JAK2 mutations by ARMS-PCR and/or ASO-PCR. Demographic data, 

spleen size, hemoglobin level, white blood cell and platelet counts were recorded. 




Independent sample t-test was used to study the correlation of JAK2 mutations with 

age, haemoglobin , blood counts and spleen size. Fisher’s exact test was applied to 

compare disease progression in mutation positive and negative cases. 

RESULTS: The JAK2 mutation was studied in 100 CML patients , 50 were in chronic 

phase(CP), 10 in accelerated phase(AP) and 15 in blast crisis(BC).Overall twenty one 

of hundred cases (21%) were carrying JAK2V617F mutation,,the break-up among the 

different stages was 13% of CP-CML , 40% of AP-CML and 46.66% blast crisis(BC) 

cases .It was seen that JAK2V617F mutation frequency is increased significantly from 

early to advanced phase of CML. A higher frequency of JAK2V617F mutation was 

observed in haematologically resistant cases (35% ) and molecularly resistant cases 

(33%) to imatinib treatment than in the imatinib responders.A significant proportion 

of patients carrying JAK2V617F mutation showed early disease progression. During 

a mean follow-up of 12 months, 5/10 CP-CML (JAK2+) cases underwent disease 

progression and out of five ,3 patients transformed to blast crisis and 2 into accelerated 

phase. No statistically significant difference was seen in relation to age, spleen size, 

haemoglobin level, white blood cells and platlet counts in JAK2V617F positive 

patients. Other JAK2 exon12 (K539L,H538QK539L,F537-K539delL) mutation 

screening is under process and the results will be reported. 

CONCLUSION: JAK2V617F mutation was detected in 21% cases of Chronic 

Myeloid Leukemia. A significant proportion of these patients showed early disease 

progression. 

A-510 

Platelet, Mean platelet volume and r-glutamyl transferase: Changes in 

Platelet Index in Cholestatic conditions 

S. Cho, E. You, J. Yang, Y. Jeon, M. Kim, M. Lee, H. Yang, H. Lee, T. Park, 

J. Suh. Kyung Hee University Medical Center, Seoul, Korea, Republic of 

Background: Mean platelet volume (MPV) is the commonly measured platelet 

index for platelet size and surrogate marker of platelet function. Recently, MPV has 

been investigated various hepatic disease such as cirrhosis and viral hepatitis. We 

also had reported previous studies to analyze clinical meaning of MPV in patients 

with hepatocellular carcinoma and chronic hepatitis B. In this study, we planned to 

investigate the relationship between this platelet index and γ-glutamyltransferase 

(GGT) in various disease conditions. 

Materials and Method: The study included 671 results with increased GGT (1.5 

times higher than upper reference limit) from 415 different patients in our hospital 

between August 2011 and April 2012. For the control group, 311 subjects for medical 

check-ups were enrolled and they were also used as control group in our previous 

study. Mean age of patient group was 54.91 (range 0-88) yr, and male to female 

ratio was 281:134. Platelet index were measured using EDTA blood in Advia 2120 

(Siemens Healthcare Diagnostics Inc., Tarrytown, USA) within 2 hrs. GGT was 

tested using Toshiba chemical analyzer (Toshiba, Nasushiobara, Japan). Student t-test 

and Pearson correlation analysis were used to examine the relationships between 

variables. The statistical analyses were performed with MedCalc v11.6 (MedCalc 

Software, Mariakerke, Belgium). 

Results: Mean of MPV levels was the significantly increased in patients group 

(P



A-514 

A case report: secondary thrombophilia in the course of a 

cardiovascular surgery 

J. Romero-Aleta, M. D. Rodriguez-Fernandez, A. I. Alvarez-Rios, G. 

Pérez-Moya, B. Pineda-Navarro, J. M. Guerrero. H.U. Virgen del Rocio, 

Sevilla, Spain 

Background: The antithrombin III is a liver synthesis protein, vitamin K-independent. 

It is the major inhibitor of thrombin and factor Xa. The genetic deficiency is inherited 

40-60% as an autosomal dominant, with incomplete penetrance. The estimated 

incidence in the general population is 1/2000 to 1/5000. Affected individuals are 

heterozygous with activity levels



when compared to manual methods of establishing red cell indices. Because the cells 

in our measurement are bathed in their native plasma, while those in a flow-cytometric 

or aperture impedance system are highly diluted in a fluid whose osmolality may 

differ from that of the plasma, we found somewhat different MCV values when 

utilizing those automated methods. Based on this issue, we focused on comparison to 

manual reference methods for RBC, HGB and HCT. This issue will be investigated 

in future work. 

A-518 

The Use of Quantitative, Multi-Spectral Imaging to Measure 

Hematology Parameters in Whole Blood Preparations 

D. Unfricht, D. Olson, M. Xie, R. Holt, D. Herzog, J. Verrant, C. Gonzalez. 

Abbott Laboratories, Princeton, NJ 

Background: The rapid advancement of technology has made it increasingly possible 

to provide critical diagnostic tests at the point of patient care (POC). Instead of waiting 

for test results, clinicians can perform diagnostic tests in minutes while the patient 

is present. This is especially important in situations where rapid test turnaround is 

essential for positive patient outcomes. While POC tests are increasingly available, 

there are as yet no satisfactory complete blood count (CBC) and white blood cell 

(WBC) differential solutions for near patient testing. Various hematology solutions 

based on automated impedance and flow cytometry or other traditional technologies 

have been developed, but none of them fully satisfy demand for rapid, accurate sample 

analysis, fluid-free processing, reliability, compactness, and ease of operation. All of 

these are important requirements for POC diagnostic systems. In this presentation, a 

novel, imaging-based POC hematology analyzer that performs a complete blood count 

(CBC) with 5 part differential comparable to conventional laboratory hematology 

instruments is described. The POC hematology analyzer processes a small volume 

of whole blood stored inside a disposable, companion cartridge with dry reagents. 

After the blood sample fills an imaging chamber of precisely-defined height, the POC 

analyzer acquires digital hematology images at multiple wavelengths of light (multispectral 

analysis) and quantitatively analyzes them. 

Methods: Fifty anti-coagulated, whole blood samples (either native or manipulated) 

were analyzed in duplicate on the Abbott, imaging-based, POC hematology analyzer, 

and a traditional multi-parameter hematology system. Linear regression was performed 

to compare the methods. Additionally, a precision study (n = 20) was performed to 

examine the repeatability of the imaging-based POC hematology analyzer. 

Results: For WBC and platelet (PLT) counts, the Abbott imaging-based POC 

hematology analyzer generated linear regression r 2 values > 0.99 and 0.98, 

respectively, when compared to the traditional multi-parameter hematology system. 

Precision for WBCs and PLT was 3.6% and 3.1%, respectively. 

Conclusions: Although the art of acquiring digital hematology images has been 

practiced for decades, quantitative methods of measuring hematology parameters 

from these images is in its infancy. Digital image analysis has many advantages, 

including the visual confirmation of identified objects. Additionally, the design of 

the imaging chamber allows the same region of interest (ROI) to be analyzed with 

multiple wavelengths of light, providing a wealth of information from the same 

ROI. Multi-spectral analysis can be particularly useful when analyzing cellular 

objects containing nucleic acids, such as white blood cells, platelets, platelet clumps, 

and nucleated erythrocytes that can be stained with supravital fluorescent dyes. 

Preliminary results, along with confirmatory digital hematology images, suggest that 

the multi-spectral analytical methods compare favorably with traditional automated 

hematology analyzers. 

A-519 

Disposable Analysis Chamber for a Novel Imaging Based Hematology 

Instrument 

B. Ports 1 , D. Unfricht 2 , P. Mitsis 2 , N. Khan 1 , S. Levine 3 , R. Levine 3 . 1 QDx, 

Inc., Cranford, NJ, 2 Abbott Laboratories, Princeton, NJ, 3 Yale University 

School of Medicine, New Haven, CT 

Objective: To show a disposable transparent chamber with a precisely known interior 

height of 4.0 μm, can be used to determine the concentration of white blood cells and 

platelets in whole blood when measured using automated digital imaging, such that 

instrument and chamber yield acceptable clinical correlations and precision for WBC 

and PLT with a commercially available hematology instrument. 

Methodology: The imaging chamber is one component of a disposable cartridge 

which accepts 20-30 μL whole blood. Once inserted in the instrument, the cartridge 

automatically stains the blood sample with dried acridine orange and dispenses ~300 

nL to the imaging chamber. The chamber design allows all components of blood 

to fill by capillarity, forming a monolayer of WBCs within the 4 μm space due to 

their deformability in the live state. Fluorescent digital images are then captured and 

analyzed by image processing algorithms to enumerate WBC and PLT, among other 

CBC parameters. 

Validation: Studies performed using replicate analysis (each analysis in a new 

chamber) of 20 samples, demonstrated a working precision for WBC and PLT of 

~3.5% in the normal range. Separate studies comparing ~200 abnormal and normal 

samples with a comparative instrument in duplicate show excellent agreement, with 

correlations of R = 0.99 for WBC and PLT. 

Conclusions: Fluorescent imaging of acridine orange stained WBC and PLT in the 

novel 4 μm chamber allows for accurate and precise enumeration of these cells. 

A-520 

Validation of Buzzy® during blood specimens collection by 

venipuncture for hematology testing: a preliminary evaluation 

G. Lima-Oliveira 1 , C. D. Valentim 2 , G. Salvagno 3 , G. Lippi 4 , M. D. R. 

Campelo 2 , C. A. Amaral-Valentim 2 , K. S. A. Tajra 2 , F. S. Gomes 2 , S. J. C. 

Romano 2 , G. Picheth 1 , G. Guidi 3 . 1 Federal University of Parana, Curitiba, 

Brazil, 2 Bioanalise, Teresina, Brazil, 3 University of Verona, Verona, Italy, 

4 

University of Parma, Parma, Italy 

Background and objective: A new device called Buzzy® which combines ice pack 

and vibrating motor is proposed to relieve the venipuncture pain, thus increasing 

patient compliance during venipuncture. Aim of this study was to evaluate the impact 

of the device to validate it for blood collection by venipuncture for hematology tests. 

Methods: Blood was collected from 20 volunteers by a expert phlebotomist. A vein 

was located on the left forearm without applying tourniquet using a subcutaneous 

tissue transilluminator device, and blood samples were collected directly into vacuum 

tube with K2EDTA. In sequence, Buzzy® was applied on the right forearm, for one 

minute before venipuncture and maintained until the end of blood collection. The 

routine hematological tests were performed in the same instrument Sysmex® XE- 

2100D. The significance of the differences between samples was assessed by using the 

paired Student t-test after verifying the normality. Because non-normal distribution 

was found for MCV, relevant results were assessed by using Wilcoxon ranked-pairs 

test. Statistical significance was set at P < 0.05. 

Results: The main results of the present investigation are synthesized in the table I. 

Table 1. Impact of Buzzy® on routine hematology tests. 

Discussion and conclusion: From a practical point of view, the cold-induced 

hemoconcentration promotes the exit of water, diffusible ions and low molecular 

weight substances from the vessel thereby increasing the concentration of various 

blood analytes at the punctured site thus potentially influencing the laboratory results 

interpretation (red blood cell, haemoglobin and haematocrit). In conclusion, the use of 

Buzzy® was not validated for diagnostic blood collection by venipuncture for routine 

hematology tests because the device could be affect the patient safety. Further study 

with more volunteers should be done to confirm this preliminary result. 


A155



A-521 

Risk index for the predictor of blood products transfusion in liver 

transplantation 

A. I. Alvarez-Rios 1 , A. León-Justel 1 , J. A. Noval-Padillo 1 , P. Mellado 2 , 

M. A. Gomez-Bravo 3 , J. M. Alamo 3 , M. Porras 4 , F. Sanchez 2 , L. Barrero 3 , 

R. Hinojosa 4 , J. L. Lopez-Romero 2 , M. Carmona 5 , J. M. Guerrero 1 . 

1 

Department of Clinical Laboratory Sciences, Virgen del Rocío University 

Hospital, Sevilla, Spain, 2 Department of Anaesthesiology, Virgen del Rocío 

University Hospital, Sevilla, Spain, 3 Department of Hepatobiliar Surgery, 

Virgen del Rocío University Hospital, Sevilla, Spain, 4 Department of 

Intensive Care Medicine, Virgen del Rocío University Hospital, Sevilla, 

Spain, 5 Department of Haematology and Haemotherapy, Virgen del Rocío 

University Hospital, Sevilla, Spain 

Background:Liver transplantation (LT) is a surgical procedure that can lead 

to massive blood loss and consequently result in transfusion of blood products. 

Substantial evidence suggests that the use of blood products during OLT is associated 

with morbidity and mortality, and has been identified as an independent risk factor for 

adverse postoperative outcomes. The early identification of patients at risk of blood 

products transfusion may provide the opportunity to develop clinical pathways and 

test approaches to prevent blood loss during LT.The primary objectives of our study 

were to identify preoperative predictors of blood products transfusion in LT, and to 

develop a risk index to predict blood products transfusion in LT. 

Methods:We performed a retrospective, observational study of all LTs patients among 

those performed between October 15 th , 2009 and December 31 st , 2011. A hundred 

and twenty five LTs were included during the study period. The following variables 

were recorded for each patient: age; thromboelastometry´s variables (CT (clotting 

time); A10 (amplitude clot after 10 minutes); CFT (clotting formation time); MCF 

(maximum clot of firmness); alpha); INR (international normalized ratio); aPTT 

(activated partial thromboplastin time); Fg (fibrinogen); RBC (red blood cells); Hb 

(hemoglobin) and platelets. Independent predictors of blood products transfusion 

were identified by multivariable logistic regression analysis. We have developed a risk 

index of blood products transfusion with the quartile and the diagnostic performance 

was established by calculating area under the ROC curve, sensitivity, specificity, and 

95% confidence intervals (CI). This risk index of blood products transfusion was 

internally validated with the following twenty LTs. 

Results:Multivariable logistic regression analysis revealed that CT (OR=1.036; IC 

95%, 1.003-1.069; p=0.030); A10 (OR=0.765; IC 95%, 0.612-0.956; p=0.018); MCF 

(OR=1.275; IC 95%, 1.012-1.605; p=0.039); Hb (OR=0.942; IC 95%, 0.894-0.992; 

p=0.024) were associated with an overall risk of transfusion. We obtained an area 

under the ROC curve of 0.77, 95% IC (0.68-0.84; p



Conclusion: The pancytopenia was not correlated with the degree of splenomegaly in 

patients with schistosomal portal hypertension. 

Results of hematological tests of 80 patients with SPH, since 2004 to 2011 

Exams 

Results 

mean ± sd minimum maximum 

Erythrocytes (céls/mm 3 ) 3.98 ± 0,57 2.92 5.00 

Hemoglobin (g/dL) 10.8 ± 1.9 7.7 14.2 

Hematocrit (%) 33.2 ± 4.8 24.2 41.0 

Total leukocytes (céls/mm 3 ) 3040 ± 920 1400 5400 

Eosinophils (%) 6 ± 5 1 20 

Platelets (céls/mm 3 ) 61000 ± 28000 12000 110000 

A-525 

Behavior of MCH and MCHC in iron-deficiency anemia and 

thalassemia minor 

S. F. Fonseca 1 , J. R. S. Oliveira 2 , A. T. Q. Lopes 2 , G. Azevedo 2 , L. F. A. 

Nery 2 , S. S. S. Costa 2 , R. H. Jacomo 2 . 1 Brasilia University, Laboratorio 

Sabin, BRASILIA, Brazil, 2 Laboratorio Sabin, BRASILIA, Brazil 

The red cell indices are very important for the classification and etiologic investigation 

of anemia. In general, anemia is classified according to the mean corpuscular volume 

(MCV) as normocytic, microcytic or macrocytic, and, based on mean corpuscular 

hemoglobin (MCH) and mean corpuscular hemoglobin concentration (MCHC), as 

normochromic or hypochromic. Data in the literature are conflicting with regard to 

which of these indices best classifies anemia. 

Objective: Considering that iron-deficiency anemia and beta-thalassemia minor are 

frequent causes of hypochromic anemia, the authors analyzed the behavior of MCH 

and MCHC in these two pathologies. 

Methods: MCH and MCHC values were analyzed in 4,196 complete blood counts 

(CBC) from adults who presented serum ferritin concentration below 10ng/dl and 

showed hemoglobin (Hb) levels below reference values for age and sex (Group I); 

and in 116 CBC from adults with HbA2 above 3.5% and with ferritin and transferrin 

saturation within reference values (Group II). The CBC were carried out by an 

automated system (Sysmex XE2100), hemoglobin analysis by capillary electrophoresis 

(Capillarys 2, Sebia), and serum ferritin analysis by chemiluminescence (Advia 

Centaur XP). Statistical analysis was performed using the Student´s T test. 

Results and Conclusion: The average Hb values were 11.5 g/dl and 11.8 g/dl 

(p=0.049); MCH values were 25.8 pg and 21.7 pg (p


Factors Affecting Test Results 

A-527 




Interference in HbA1c Measurement by HPLC: Unusual Case 

Involving a poorly controlled Diabetic Patient with Hemoglobin D 

Trait 

T. Brandler, M. Fenelus, L. K. Bjornson. North Shore University Hospital 

Laboratory, Manhasset, NY 

Introduction: Hemoglobin A1c (HbA1c) is the universally accepted index of glycemic 

control in diabetes mellitus over the longevity of an erythrocyte, approximately 120 

days. HPLC (high performance liquid chromatography) is one of the most common 

methodologies for measuring HbA1c. Hemoglobinopathies such as HbAE and HbAD 

are reported to interfere with some of the commercially available HPLC methods. 

Here, we present a case of a 66 year old female with unreportable HbA1c results using 

the Tosoh G8 HPLC system. 

Methods: The Core Laboratory received a blood sample from a 66 year old female. 

HbA1c and serum glucose measurements were performed initially. Subsequently, 

fructosamine measurement and hemoglobin identification were performed. The 

two principle methods used to measure HbA1c in our laboratory system are HPLC 

and immunoassay. HbA1c was performed with the Tosoh HLC-723G8 using ionexchange 

chromatography and by immunoassay with the Roche Cobas Integra 800 

using a turbidimetric inhibition immunoassay (TINIA). Both manufacturers, Tosoh 

- HPLC and Roche - immunoassay, specify that HbA1c can be reliably measured for 

patients with HbAD or hemoglobin D trait. Hemoglobin identification was performed 

using the Bio-Rad CDM System Variant V-II Instrument for hemoglobin HPLC and 

the Resolve Perkin Elmer System for isoelectric focusing. 

Results: Our patient had a glucose level of 330 mg/dL. The HbA1c measurement 

by HPLC was 12.7%, but could not be reported because of an error flag on the 

chromatogram indicating the presence of an unidentified peak (P00 =8.6%) just 

before HbA0. An additional peak (H-VI = 35.5%) appeared just after HbA0. A 

second specimen was obtained from the patient and demonstrated the same HbA1c 

error flag indicating unreportable results. Since the HPLC analysis of HbA1c 

indicated the probable presence of an abnormal hemoglobin and/or other interfering 

substance, the patient’s blood was investigated for hemoglobinopathy. Examination 

of her hemoglobins by HPLC and isoelectric focusing demonstrated the presence 

of HbD at 39% and established that this patient had a hemoglobin D trait. HbA1c 

was subsequently measured by an alternate immunoassay method (TINIA) on the 

Roche Cobas Integra 800 and found to be 11.8% (as compared to the HPLC result of 

12.7%). There were no error flags for the immunoassay and results were assumed to 

be valid. Serum fructosamine was measured at 535 umol/L (reference interval 205 - 

285), which confirmed this patient’s very high HbA1c levels and her poorly controlled 

diabetic state. 

Conclusion: HbA1c measurements could not be reported on a 66 year old female with 

poorly controlled diabetes and hemoglobin D trait using the Tosoh G8 HPLC system 

because of an unidentified peak (8.6%) just before HbA0. This unidentified peak was 

not HbD which eluted after HbA0 and may be an artifact of her poor glycemic control 

or possibly due to medications. The Roche Integra immunoassay (TINIA) produced 

a reliable result with no instrument flags that was consistent with all other laboratory 

data. 

A-528 

How Frequently does Hemolysis Mask Hypokalemia? A study from a 

Large Tertiary Hospital 

J. R. Asirvatham, L. Bilello, R. Agostinello, L. K. Bjornson. North Shore 

University Hospital (NSLIJHS), Manhasset, NY 

Introduction: Excluding a false elevation of potassium due to hemolysis is almost 

a reflex reaction when faced with an elevated potassium concentration. However, 

hemolysis can underestimate the degree of hypokalemia or mask hypokalemia when 

the measured concentrations fall within the reference interval. Data on the frequency 

and clinical impact of masked hypokalemia is lacking. 

Objective: To estimate the proportion of masked hypokalemia in a large set of 

hemolysed samples by applying a correction factor based on the hemolysis index (HI). 

For this purpose, masked hypokalemia is defined as a potassium concentration from a 

hemolyzed specimen that is within the reference interval originally (normokalemic), 

but is hypokalemic after correcting for hemolysis. 

Methods: The study was conducted in the laboratory of North Shore University 

Hospital which is a large tertiary hospital in central Long Island, NY. The potassium 

concentrations of samples with HI between 25 and 500 were retrieved from the 

laboratory information system over 17 days in January 2013. Samples were considered 

to have hemolysis if the hemolytic index (HI) was >25. Samples with HI > 500 were 

excluded as they are not reported. Potassium was measured using an indirect ion 

selective electrode method on the Roche Modular ISE 1800 System. Serum indices 

including HI were measured simultaneously on the Roche Modular P 800. For this 

study, a previously published correction formula [Corrected potassium = Measured 

potassium - (HI x 0.004) mmol/L] was used to estimate the actual plasma potassium 

(Corrected potassium results have not been validated for clinical use). The reference 

interval for potassium used in the laboratory (3.5-5.1 mmol/L) was used to compare 

and categorize the pre and post correction values as hypokalemic, normokalemic and 

hyperkalemic. 

Results:704 samples (9.2%) were found to be hemolysed out of the 7650 samples 

analyzed for potassium in this 17 day time period. 41 (5.7% ) hemolysed samples were 

hypokalemic pre and post correction. 10 of these 41 specimens were below or equal to 

the critical concentration of 2.9 mmol/L post correction. “Masked hypokalemia” (pre: 

normo, post:hypo) was found in 56 (7.8%) of the hemolysed samples ; one of which 

was below the critical level. The lowest HI associated with a “masked hypokalemia” 

was 30. 

Conclusion: This study estimated that masked hypokalemia occurred in 7.8% of all 

hemolyzed samples. A smaller subset of 1.2% involved potassium concentrations 

that were hypokalemic initially but were below the critical limit of 2.9 mmol/L 

after correction. Masked hypokalemia caused by hemolysis poses a risk to patients, 

especially, those who have only one blood sample drawn per encounter, e.g., physician 

office, clinic or Emergency Room, and should be considered when potassium results 

are in the lower part of the reference interval even with mild hemolysis. 

A-529 

Thyroxine Binding Protein Dependence of Three Free Thyroxine 

Assays 

X. Qin 1 , T. J. Pitcher 2 , J. J. Miller 2 . 1 Peking Union Medical College 

Hospital, Beijing, China, 2 University of Louisville, Louisville, KY 

The Objective of this study was to test the effect of thyroxine (T4) binding protein 

concentration on 3 free T4 (FT4) assays used in our medical center by the effect of 

dilution on the measured FT4. Many of our patients are acutely ill with decreased 

concentrations of two T4 binding proteins, Albumin (Alb) and Prealbumin (PA). 

Pregnant patients have increased concentrations of the major T4 binding protein, 

Thyroxine-Binding Globulin (TBG). Accurate measurement of FT4 concentrations in 

these patients requires the assay to be minimally affected by the concentration of T4 

binding proteins. A FT4 assay should give the same result on diluted samples as on the 

original serum if the assay is not affected by the concentrations of T4 binding proteins. 

Methods: We prepared serum pools from 1. ill patients, and 2. pregnant women. 

Concentrations in the patient and pregnancy pools (reference intervals) were: Alb, 4.1 

& 3.5 g/dL (3.5-5.0); PA, 17.7 & 15.5 mg/dL (18-38); TBG, 16.7 & 25.7 μg/mL (13.5- 

30.9); FT4, 1.14 & 1.17 ng/dL (0.78-2.19). We made serial dilutions of each pool with 

10 mmol/L HEPES buffer, pH 7.4. We assayed FT4 in the pools and dilutions on the 

Vitros® 5600, Elecsy® 2010, and UniCell® DxI 800. We expressed the results of 

dilutions as a percentage of the undiluted pools. 

Results: See table. A binding-protein independent assay will have 100% for all 

dilutions due to readjustment of the equilibrium. The DxI FT4 assay was least 

dependent on T4 binding protein concentrations, the Vitros assay was affected more 

than the DxI assay and the Elecsys assay was markedly affected. The dilution curves 

were similar for normal and pregnant pools. 

Conclusion: We conclude that the DxI FT4 assay is most accurate among these 3 

assays for samples in which the T4 binding protein concentrations may be abnormal. 

Percent recovery of initial FT4 after dilution. 




Vitros Elecsys DxI 

Dilution Ill Pt. Pool Preg. Pt. Pool Ill Pt. Pool Preg. Pt. Pool Ill Pt. Pool Preg. Pt. Pool 

0 100.0 100.0 100.0 100.0 100.0 100.0 

2 92.2 91.4 82.8 84.6 105.6 114.0 

4 80.9 87.1 68.9 73.3 102.2 117.4 

8 77.4 87.1 54.3 59.5 100.0 95.3 

16 75.7 84.5 39.2 44.8 76.4 86.0 

32 62.6 77.6 26.4 31.3 65.2 75.6 

A-530 

636 females[F]), 80.1 cm to 90 cm (639 M, 1005 F), 90.1 to 100 cm (991 M, 1033F), 

100.1 to 110 cm (704 M, 738 F), 110.1 to 120 cm (380 M, 437 F) and greater than 

120.1 cm (312 M, 344 F). 

Results: The Figure shows a sample reference interval diagram. As expected, for the 

liver enzymes and glucose, the upper reference limits are highly correlated to WC. 

Albumin, total protein, iron and total bilirubin decreased with increasing WC while 

triglyceride and uric acid increased. 

Conclusion: Obese patients exhibit extreme as well as subtle laboratory abnormalities. 

A comparison of V- tube with BD vacutainer tubes for laboratory tests 

E. Won 1 , M. Jang 1 , M. Shin 1 , D. Cho 1 , S. Kee 1 , S. Kim 1 , J. Shin 1 , Y. Won 2 , 

D. Ryang 1 , S. Suh 1 . 1 Chonnam National University Hospital, Hwasun-gun, 

Jeollanam-do, Korea, Republic of, 2 School of Electronics and Computer 

Engineering, College of Engineering, Chonnam National University, 

Gwangju, Korea, Republic of 

Background: Vacuum tubes are widely used in the clinical laboratory for routine 

tests. We compared a newly developed V tube (AB Medical, Gwangju, Korea) and 

BD tube (BD, Franklin Lakes, NJ, USA) in common clinical assay of hematology, 

chemistry and immunoassay tests. 

Methods: A total of 100 volunteers comprising 79 patients and 21 healthy volunteer 

were recruited and peripheral blood samples were collected with two brands of EDTA 

tubes, sodium citrate tubes and serum separating tubes. The samples from EDTA 

tubes were evaluated for 16 routine hematology tests. The sodium citrate tubes were 

evaluated for 2 coagulation tests. The SST samples were evaluated for 32 routine 

chemistry items and three thyroid hormone tests. Their results were statistically 

analyzed by paired t-test and Bland-Altman plot. Additionally, the stability of each 

analyte in two brands of vacutainers was evaluated: the results of hematology tests 

at t =0 hr were compared with those at t=72±2 hr, and the results of chemistry and 

thyroid hormone test at t =0 hr were compared with those at t=72±2 hr, and t=168 ±2 

hr for each tube. 

Results: Paired t-test analysis revealed that the results of 16 routine hematology 

tests, 2 coagulation tests, 32 routine chemistry items and three thyroid hormone 

tests showed clinically allowable differences between two brands of vacuum tubes 

(t =0 hr). The results of V tube showed significant correlation between the results 

of BD tube, statistically. Stability of two vacuum tubes for each analyte was similar. 

Except for 10 items (WBC, MCV, basophil%, MCHC, monocyte%, phospholipid, 

Na, K, Cl and free T4), almost showed statistically significant but clinically allowable 

differences according to the storage duration. 

Conclusions: Newly developed V tube vacutainers provided a suitable alternative to 

BD tubes in common clinical laboratory. 

A-531 

Reference interval graphs for common clinical chemistry tests 

measured in typical US volunteers stratified by gender, race and waist 

circumference. 

M. La, Y. Qiu, G. S. Cembrowski. University of Alberta Hospital, 

Edmonton, AB, Canada 

Background: While body mass index (BMI) usually represents the magnitude of 

obesity, its concept is not easily grasped by patients or physicians. Waist circumference 

(WC) is correlated to obesity, is better understood and has a stronger relationship with 

metabolic syndrome, one of the most important sequelae of obesity. We wished to 

correlate WC to the usual ranges (reference intervals) of various laboratory tests. 

Methods: We compiled the WC, general chemistries, and other pertinent data of 

25 to 55 year old US volunteers sampled in 3 cycles of the U.S. National Health 

and Nutrition Examination Survey (NHANES), 2005-2006, 2007-2008 and 2009- 

2010. To determine reference intervals of typical US patients visiting their clinician, 

we used minimal exclusion criteria: negative serology for HIV, hepatitis C, active 

hepatitis B and consumption of < 6 drinks per day. We compiled albumin, ALT, ALP, 

AST, bicarbonate, blood urea nitrogen, calcium, cholesterol, chloride, creatinine, 

GGT, globulin, glucose, iron, LD, osmolality, phosphorus, potassium, sodium, total 

bilirubin, total protein, triglycerides, and uric acid. The three major US races were 

studied: Mexican American, white (nonHispanic White) and black (nonHispanic 

Black). 138 reference interval diagrams were constructed with the 97.5, 95, 90, 50, 

5 and 2.5 percentiles plotted against the WC intervals: 70.1 to 80 cm (200 males[M], 

A-532 

Development of a Liquid Multi-Analyte Control Containing 100 

Analytes at Clinically Relevant Levels to Increase the Efficiency of the 

Analytical Performance Assessment 

I. Palmer, A. Shanks, M. L. Rodriguez, P. Armstrong, J. Campbell, S. P. 

Fitzgerald. Randox Laboratories, Crumlin, United Kingdom 

Background: Quality control refers to the process of detection of analytical errors to 

ensure reliability and accuracy of the laboratory test results. The use of liquid multianalyte 

controls with analytes present at clinically relevant levels, not only reduces 

the number of control to be used simplifying the quality control practices, but also 

removes errors associated with the reconstitution required if lyophilised controls were 

to be employed. The consolidation of quality control provided by such liquid multianalyte 

control material would be further enhanced by covering not only chemistry 

but also immunoassay and cardiac parameters, lipids, proteins, drugs, electrophoresis, 

trace metals. 

Relevance: This study reports the development of a third party liquid multi-analyte 

clinical chemistry control containing 100 analytes (covering not only routine clinical 

chemistry but also other parameters) at clinically relevant levels, including CRP, C3, 

C4, ferritin, immunoglobins, transferrin. This is of value as a useful, comprehensive 

and convenient control material to assess accuracy and precision and to monitor 

performance in a wide range of clinical settings. 

Methodology: Multi-analyte liquid clinical chemistry human sera, containing 100 

analytes, were generated at three levels covering clinical significant levels. Each level 

of control material was dispensed in 5ml vials and stored below -20 degrees Celsius. 

The stability of the multi-analyte liquid control material was determined as the 

percentage recovery of each level stored at +2-+8 degrees Celsius related to the same 

material stored at -20 degrees Celsius at 7 days. The shelf life for was determined as 

the percentage recovery of each level of the control material stored at -20 degrees 

Celsius related to the same material stored at -80 degrees Celsius after 21 months. 

Measurements were performed on various automated analysers. 

Results: The evaluation of the developed liquid multi-analyte tri-level control showed 

for example, the following analyte concentration per level: CRP (1.1, 19.8 and 44.1 

mg/l), C3 (60.3, 114.8, 171.3 mg/dl), C4 (11.3, 22.1, 32.2 mg/dl), IgG (625.3, 1000.9, 

1582.1 mg/dl) and transferrin (133.0, 227.3, 355.8 mg/dl). The stability of the analytes 

at each concentration level as percentage recovery of control material stored at +2-+8 

degrees Celsius compared to -20 degres Celsius was < 10% after 7 days. The shelf life 

data showed a percentage recovery of control material stored at -20 degrees Celsius 

compared to -80 degrees Celsius typically



A-533 

Risk management: evaluating the effects of light in stability studies 

L. Labay, S. Noel. NMS Labs, Willow Grove, PA 

Background: Obtaining accurate results is a non-negotiable component of any 

laboratory test. It is, therefore, critical that specimens are protected from deleterious 

changes that compromise analyte concentration. This often means that collection 

containers are stored refrigerated or frozen prior to transport and analysis. However, 

processes no matter how well conceived are not infallible and at times laboratories are 

asked to test samples that were not appropriately stored. In the interest of mitigating 

this risk, individual quality control plans should address this circumstance. 

As part of our risk management strategy, we had cause to investigate our stability 

data for the antidepressant duloxetine. It was determined that light protecting serum 

samples stored at ambient temperature preserved duloxetine concentrations for at least 

30-days. Having ready access to this type of information can be beneficial in certain 

situations such as when environmental systems meant to safeguard specimens fail, or 

when specimens are improperly maintained. In the absence of this, test results and 

their interpretation may be weakened or a patient may not receive timely care. 

Methods: Two concentrations of test material (8.7 and 175 ng/mL) in blood and serum 

were prepared in bulk. Aliquots of 0.3 mL were transferred to 2 mL snap-cap tubes 

and placed in the storage conditions (ambient temperature, ambient temperature with 

light protection, 3C and -10C) until analysis on days 1, 2, 7, 14 and 30. Samples were 

tested by transferring 0.2 mL standards, controls and test material to appropriately 

labeled test tubes. Internal standard (D4-Duloxetine) was added and the test tubes 

vortexed. Zinc Sulfate (33% w/v) was then added followed by methanol. After each 

of these additions all test tubes were vortexed. Supernatants were transferred to 

autosampler vials and analyzed by HPLC separation with positive-ion electrospray 

tandem mass spectrometry (LC-MS/MS). The monitored ion transitions are 298>43.8; 

298>154 for duloxetine and 302.1>46.9; 302.1>158 for D4-Duloxetine. The linearity 

of the assay is 3.0 to 300 ng/mL with precision and accuracy of



A-536 

Diagnostic blood specimens collection for erytrocyte sedimentation 

rate: K2EDTA vs. 4NC sodium citrate 

G. Lima-Oliveira 1 , G. Salvagno 2 , G. Lippi 3 , F. Dima 2 , G. Brocco 2 , M. 

Marcori 2 , L. Mainenti 2 , G. Picheth 1 , G. Guidi 2 . 1 Federal University of 

Parana, Curitiba, Brazil, 2 University of Verona, Verona, Italy, 3 University 

of Parma, Parma, Italy 

Background and objective: The method for the erythrocyte sedimentation rate 

(ESR) was first described in 1921 by Dr R Fahraeus and Dr A Westergren, and 

rapidly became a common screening test worldwide for acute phase proteins and 

chronic diseases. Despite its limitations and the introduction of other more specific 

markers of inflammation, the ESR remains a widely used test for the screening and 

monitoring of infectious, autoimmune, malignant and other disease processes that 

affect plasma proteins and the sedimentation rate. Recently the ESR determination 

has been automatized and vacuum tubes with 4NC sodium citrate are commercialized 

to replace K2EDTA, as an ESR dedicated vacuum tube. Nevertheless, no information 

is available on the 

influence of this dedicated vacuum tube on Esr analysis. The aim of the present 

investigation is to compare ESR results obtained on blood specimens collected with 

these two different additives. 

Methods: Blood samples from 20 volunteers were collected by a single, expert 

phlebotomist. All subjects were maintained seated for 15 minutes 

to eliminate possible interferences of blood distribution. After this interval of time, 

a vein was located on the forearm using only a subcutaneous tissue transilluminator 

device (without tourniquet), and blood samples were collected using a 20-G straight 

needle (Terumo) directly into 2 different vacuum tubes: Tube I: 2 mL 4NC ESR 

Sodium Citrate Premium ® (Greiner bio-one, GmbH,Kremsmunster, Austria) and Tube 

II: 3 mL Venosafe ® 5.9 mg K 2 

EDTA (Terumo, Europe, Leuven, Belgium). All samples 

were assayed for ESR on the TEST 1 YDL® (ALIFAX, Padova, Italy). Calibrations 

were performed according to the instructions provided by the manufacturer. Analytical 

imprecision, expressed as inter-assay coefficient of variation (CV) and calculated 

according to internal quality control was 0.8-2.2%. Data were analysed with the 

paired Student’s t-test after checking for normality. 

Results: The results, expressed as mean ± standard error of the mean (SEM), showed 

statistically significant difference between Tube I (16 ± 2 mm/h) and Tube II (28 ± 3 

mm/h), P < 0.001. 

Discussion and conclusion: This investigation clearly attests that the preanalytical 

variability might also affect ESR testing, since the type of additive (4NC sodium 

citrate or K2EDTA) inside the vacuum tube could influence test results. Further 

studies with more volunteers should be done to confirm these preliminary results. 

Finally, laboratory personnel should validate reference ranges for this new kind of 

additive before introducing the new tubes in laboratory routine. 

A-537 

Assessment of the validity of Trinity Biotech ultra2 hemoglobin A1c 

results in the presence of HbE or HbD Punjab trait. 

S. Connolly 1 , S. Hanson 1 , T. Higgins 2 , C. Rohlfing 1 , R. Little 1 . 1 University 

of Missouri, Columbia, MO, 2 DynaLIFEDx, Edmonton, AB, Canada 

Hemoglobin A1c (HbA1c) is a well-established indicator of mean glycemia and risks 

for complications in patients with diabetes that is now also recommended for diabetes 

diagnosis. The presence of variant hemoglobins has been shown to affect the accuracy 

of some HbA1c assay methods, most notably those based on ion-exchange HPLC 

but also some immunoassay methods, depending upon the specific variant present. 

Boronate affinity chromatography is often used as the comparative method for 

assessing the effects of variant hemoglobins on other assay methodologies due to the 

fact that it quantitates total glycated hemoglobin regardless of the hemoglobin species 

present. We have previously shown that HbA1c results for the Trinity Biotech ultra2 

boronate affinity HPLC are not affected by HbS or HbC trait. Here we validate the 

use of the ultra2 as a comparative method when evaluating interference from HbE or 

HbD Pujab trait via comparison to results obtained from the IFCC HbA1c reference 

method (IFCC RM). For the IFCC RM the proteolytic enzyme endoproteinase Glu-C 

was used to cleave the N-terminal hexapeptides from the hemoglobin beta chains, 

then the ratio of glycated to non-glycated hexapeptides was determined using HPLC- 

Capillary Electrophoresis. The amino acid sequence of the N-terminal hexapeptides 

for the HbE and HbD Punjab beta chains are identical to the sequence for HbA so 

IFCC RM results are presumably not affected by the presence of these variants. 

Samples containing either HbE or HbD Punjab trait as verified using a Bio-Rad Beta 

Thalassemia HPLC system and Sebia Hydrasys electrophoresis at both alkaline and 

acid pH, as well as non-variant (HbAA) specimens, were collected and analyzed 

by both the ultra2 and IFCC RM. An overall test of coincidence of least-squares 

regression lines was used to determine if the presence of HbE or HbD Punjab trait 

had a statistically significant effect (P



A-539 

Do We Need to Replicate ELISA (Microtiter Plate) Assays: Quantitative 

Case. 

E. S. Pearlman 1 , L. King 2 , C. Hoang 1 , J. Parikh 2 . 1 Veterans Affairs Medical 

Center, Memphis, TN, 2 University of Tennessee Health Sciences Center, 

Memphis, TN 

Background: Historically micro-titer plate assays have required mean values of 

duplicate calibrators and patient samples to be used/reported. The lab at the VAMC 

recently acquired a Triturus (Grifols; Los Angeles, CA) ELISA analyzer to bring our 

Vitamin D assay in-house. Current (approximately 2000 requests per month) and 

anticipated volumes make single versus duplicate testing significant from both turnaround 

time and cost perspectives. 

Methods: Using the first of two duplicate OD values for the seven standards, 

calibration curves were constructed using a four parameter logistic (4PL) function on 

two different runs using Table Curve 2D software (Systat, San Jose, CA). Recoveries 

on the standards were assessed using the new calibration curves. We also determined 

results on 39 patients using the first of the two OD values and a single value calibration 

curve and compared these with Vitamin D concentrations determined from the mean 

of two OD determinations using EP Evaluator software [Data Innovations, South 

Burlington, VT]. 

Results: Fitting the data from assigned concentrations and first determination of OD 

to a 4PL function we obtain:Y = a + {b/ (1 + [x/c] d )}. On two separate runs where 

Y = OD, x = vitamin D concentration, a = (.27, .29), b = (1.88, 1.92), c = (12.09, 

12.69), d = (1.76, 1.80) and r-sq = .99. Comparing concentrations of the standards 

obtained from the above equation to the designated concentrations we found that 

for the concentration range [5.9-132] ng/mL the ratios were [97.5-110%] and [98- 

105%]. The ratios dropped to 56 and 89% at an expected concentration of 2.7 ng/dL 

and the zero calibrator results were 1.3 and .78 ng/dL. Comparing results that used 

first OD readings [F] versus those derived from duplicate testing [D} for 39 patients 

employed Deming regression (DR): F = 1.05 • D - 1.65 . The range of D was 6.6-55.6 

ng/mL with 95% CIs on the slope and y-intercept of [1.03, 1.08] and [-2.38, -0.92] 

respectively and r-sq = .998. In comparing distribution of patient results among the 

classes 35 ng/mL., there was complete concordance between D 

and F results. A comparison of D and F to results from the reference lab suggested 

similar performance with 21 and 20 percent respectively of the patient specimens 

being misclassified by one category. Between duplicate CVs on standards and patient 

sample ODs were



ambient temperature for ≤2h (baseline) or 4h, and other aliquots were stored at 

2-8°C or incubated at 37°C overnight. Two days later this procedure was repeated 

with a second fresh collection of urine from the same subjects supplemented with 

recombinant proteins (2.9 ng/mL KIM-1, 0.56 ng/mL clusterin, 0.11 ng/mL Cys-C, or 

0.56 ng/mL RBP4). Aliquots from each condition were thawed the day after collection 

and analyzed by ELISA or enzyme activity-assay. 

Results: Mean creatine-normalized biomarker concentrations in the various iterations 

of the three pools were determined and compared to those from urine that had been 

preserved with CP alone. At baseline, NGAL, A1M, Cys-C and clusterin showed 



A-545 

Effect of pH on the Stability of 5-Hydroxyindole-3-acetic Acid in Urine 

A. Abbadi 1 , J. M. El-Khoury 2 , S. Wang 2 . 1 Cleveland State University, 

Cleveland, OH, 2 Cleveland Clinic, Cleveland, OH 

Background: Measurement of 5-hydroxyindole-3-acetic acid (5-HIAA) in urine is 

important in detecting metastatic carcinoid tumors and in the study of neurological 

disorders. A few major reference laboratories recommend acidification of urine 

samples to stabilize 5-HIAA, especially at ambient temperature. However, the pH 

effect on the stability of this analyte is poorly defined in the literature. The objective 

of this study was to evaluate the pH effect on the stability of 5-HIAA in urine at 

ambient temperature. 

Methods: A 24-hr urine sample was split into two batches which were spiked with 

5-HIAA at concentrations of 5 mg/L and 15 mg/L, respectively. These batches were 

then aliquoted and the pH was adjusted to 2, 7, and 9, with the unadjusted pH of the 

urine sample being 5.73. Baseline samples (n=3) consisting of the unadjusted urine 

were frozen at -70°C immediately, while remaining aliquots were kept at ambient 

temperature then frozen at different time intervals (days 1, 4 and 7). All aliquots were 

thawed and analyzed in a single batch by a high performance liquid chromatography 

method. The criterion for significant change was 10.2%, which was calculated based 

on the within subject biological variation (20.3%). The analytical variation of the 

method was 2.89%. 

Results: The percent difference from baseline of the urinary 5-HIAA measurements at 

all tested pH conditions was less than 2.89% for up to 24 hours. Beyond that, 5-HIAA 

started to break down. The largest change was less than 7%. 

Conclusions: Contrary to the common practice, this study demonstrated that 

acidification of urine samples should not be required for stabilizing 5-HIAA in urine. 

Samples can be stored at ambient temperature non-acidified for up to 7 days. 

A-546 

AST assay performed using VITROS® 5600 MicroSlide reagent is 

sensitive to platelet resuspension. 

V. Ricchiuti, B. Karr, C. Cronin, F. Lucas. University of Cincinnati Medical 

Center, Cincinnati, OH 

Background: Resuspension of platelets into centrifuged plasma during transportation 

may lead to artificially elevated aspartate aminotransferase (AST) using VITROS® 

MicroSlide assay (VITROS® 5600, Ortho-Clinical Diagnostics, Inc., Rochester, 

NY). We performed a study to verify that a heparin plasma versus serum tube 

should be “kept upright” after centrifugation during transportation to avoid platelet 

contamination. 

Method: Heparin plasma (BD Vacutainer PST PLUS, Cat#367962) and serum (BD 

Vacutainer SST PLUS, Cat#367986) samples collected at same day and time were 

selected (n=50 each). Samples were transported upright to the VITROS® 5600 after 

reaching room temperature (RT), loaded onto the analyzer and tested for a panel of 

four tests: AST which will be affected by platelet resuspension and three other tests 

used as controls such as alanine aminotransferase (ALT), potassium (K) and thyroidstimulating 

Hormone (TSH) (Group A). Samples were centrifuged to ensure platelet 

poor plasma (platelet counts (PLTC)



pool samples were quantitatively analyzed with Vantera at ambient air temperatures 

of 60, 65, 70, 75, 80, and 85 °F. Each of the six temperature points were tested at 

humidity levels of 15% and 80%. For vibration testing, the same standardized samples 

were quantitatively analyzed with Vantera while subjected to average vertical floor 

vibrations of approximately 60, 250, 280, and 335 micro-gravities at 3, 7, 12, and 30 

Hz, respectively. 

Results: At 60 °F, low-density lipoprotein particle number (LDL-P) bias was slightly 

over 10% (10.3%) when calculated with respect to approximate maximum values 

obtained at 75 °F. Interpolation of the data at 60 and 65 °F showed that 61 °F was the 

temperature at which LDL-P bias was within 10%. At temperatures between 61 and 85 

°F, LDL-P bias was less than 10%. LDL-P bias between the 15% and 80% humidity 

levels was less than 7% at all temperatures tested. LDL-P bias due to floor vibrations 

was less than 6% at all frequencies tested. 

Conclusion: Our experiments show that the measurement of LDL-P on Vantera 

can be affected by environmental conditions such as temperature, humidity, and the 

presence of floor vibrations even after temperature dependent linear normalization 

and vibration isolation is applied. However, while the amount of bias present at each 

environmental condition is statistically significant, it is not clinically significant as 

the variance in mean analyte value in each case is less than 10% which is acceptable 

in clinical laboratories. Furthermore, the humidity and vibration levels tested in 

this study represent extreme conditions and are not considered standard operating 

conditions in a clinical laboratory. 

A-548 

Inappropriate Gel Barrier Formation at Low and Normal Total 

Protein Concentrations 

H. Li 1 , J. R. Healey 2 , M. Rapp 1 , L. E. Keczem 1 , A. S. Ptolemy 1 . 1 Gamma- 

Dynacare Medical Laboratories, London, ON, Canada, 2 Gamma-Dynacare 

Medical Laboratories, Brampton, ON, Canada 

Background: Laboratories often perform routine chemical analyses with serumbased 

blood collection tubes containing separator gels. Following centrifugation, 

inappropriate gel barrier formation has previously been reported to occur in specimens 

with elevated densities and total protein concentrations. In these specimens the barrier 

gel may float on or near the surface of the sample supernatant. Such an occurrence is 

of concern to laboratories with automated centrifugation and on-line sample transport 

systems linked to their chemical analyzers. Over an approximate six-month period we 

identified fifteen serum samples with anomalously floating separator gels. This study 

examined the relationship between total protein concentration and inappropriate gel 

formation. The presence and potential impact of serum protein abnormalities on gel 

barrier formation was also investigated by protein electrophoresis. 

Methods: In the fifteen specimens visually identified to have inappropriately 

formed gel barriers, following routine centrifugation at 2000g for 10 min, the serum 

total protein level was quantified by a colorimetric assay on a Roche Modular 

system (Roche Diagnostics). Patient serum was also analyzed by serum protein 

electrophoresis (SPE) and immunofixation electrophoresis (IFE) (Sebia Hydrasys 2) 

to detect serum abnormalities. All testing was performed according to manufacturer 

recommendations. The quantified total protein levels (reference range: 60 to 80 g/L) 

and identified serum abnormalities were systemically reviewed for the specimen 

cohort, which consisted of six male and nine female patients ranging from 39 to 95 

years in age. The average patient age was 78 years. No clinical history, including 

any potential gammopathy diagnoses or previous SPE testing, was available for all 

patients. 

Results: The average (mean ± SD) total protein concentration for all specimens (N 

= 15) was 72 ± 19 g/L. The total protein levels of only two specimens exceeded the 

normal range. Their protein concentrations were 89 and 131 g/L, respectively. Five 

specimens had low total protein concentrations, which ranged from 50 to 58 g/L in 

these samples. The average concentration of protein in the remaining nine samples 

was 72 ± 19 g/L. Inappropriate gel barrier formation with low to normal total protein 

concentrations has not been previously reported. SPE revealed the gamma globulin 

fraction to be elevated (reference range: 6 to 14 g/L) in six of the fifteen specimens 

(40%), including the two samples with elevated total protein. The presence of 

monoclonal protein, an IgG-κ and IgM-κ, was identified in two patients, respectively. 

Conclusion: Serum-based blood collection tubes containing separator gels 

may experience inappropriate barrier formation at low to normal total protein 

concentrations. High solution density is likely responsible for the observed floating 

gel barriers. Laboratories should be aware that total protein concentration is not the 

sole variable governing inappropriate gel barrier formation. 

A-549 

Chart review and Statistical Analysis of Patient Values Demonstrating 

that Sample pH can Contribute to Discrepancies Between Total 

Carbon Dioxide Measurements and Calculated Bicarbonate Values 

M. P. A. Henderson, J. L. Shaw, C. R. McCudden, S. L. Perkins. The 

Ottawa Hospital and The University of Ottawa, Ottawa, ON, Canada 

Objectives: Bicarbonate concentration is commonly used in the assessment of 

acid-base status. In clinical practice, measured total carbon dioxide and calculated 

bicarbonate are often used interchangeably, however, discrepancies are observed. 

Historical patient data was used to examine the relationship between measured total 

carbon dioxide and calculated bicarbonate. 

Methods: Total carbon dioxide in serum or plasma was measured enzymatically on 

the Siemens Dimension Vista 1500. Whole blood pH and pCO2 were measured on 

the GEM 4000 blood gas analyzer by ion-selective electrodes. The blood gas analyzer 

calculated bicarbonate using the Henderson-Hasselbach equation which assumes a 

pKa of 6.1. Records from 8849 blood gas analyses performed at The Ottawa Hospital 

were linked to total carbon dioxide measured on the same patient within 2 hours. 

Deming regression examined the relationship between calculated bicarbonate and 

measured total carbon dioxide. Linear regression examined the effect of pH, sodium 

concentration (as a surrogate for ionic strength), time interval between measurements, 

and pCO2 on the difference between carbon dioxide and bicarbonate values. 

Results: The relationship between total carbon dioxide and calculated bicarbonate 

shows proportional and constant bias: Calculated Bicarbonate = 1.23 * Total CO2 

− 5.43. The sample pH has a significant effect on the difference between calculated 

bicarbonate and total carbon dioxide (Table 1). While other factors in the model 

are statistically significant, they have inconsequential beta coefficients. Upon chart 

review, many of the patients with large discrepancies exhibited respiratory failure/ 

distress. 

Conclusions: Calculated bicarbonate and total carbon dioxide agree well near the 

reference interval but exhibit proportional and constant bias at extremes of pH. 

Calculated bicarbonate and total carbon dioxide should not be used interchangeably in 

patients with acid-base disturbances. In these situations, measurement of total carbon 

dioxide is preferable. 

Summary of Linear Regression Analysis of the Difference between Calculated Bicarbonate 

and Measured 

Paremeter Estimate (β-coefficient) Std. Error t-value Pr (> t) 

Intercept 59.81 3.68 16.25 0.00 

pH -8.56 0.5 -17.06 0.00 

pCO2 -0.06 0.01 -12.64 0.00 

Sodium -0.02 0.01 -7.03 0.00 

Bicarbonate 0.35 0.01 36.87 0.00 

Time (min.) 0.00 0.01 4.27 0.00 

A-550 

Ethanol is unaffected by clearing of lipemic samples using an airfuge 

A. A. Venner, A. Dennis, K. Carter, J. C. Wesenberg. Alberta Health 

Services, Red Deer, AB, Canada 

Background: Ethanol is commonly assayed on chemistry analyzers, often along 

with other requested analytes. Lipemia interferes with a variety of tests on chemistry 

analyzers. This interference is commonly avoided by using an airfuge to clear samples 

prior to analysis. However as ethanol is volatile, there is concern that airfuging may 

negatively impact the result. This study evaluated the effect of airfuging serum/ 

plasma samples tested for ethanol on a chemistry analyzer. 

Methods: Twenty-six serum/plasma patient samples with ethanol concentrations 

from 5-63 mmol/L (23-290 mg/dL) were tested on a Siemens Dimension Vista® 

1500 analyzer before and after airfuging (Beckman Airfuge Ultracentrifuge for 10 

minutes at 30 psi). Data analysis included summary statistics, paired two-sample t-test 

analysis, absolute and relative difference calculation, and agreement assessment by 

Bland-Altman. 

Results: For all twenty six samples, the mean ± 1SD was 33.9 ± 15.7 mmol/L (156 

± 72 mg/dL) pre-airfuge and 33.2 ± 15.6 mmol/L (153 ± 72 mg/dL) post-airfuge. 

As most results were marginally lower post-airfuge, the t-test showed a statistical 

difference (p-value = 0.004). As the range of differences was only -3.1 to 1.9 mmol/L 

(-14 to 9 mg/dL), the difference was not considered clinically significant. The results 

were highly correlated (Pearson correlation = 0.9977). The Bland-Altman analysis 


A165



(Figure) indicated that the 95% limits of agreement between the pre- and post-airfuge 

results were between a narrow range of -2.74 and 1.43 mmol/L (-13 and 7 mg/dL), 

supporting the lack of clinical significance. 

Conclusion: The difference in ethanol results pre- and post-airfuge was not clinically 

significant. The airfuge is beneficial for ethanol assays affected by lipemia. Even if 

the ethanol assay is unaffected by lipemia, if there are requested tests that are affected, 

use of the airfuge and the ability to run all of the tests together improves workflow. 

A-551 

Sodium Azide Mediated Inhibition of LOCI® Assay Methods on the 

Siemens Dimension® ExL 

B. Fernández, M. Ghadessi, M. Ban. Quantimetrix, Redondo Beach, CA 

Background: Sodium azide (NaN3) is an effective biocide in solutions that may 

otherwise support microbial growth. NaN3 is a common preservative in many 

reagent, control, and calibrator formulations. The Siemens Dimension® ExL is 

an integrated chemistry and immunoassay analyzer that supports the luminescent 

oxygen channeling (LOCI®) assay technology capable of the rapid determination of 

many analytes over a wide range of concentrations. Latex particle pairs, containing a 

photosensitizer and chemiluminescer, are formed through specific binding interactions 

with the sample. Illumination at 680nm generates the formation of singlet oxygen 

which triggers a luminescence emission used to determine the analyte concentration. 

Since NaN3 is potent scavenger of singlet oxygen, control and calibrator materials 

formulated with NaN3 may inhibit the signal on LOCI assay methods. 

Objective: To determine the effect of NaN3 on the Siemens Dimension ExL TNI and 

NTP LOCI assay methods. 

Methods: A NaN3-free human serum derived matrix was formulated with preparations 

of cardiac Troponin I (TNI) and N-terminal pro-natriuretic peptide (NTP) to clinically 

significant levels. Aliquots were divided into 8 pools to which sodium azide was 

added at 0, 0.05, 0.1, 0.2, 0.24, 0.48, 0.95, and 1.9 mg/mL respectively then were 

assayed for TNI and NTP recovery on the Siemens Dimension ExL. 

Results: 

Table 1: Effect of NaN3 on the Siemens Dimension ExL TNI and NTP LOCI Assays 

NaN3 (mg/mL) 

% Recovery vs 0 NaN3 

LOCI TNI 

LOCI NTP 

0 100% 100% 

0.05 94% 97% 

0.1 87% 91% 

0.2 83% 87% 

0.24 77% 86% 

0.48 62% 73% 

0.95 43% 59% 

1.9 25% 39% 

Conclusion: NaN3 is a potent inhibitor of the TNI and NTP LOCI assays on the 

Siemens Dimension ExL. The formulation in the commonly used 0.95 mg/mL NaN3 

concentration resulted in a significant suppression of results. While this study was 

limited to only TNI and NTP, it is likely that other LOCI methods would show similar 

results. Control and calibrator formulated with any amount of NaN3 should be avoided 

on LOCI methods prevent skewed control results, calibrator curves, and ultimately 

prevent patient misdiagnosis. The new Quantimetrix cardiac control formulation will 

be NaN3-free to avoid this issue. 

A-552 

Suggested specification for Total Error of 5 different assays used in 

Neonatal screening, obtained by Aleatory and Systematic Error sum. 

R. C. M. Barbi 1 , L. G. S. Carvalho 1 , F. D. Sandrini 1 , M. Molina 2 , C. F. A. 

Pereira 2 . 1 DASA, Cascavel, Brazil, 2 DASA, São Paulo, Brazil 

Background: Screening means to identify, within a population considered “normal”, 

those individuals who are at risk of developing a specific disease and who would 

benefit from further investigation (to confirm or to exclude this risk) or preventive 

action. An assertive neonatal screening changes dramatically the prognosis of patients, 

and early treatment ensures continuous life quality of affected children, being the 

philosophical basis of neonatal screening programs worldwide. Screening tests should 

be simple, efficient, applicable on a large scale and cheap, and it must be remembered 

that it is not a diagnostic test (and therefore it is acceptable to have false negatives, 

although not desirable) and must have high sensitivity and specificity, although it 

may be associated with a large number of false positives. The Total Error or the 

Maximum Permissible Error are different for each laboratory test, and establishes 

test performance so that it fits the purpose of use. The Analytical Total Error can be 

calculated by different approaches, the most common form is the sum of Random 

Error with Systematic one. Total Error Limits defines how much results can vary 

and/or approach targets values aimed at clinically acceptable performance for these 

laboratory tests. Evaluate the total error for 5 newborn screening tests, calculated from 

sum of Systematic and Random Errors. 

Methods: The Total Error was calculated by the sum of Random and Systematic 

Errors of 5 different neonatal screening assays (PerkinElmer®): 17 alpha 

hydroxyprogesterone, total T4, immunoreactive trypsin, TSH and Phenylalanine, 

from January to December 2012. For the Random Error we used the coefficient 

of variation (CV) of each test multiplied to 1,65 for a desired confidence level of 

90%. For Systematic Error calculation, we used results from three Proficiency Test 

providers: Control Lab® (Pesquisa Neonatal) , Centers for Disease Control and 

Prevention® - CDC - ( Newborn Screening Program) and Programa de Evaluación 

Externa de Calidad - PEEC - (Pesquisa Neonatal). 

Results: The medium CV of the period for each analyte was 8,27% for 17 alpha 

hydroxyprogesterone, 13,33%, for total T4, 8,78% for immunoreactive trypsin, 9,96% 

for TSH and 17,75% for Phenylalanine. The Total Error obtained was 22.57% for 

17 alpha hydroxyprogesterone, 26.54%, for total T4, 22.39% for immunoreactive 

trypsin, 23.38% for TSH and 35.0% for Phenylalanine. 

Conclusion: Taking into account the medium CV of the period, for each analyte, 

compared to the CV reported by the manufacturer in the package insert, we realized 

that all our obtained CVs are smaller than the ones informed by PerkinElmer®. We 

also note that the results of the Proficiency Testing are all suitable. Considering 

all these issues we can assume that the calculated Total Error for these assays are 

adequate for its proposed purposes. 

A-553 

Case Report: Molecular fetal sex determination and allogeneic 

immunization. 

F. Oliveira 1 , P. trojano 1 , P. Macedo 1 , F. Monica 2 , N. Gaburo 1 . 1 DASA, Sao 

Paulo Brasil, Brazil, 2 DASA, Rio de Janeiro Brasil, Brazil 

Background: The immunization using paternal lymphocytes has been used as 

treatment in women who had consecutive miscarriages. In literature, there is a 

concern whether this treatment can interfere with the results of tests like identification 

of fetal sex from maternal plasma and there are few data published about it. Fetal 

sex determination is an early and non-invasive method usually performed in the first 

trimester of pregnancy with fetal genetic material amplified from maternal plasma 

by a molecular method. This test targets the DSY14 region of Y chromosome and is 

routinely performed at DASA´s Molecular Diagnostics laboratory. 

Methods:A 33 years old woman, at week 8 of pregnancy was submitted to fetal sex 

determination by molecular method. The test was performed in duplicate, using two 

different DNA extractions from two different tubes, following the laboratory standard 

procedure. 

Results: Result was compatible with the presence of male fetus, with the target 

DSY14 amplification cycle threshold in 33.21 and 33.85 (cycles bellow 35.62 are 

considered positive). At 18 th gestational week ultrasound suggests a presence of 

female fetus, in disagreement with previous fetal sex determination results and a 

new blood sample was collected to repeat the test. The result was found female, with 




absence of DSY14 region amplification. The test was also repeated using the original 

primary tube sample and the male result was confirmed (excluding possible sample 

mixup). The contact with patient’s physician brought the information that she was 

submitted to an allogeneic immunization using paternal lymphocytes only one day 

prior to sample collection for fetal sex test. 

Conclusion: In this case, the immunization with male cells procedure one day prior 

to sample collection has interfered with results of fetal sex determination when the 

DSY14 is detected in plasma of pregnant women. 

A-554 

Validation of four vacuum tubes with different inhibitor of glycolysis 

G. Lima-Oliveira 1 , G. Lippi 2 , G. Salvagno 3 , M. Montagnana 3 , G. Picheth 1 , 

G. Guidi 3 . 1 Federal University of Parana, Curitiba, Brazil, 2 University of 

Parma, Parma, Italy, 3 University of Verona, Verona, Italy 

Background and objective: Necessary improvements and potential sources of 

nonconformities, either technical or concerning the quality management system, shall 

be indentified and all laboratory process shall be validated. The aim of this study 

was to validate four different kinds of sodium fluoride vacuum tubes for glucose and 

lactate determinations.Methods: Blood specimens from 19 volunteers were collected 

by a single, expert phlebotomist. All were maintained seated for 15 minutes to 

eliminate possible interferences of blood distribution. After this interval of 

time, a vein was located on the forearm using only a subcutaneous tissue 

transilluminator device (without tourniquet), and blood samples were collected 

using a 20-G straight needle (Terumo) directly into 4 different vacuum tubes: Tube I: 

Vacutainer® FX 5mg/4mg; Tube II: Vacuntainer® NaF 6mg Na2EDTA 12mg; Tube 

III: Venosafe® FX and Tube IV: Vacuo-Care® NaF/OxK). Glucose and lactate were 

performed on the same instrument cobas® 6000 module (Roche Diagnostics 

GmbH, Penzberg, Germany). The significance of the differences among samples 

(fluoride vacuum tubes) was assessed by Friedman test and Wilcoxon ranked-pairs 

test after checking for normality, at P



A-560 

PREANALYTICAL ERRORS IN CLINICAL LABORATORY 

DEPARTMENT OF A PERUVIAN NATIONAL GENERAL 

HOSPITAL 

P. C. Donayre Medina 1 , H. M. Zeballos Conislla 1 , B. J. Sanchez Jacinto 1 , A. 

Palacios Ramirez 2 , S. M. Flores Toledo 1 , J. C. Jara Aguirre 1 . 1 Universidad 

Peruana Cayetano Heredia, School of Medical Technology, Faculty of 

Medicine Alberto Hurtado, Lima, Peru, 2 Hospital Nacional Cayetano 

Heredia, Lima, Peru 

A-559 

Risk Estimates for HbA1c Result Reliability Across Four Academic 

Medical Centers Using Analytical Performance Characteristics and 

Routine Quality Control Practice 

A. Woodworth 1 , N. Korpi-Steiner 2 , J. J. Miller 1 , R. V. Lokinendi 3 , J. C. 

Yundt-Pacheco 4 , L. Kuchipudi 4 , J. M. Rhea 5 , C. A. Parvin 4 , R. Molinaro 5 . 

1 

Vanderbilt University School of Medicine, Nashville, TN, 2 University of 

North Carolina, Chapel Hill, NC, 3 University of Massachusetts Memorial 

Medical Center, Worcester, MA, 4 Bio-Rad Laboratories, Plano, TX, 5 Emory 

University, Atlanta, GA 

Background: Assay standardization has facilitated the utilization of HbA 1c 

for the 

diagnosis of diabetes. Guidelines recommend maintenance of precise and accurate 

HbA 1c 

assays with total allowable error (TE A 

) goals of



according to CLSI EP15. The %CVs at the high, middle and low levels were 8.3, 6.8 

and 5.5 %, respectively. The RiLiBAEK limits (target ±7 %) were not exceeded with 

cholesterol irrespective of the day time or workload. 


A169


Animal Clinical Chemistry 

B-01 

Wednesday, July 31, 2013 



Method Modification, Analytical Validation and Correlation of Alpha- 

2-Macroglobulin Assay for Use with Rat Serum on the Siemens Advia 

1800 Automated Clinical Chemistry Analyzer 

D. Carraher 1 , J. Stejskal 1 , M. Jesson 1 , S. Ramaiah 1 , P. Christensen 2 . 1 Pfi zer, 

Inc, Andover, MA, 2 Dako Denmark A/S, Glostrup, Denmark 

Acute phase proteins (APP) are considered to be general biomarkers of systemic 

inflammation, and there is strong correlation between their measured changes in blood 

and other inflammatory end-points. C-reactive protein (CRP) is a well-established 

and widely used indicator of the acute phase response in humans, but has an altered 

temporal and dynamic response in rodents making it a poor biomarker for pre-clinical 

studies. In contrast, alpha-2-macroglobulin (A2M) and haptoglobin respond rapidly 

and achieve sustained levels following systemic inflammation in rat, while serum 

amyloid A and serum amyloid P are better indicators in mouse. Since the underlying 

mechanisms of induction are similar for these proteins, they typically demonstrate 

good pre-clinical to clinical translatability, making them useful tools in the drug 

discovery setting when screening for compounds with better safety profiles or when 

measuring efficacy in disease models. 

The objective of this study was to verify whether assay modifications made to an 

automated, human application of A2M (Dako) could be used to measure the acute 

phase protein (A2M) in rats with results comparable to a non-automated, rat-specific 

ELISA platform. The ultimate goal was to transfer the rat assay to the Siemens Advia 

1800 and take advantage of the high throughput, rapid turnaround time, and ease-ofuse 

of the automated platform. Modifications of the clinical A2M application included 

altering the dilution of the polyclonal antibody in the Dako reagent. Increasing the 

concentration of A2M antibody increased the binding capacity of the assay, thus 

imparting improved sensitivity to the rat platform. Also pivotal to the rat A2M 

method development was manipulation of the Advia 1800 to create a 6-point standard 

curve (0.00-11.00g/L) from a single standard, Life Diagnostic’s Rat A2M calibrator 

(1.33g/L). To correlate the automated method with the ELISA assay, experimental rat 

serum samples containing varying levels of A2M were generated. Briefly, Lewis rats 

were immunized with 2.25 mg of Mycobacterium butyricum emulsified in incomplete 

Freund’s adjuvant to induce adjuvant induced arthritis. Animals were divided into 

treatment groups which included a therapeutic known to inhibit inflammation. Serum 

A2M was analyzed using both the rat-specific ELISA (Life Diagnostics, cat #2810-2) 

and the Advia 1800 automated platform. Correlation between the two platforms was 

acceptable (Deming slope, 1.889; regular slope, 1.868) and A2M measurements from 

both assays correlated with the degree of inflammation observed for each group. Mean 

Advia assay values for the treatment groups were 3.29g/L (vehicle controls), 2.80g/L 

(low dose), 1.07g/L (high dose) and



protein that was spiked in the urine matrix was contributing to the variability seen. To 

further test urine stability, all timepoints and freeze-thaw cycles were repeated with 

urine samples spiked with calibrator (10%). Follow-up testing confirmed stability out 

to 3 months and three freeze-thaw cycles. 

Conclusion: The DakoCytomation Cystatin C assay met all outlined criteria for 

validation and is appropriate for use in canine serum, plasma and urine samples to 

support pre-clinical toxicology studies. 

B-04 

Optimization, Validation, and Implementation of Hematology 

Automation in a Multispecies Clinical Pathology Laboratory 

S. E. Wildeboer, A. G. Bull, J. E. Graves, C. Phanthalansy, R. P. Giovanelli. 

Pfi zer Global Research and Development, Groton, CT 

Background: Hematology sample processing often requires time consuming 

preparation and handling of samples. In order to improve laboratory efficiency, we 

validated two automation platforms, an automated slide maker and stainer and cell 

imaging and pre-classification software in our multispecies laboratory. We selected 

the Sysmex SP-1000i TM automated slide preparation unit and CellaVision TM DM96 

automated cell imaging instrumentation based on predetermined requirements. 

Methods: The Sysmex SP-1000i was optimized for canine, non-human primate 

and rat peripheral blood smear preparation and staining using a May Grünwald- 

Geimsa stain after evaluation of multiple stain options. 10 samples per species 

were prepared and manual differentials were compared to automated results and an 

overall morphology review to ensure proper cell staining. Stain quality for additional 

species was evaluated including rabbits, mice, felines, cattle, and pigs to complete 

the validation of the instrument. To validate the CellaVision DM 96, stained smears 

were imaged from 100 slides of varying species including human, canine, non-human 

primate, mouse, rat and feline. Manual differential and morphology was performed 

microscopically and compared to those performed using the CellaVision software for 

correlation. Effort and use metrics were collected for a period of 3 months during the 

evaluation period to estimate time savings and project impact. 

Results: Optimization of the Sysmex SP-1000i allowed conservation of both slide 

angle and stain timing for all smears. The May Grünwald-Giemsa stain produced the 

most consistent stain quality and best cell identification features across all species 

evaluated. Once implemented, the automation of the slide preparation process saved 

our laboratory 80 FTE hours per year. With the consistency gains obtained using the 

slide preparation and staining from the Sysmex SP-1000i, we acquired a CellaVision 

DM96 automated cell imaging unit. Differential and morphology review using the 

CellaVision software was consistent with microscopic review. Implementation of the 

cell imaging and review process reduced our overall result turnaround time. Additional 

identified benefits gained with the implementation of cell imaging software include 

interfacing with our LIS, creation of reference databases, archival of cellular images, 

easy pathologist review, and implementation of a comprehensive cell morphology 

competency program. 

Conclusion: The incorporation of automated slide preparation, staining and cellular 

identification allowed recognized efficiency gains in our Clinical Pathology laboratory. 

By streamlining the peripheral blood smear process, we were able to consistently make 

peripheral blood smears which enabled the use of cellular identification methodology 

to be incorporated. As a result of the implementation of hematology automation, we 

found a significant reduction in time spent in the production and review of peripheral 

blood smears. 

B-05 

Determination of total serum cholesterol, HDL-C, and LDL-C in sera 

from humans and laboratory animals using 3 reagent systems and 

FPLC 

N. Everds 1 , M. Zhou 2 , L. Ross 3 , S. Z. Ratia 2 , P. Fordstrom 2 , J. F. Schroeder 3 , 

A. D. Aulbach 4 . 1 Amgen, Inc., Seattle, WA, 2 Amgen, Inc., South San 

Francisco, CA, 3 Amgen, Inc., Thousand Oaks, CA, 4 MPI Research, 

Mattawan, MI 

Background: This study evaluated the performance of Roche and Beckman-Coulter 

(B-C) clinical chemistry instruments and reagents for the determination of total 

serum cholesterol (TCHOL) and high-density and low-density lipoprotein cholesterol 

fractions (HDL-C and LDL-C) for humans and 5 laboratory animal species. 

Methods: 10 serum samples from each species were prepared from whole blood 

collected under fasted conditions. For human, cynomolgus monkey, rabbit, rat, and 

hamsters, each tube was from an individual subject. For mice, each tube contained 

serum pooled from multiple animals. Aliquots were prepared from each of the 10 

serum tubes/species, and frozen until analyzed. Aliquots were analyzed for TCHOL, 

HDL-C, and LDL-C using Roche or B-C instruments (Cobas Integra 400 and Olympus 

AU 400, 640, or 2700, respectively) and reagents as follows: TCHOL: Roche and 

B-C enzymatic assays; HDL-C: Roche dextran-based assay, Olympus detergent 

and antibody based assays; LDL: Roche cyclodextrin-based and B-C detergentbased 

assays. Aliquots were also fractionated by fast protein liquid chromatography 

(FPLC), from which HDL-C and LDL-C were calculated by determining TCHOL 

concentrations in each fraction using Roche reagents. 

Results: Results for TCHOL measured by Roche and B-C reagents were concordant 

for all species. Results for HDL-C measured by Roche reagents and HDL-C measured 

by B-C antibody-based reagents were also concordant for all species. However, results 

for HDL-C measured by B-C detergent-based reagents were concordant with Roche 

and B-C antibody-based reagents only for human, cynomolgus monkeys, rabbits, and 

hamsters. For rats and mice, HDL-C concentrations measured by B-C detergent based 

reagents were lower than those measured with the other 2 HDL-C assay systems. 

HDL-C concentration estimated by FPLC was similar to measurements using the 

Roche and B-C antibody based reagents for all species except rats and hamsters, 

which had higher HDL-C measured by FPLC. LDL-C particles for these two species 

do not elute separately from HDL-C particles, likely resulting in this overestimation 

by FPLC. LDL-C concentrations measured by Roche reagents and B-C detergentbased 

reagents were concordant for human, cynomolgus monkey, rabbit, and hamster, 

but not rats and mice. LDL-C concentrations for rats and mice were lower using the 

B-C detergent based assay compared to Roche reagents. Similarly, the sum of HDL-C 

plus LDL-C measured with B-C reagents was concordant with TCHOL for human, 

cynomolgus monkey, rabbit, and hamster, but lower than the TCHOL for rats and 

mice. 

Conclusion: Based on these results, Roche and B-C TCHOL reagents are appropriate 

for all species. HDL-C Roche and B-C antibody- and detergent-based reagents are 

appropriate for human, cynomolgus monkeys, rabbits, and hamsters. For mice and 

rats, HDL-C and LDL-C concentrations are underestimated by B-C detergent-based 

reagents. Taken together, the results suggest that Roche Diagnostics HDL-C and 

LDL-C reagents generate the most accurate results across the species evaluated. In 

animal research, the use of species-appropriate cholesterol assays is necessary for the 

generation of accurate data. 

B-06 

Development of immunoassays for quantification of NT-proBNP in 

canine blood. 

K. R. Seferian 1 , N. N. Tamm 1 , S. V. Kozlovsky 1 , F. N. Rozov 1 , V. K. 

Illarionova 2 , D. M. Filimonova 3 , A. N. Kara 4 , E. V. Beketova 4 , A. G. 

Katrukha 1 . 1 HyTest LTD, Turku, Finland, 2 Veterinary clinic “Biocontrol”, 

Blokhin Cancer Research Center, Moscow, Russian Federation, 

3 

Veterinary Center “Zoovet”, Moscow, Russian Federation, 4 Department 

of Biochemistry, School of Biology, Moscow State University, Moscow, 

Russian Federation 

Background: B-type Natriuretic Peptide (BNP) is a cardiac hormone produced by 

myocardium in response to volume overload and increased filling pressure. Active 

BNP hormone is produced along with the N-terminal fragment NT-proBNP from a 

precursor molecule proBNP by the proteolytic cleavage. Both BNP and NT-proBNP 

are known to be powerful biomarkers of heart failure in humans. During the past 5 

years species-specific NT-proBNP assays were also used to diagnose heart disease 

in veterinary. Rapid and accurate NT-proBNP measurements are essential for timely 

initiation of treatment. Thus, new generation of sensitive, precise and rapid canine 

NT-proBNP (cNT-proBNP) assays can contribute to better clinical outcomes in 

veterinary patients. 

Methods: A panel of monoclonal antibodies (MAbs) specific to cNT-proBNP was 

developed. Epitope specificity of 65 newly raised MAbs was established with the help 

of synthetic peptides corresponding to different regions of cNT-proBNP. Antibody 

epitopes were distributed throughout cNT-proBNP molecule with the exception of 

fragments 1-13 and 50-64 amino acid residues. Regions 1-13 and 50-64 were not 

immunogenic; no antibodies were isolated when selected against these fragments. 

DELFIA technology (Dissociation-Enhanced Lanthanide Fluorescent Immunoassay) 

was used for development of two-site immunoassays. MAbs were tested as capture 

and detection antibodies in such assays. Detection MAbs were labeled with stable 


A171



europium chelate. Recombinant canine NT-proBNP expressed in E. coli (HyTest, 

Finland) was used as a calibrator in assays. EDTA plasma from dogs with heart 

disease was used as a source of endogenous cNT-proBNP. 

Results: Recent studies of human NT-proBNP revealed that the central region of 

NT-proBNP (28-60 amino acid residues) is hardly available for antibodies due to 

O-glycosylation. We found that, in contrast to human NT-proBNP, all regions of cNTproBNP 

were accessible for antibodies (excluding regions 1-13 and 50-64 that were 

not examined). Among all tested combinations, fifteen two-site MAb combinations 

demonstrated the 

highest signal level with canine plasma samples and recombinant cNT-proBNP. Five 

combinations were selected for further evaluations (CaNT611 13-33 

-CaNT19 40-50 

, 

CaNT90 29-50 

-CaNT89 13-26 

, CaNT73 13-26 

-CaNT46 40-50 

, CaNT73 13-26 

-CaNT59 64-72 

, and CaNT53 64-80 

-CaNT930 13-26 

). The 

detection limit of these assays was 0.2 ng/mL or lower that was sufficient for 

determination of cNT-proBNP concentration in healthy dogs. Assays had a linear 

range of 0.2-50 ng/mL. Wide linear range enabled to 

avoid a dilution step when testing plasma specimens with high cNT-proBNP 

concentrations. Kinetic studies revealed that selected MAb combinations could 

be used for the development of rapid (20 minutes) quantitative immunoassays. 

Preliminary clinical studies showed that selected assays were able to differentiate 

healthy dogs and dogs with cardiac disease. 

Conclusion: Several combinations of MAbs specific to different epitopes of cNTproBNP 

were selected and utilized for development of rapid and 

sensitive immunoassays for measurement of cNT-proBNP in plasma samples. 

B-07 

The effects of N-acetylcysteine and ozone therapy on oxidative stress 

and inflammation in acetaminophen-induced nephrotoxicity model 

F. Ucar 1 , M. Y. Taslıpınar 1 , B. F. Alp 2 , I. Aydın 3 , F. N. Aydın 3 , M. Agıllı 3 , 

M. Toygar 4 , E. Ozkan 5 , E. Macit 6 , M. Oztosun 7 , T. Caycı 3 , A. Ozcan 8 . 

1 

Diskapi Yildirim Beyazit Training and Research Hospital, Department 

of Clinical Biochemistry, Ankara, Turkey, 2 Gulhane Military Medical 

Academy,Department of Urology, Ankara, Turkey, 3 Gulhane Military 

Medical Academy, Department of Clinical Biochemistry, Ankara, Turkey, 

4 

Gulhane Military Medical Academy, Department of Forensic Medicine, 

Ankara, Turkey, 5 Ankara Occupational Diseases Hospital,Department 

of Clinical Biochemistry, Ankara, Turkey, 6 Gulhane Military Medical 

Academy, Department of Pharmacology, Ankara, Turkey, 7 Turkish Armed 

Forces, Health Services Command, Ankara, Turkey, 8 Gulhane Military 

Medical Academy, Department of Pathology, Ankara, Turkey 

Backgrounds:Acetaminophen (APAP) is an analgesic and antipyretic agent. In 

overdoses, it is associated with nephrotoxicity. It is important to improve new 

treatment approaches against APAP-induced nephrotoxicity. We examined the 

potential protective effects of N-Acetylcysteine (NAC) and NAC+ozone therapy (OT) 

combination against APAP-induced nephrotoxicity. 

Methods: Thirty-two male Sprague-Dawley rats were divided into four groups; 

sham, control (APAP treated only), NAC (APAP+NAC therapy) and NAC+OT 

(APAP+NAC+ozone therapy). In the APAP, NAC and NAC+OT groups, renal 

injury was induced by oral administration of 1 g/kg APAP. The NAC group received 

NAC (100 mg/kg/day). NAC+OT group received NAC (100 mg/kg/day) and ozone/ 

oxygen mixture (0.7 mg/kg/day) intraperitoneally for five days immediately after 

APAP administration. All animals were killed at 5 days after APAP administration. 

Renal tissues and blood samples were obtained for biochemical and histopathological 

analyses. Neopterin, tumor necrosis factor-α (TNF-α), interleukin (IL)-6 and IL- 

10 levels were measured in sera. Malondialdehyde (MDA) levels and glutathione 

peroxidase (GPx) activities were determined in renal homogenates. 

Results: NAC and NAC+OT significantly decreased MDA and TNF-α levels, 

increased IL-10 levels and GPx activities. Serum neopterin and IL-6 levels were not 

different among all groups. APAP administration caused tubular necrosis in the renal. 

The degrees of renal necrosis of the APAP group were higher than the other groups. 

Renal injury in rats treated with combination of NAC and OT were found significantly 

less than the other groups. 

Conclusions: Our results showed that the combination of NAC and OT prevented 

renal injury in rats and reduced inflammation. These findings suggest that combination 

of NAC and OT might improve renal damages due to both oxidative stress and 

inflammation. 

B-09 

New Sensitive Anti-Müllerian Hormone (AMH) ELISA’s for Non- 

Human Primate, Rodent, Equine, Bovine, Canine and Other Species. 

A. Kumar, B. Kalra, A. S. Patel, S. Shah. Ansh Labs, Webster, TX, 

Objective: Development of specific and sensitive ELISA’s to quantify AMH in sera 

of different species. 

Relevance: Anti-Müllerian hormone (AMH) is a 140-kDa dimeric glycoprotein 

hormone belonging to the transforming growth factor-β (TGF-β) superfamily. 

Cleavage at the monobasic site generates 110-kDa N-terminal and 25-kDa C-terminal 

homodimers, which remain associated in a noncovalent complex. Recent studies have 

shown that the AMH C-terminal homodimer is much less active than the non-covalent 

complex, but almost full activity can be restored by associating the N-terminal proregion, 

which re-forms a complex with the mature C-terminal dimer. The finding 

suggests that the AMH non-covalent complex is the active form of protein. 

Methods: We have developed two-step, sandwich-type enzymatic microplate assays 

to measure species specific AMH levels in small samples sizes from 10-50 μL of 

sera in less than 3.5 hours. Equine, bovine, rat, non-human primate assays utilize 

species specific AMH calibrators. The monoclonal antibody pairs used in the above 

AMH assays bind to the non-covalent AMH complex and do not detect other related 

members of TGF-β superfamily. 

Validation: Ansh Labs Rat/Mouse and Equine/Canine AMH ELISAs showed 

excellent clinical concordance between ovariectomized versus cycling rats, spayed 

and intact female dogs, castrated and intact male dogs, geldings, stallions, mare sera 

and granulosa cell tumor (GCT) cyst fluid, respectively. The Rat/Mouse AMH ELISA 

also detects Golden and Siberian hamsters. Ultra-sensitive AMH ELISA detected 

AMH concentrations in the range of 0.1-12 ng/mL in Rhesus, Cynomolgus, Vervet, 

and Squirrel monkey sera. The enhanced specificity and analytical sensitivity (0.011 

ng/mL) of the Bovine AMH ELISA resulted in greater than 90% detection rate in 

various dairy and beef cattle breeds. Imprecision calculated on three pooled sera over 

twenty-four replicates was 2.92% at 0.61 ng/mL, 2.54% at 1.26 ng/mL and 3.65% at 

2.56 ng/mL. Dilution and spiking studies confirmed accuracy of AMH measurement 

and showed average recoveries between 90-110% for all assays. 

Conclusions: Specific, sensitive and reproducible AMH assays have been developed 

for the measurement of AMH in non-human primate, rodents, equine, bovine, canine 

and other species. The performance of these assays is ideal for investigation into the 

physiologic roles of AMH in different species. 


Management 


B-10 



Management 

Review of ordering practices for procalcitonin from a critical care unit 

J. P. Casey, L. J. McCloskey, D. F. Stickle. Jefferson University Hospitals, 

Philadelphia, PA 

Background: Literature arguably supports a role for monitoring of procalcitonin 

(PCT) during sepsis to guide timing of cessation of antibiotics therapy. At our 

institution, PCT was brought in-house in February 2012 for this purpose at the request 

of a critical care unit (CCU). Because of large costs of PCT testing, we reviewed CCU 

ordering practices to assess efficiency of PCT utilization relative to this intent. In 

particular, we examined ordering intervals relative to the minimum required to meet 

intended cutoffs for absolute and relative changes in PCT. 

Methods: CCU PCT results (Biomerieux Vidas Brahms assay) for an 8 month 

period (Feb-Sep 2012) were retrieved from electronic records. Excel spreadsheet 

software was used to assess counts, time intervals and differences between serial 

measurements. A review of literature indicated that the least restrictive cutoffs used 

to begin consideration of cessation of antibiotic therapy were either crossing to


Management 

B-15 

Driving Transformation Change in the Laboratory: Comparison of a 

Centralized and Non-centralized Laboratory System at a 1,500- bed 

University Hospital in Thailand. 

P. Kitpoka, M. Kunakorn, S. Vanavanan, K. Khupusup, S. Wongwaisayawan. 

Pathology Department, Faculty of Medicine, Ramathibodi Hospital, 

Bangkok, Thailand 

B-14 

Practical Applications of Sigma Metrics to Evaluate Assay Quality 

J. Litten, J. Householder. Winchester Medical Center, Winchester, VA 

Background: When evaluating new instrumentation, there are numerous issues to 

consider, i.e., reliability of the instrument(s), cost, turnaround times, test menu and 

vendor support. One important factor that is too often overlooked is assay quality. 

Quality measures such as accuracy and reproducibility impact physician decisions, 

which in turn can impact patient outcomes. Assay quality also impacts the laboratory. 

Bias and imprecision will affect the number of quality control rules required to 

effectively monitor an assay. This translates into time and cost and may also impact 

proficiency testing. 

Objective: The goal of this study was twofold: 1) to use Sigma Metrics to predict the 

quality of clinical chemistry assays from multiple vendors and 2) assess the real-world 

Sigma performance of assays on the Abbott ARCHITECT c8000. 

Methods: Sigma Metrics were estimated for 30 chemistry tests across six different 

vendor instruments using the equation: Sigma Metric = (TEa - Bias observed 

) / CV observed 

. 

There are several sources of bias and imprecision data that can be used during the 

instrument assessment phase to help predict the Sigma performance. These include 

proficiency testing results, information from the vendor, literature sources and Quality 

Control (QC) programs. In this study, data were obtained from the 2009 and 2010 

College of American Pathologists (CAP) Proficiency Surveys. Bio-Rad QC data were 

also used to help support findings. Clinical Laboratory Improvement Amendments 

(CLIA)/CAP performance standards were used for the total allowable error. Since 

the total error may vary across the analytical range, the total error at the medical 

decisions level(s) was used to determine the Sigma Metric for each assay. One year 

after the ARCHITECT c8000 had been in operation, the laboratory QC data was used 

to generate real-world Sigma performance metrics. 

Results: Using CAP Proficiency Survey data to estimate Sigma Metrics, 22 of 30 

ARCHITECT assays (73%) had quality ratings of good to excellent (5 Sigma or better) 

compared to 59% for the next highest vendor. None of the 30 assays evaluated on the 

ARCHITECT were of unacceptable quality (less than 3 Sigma). All other vendors 

had at least one test in this category with most having 4 to 5 methods that were of 

unacceptable quality. Using laboratory QC data generated on the ARCHITECT, 97% 

of the chemistry assays were 5 Sigma or better; 77% were 6 Sigma and 20% were 5 

Sigma. None were 4 Sigma and only one, CO2 , was 3 Sigma. There were no tests 

that were less than 3 Sigma. Every chemistry assay performed as good as estimated 

or better. Twenty-nine of the 30 assays require only a simple Westgard Rule with two 

levels of QC samples per run. Only CO2 requires multiple Westgard Rules to be run. 

Conclusion: Sigma Metrics can be used to predict the quality of an instrument’s 

assays. Sigma Metric analysis allows for easy comparison of instrument quality and 

can predict which tests will require minimal QC. The Abbott ARCHITECT chemistry 

instrument provides high quality results for over 96% of chemistry assays studied. 

Objective:To study whether the ACCELERATOR Automatic Processing System 

(APS) can improve laboratory operational efficiencies in terms of Turn Around Time 

(TAT) accomplishment, reduced process steps, less personnel and consumables usage 

reduction in a university hospital laboratory. 

Relevance: The ACCELERATOR APS is an innovative system that has ability to 

consolidate pre-analytic, analytic and post-analytic processes together in one platform. 

Methodology: One week data of TAT achievement percentage and consumables 

usage of 42 chemistry and immunology tests, as well as the waiting time from 

phlebotomy room, were obtained from laboratory information system; whereas, the 

working steps, and personnel requirements were obtained by workflow observation. 

Data and information from a new laboratory designed using centralization concept 

and having the ACCELERATOR APS installed were compared with those from the 

old laboratory, in which tests were separated into multiple analytical sections. 

Validation: TAT was measured from the time patients registered at the phlebotomy 

room until their results were released, consumables usage and waiting time from 

phlebotomy was analyzed using LIS data. Working steps and personnel requirement 

came from workflow observations inside the laboratory. 

Results: 

Old Laboratory New Laboratory (APS 

Metrics 

% Change 

(Non-centralized) implemented) 

No. of CC/IA tests 46,728 54,993 17.7% 

% Achieved TAT goal 90.5% 96% 10.6% 

Working steps 30 9 -70.0% 

Personnel 12 4 -66.7% 

Drawing sample tube usage 6,418 6,313 -1.6% 

Barcode usage 6,418 6,313 -1.6% 

Aliquot tip usage 5,548 0 -5,548% 

Aliquot cup usage 5.548 0 -5,548% 

Average waiting time from 

phlebotomy room (mins) 

15 4 -73.3% 

Conclusion: Implementation of the ACCELERATOR APS was able to make the 

Hospital Laboratory more efficient. By adopting LEAN principles, the laboratory 

reduced wasteful and unnecessary steps by combining pre-analytical, analytical 

and post-analytical processes together in one platform. The study showed that even 

though the new laboratory performed 17.7% more tests than the old laboratory, it still 

performed better and more efficiently in all the key metrics: 

• % Achievement of TAT goal increased 10.6% 

• Working step, personnel, waiting time from phlebotomy room and drawing sample 

tube were reduced by 70%, 66.7%, 73.3% and 1.6% respectively 

• Furthermore, aliquot tip and cup are not required due to the nature of the consolidated 

platform which has a huge impact in terms of cost saving for laboratory. 

B-16 

Prevalence of Folic Acid Deficiency in Hospital-Population after 

National Mandatory Folic Acid Fortification Program in Canada 

K. Sohn, T. Feltis. Trillium Health Partners, Mississauga, ON, Canada 

Objective: Folate deficiency causes macrocytosis and in pregnant woman fetal neural 

tube defects. Red blood cell (RBC) folate is better indicator of tissue folate storage 

than serum folate, which is variable depending on recent ingestion. After the national 

mandatory folate fortification (FF) in Canada in November, 1998, folate levels below 

the lower reference limit (LRL) became very rare. In order to evaluate the utility of 

routine RBC and serum folate measurements, the prevalence of folate deficiency in a 

hospital-population was compared before and after the national folic acidfortification 

program. 

Methods: A retrospective cross-sectional observational study was done using 

the database of the Credit Valley Hospital (CVH) site of Trillium Health Partners, 

Mississauga, Ontario, Canada. RBC and serum folate results were collected from 

the laboratory information system for the period between 1994 and 2012. Folate was 

measured using Quantaphase® B12/Folate Radioassay kit (Bio-Rad Laboratories, 

Hercules, CA) during 1994 through 2002 and Vitros ECi ® Folate assay kit (Ortho- 


Management 


Clinical Diagnostics, Rochester, NY) during 2003 through 2012. Lower reference 

limits (LRL),275 nmol/L(Quantaphase® assay)and 320 nmol/L(Vitros ECi ® assay) 

for RBC folate and 5 nmol/L (both assays) for serum folate, were used as the cutoff 

for deficiency. Prevalences of folate deficiency werecompared for the period 

before (1994–1998) and after (1999-2012) FF. Data were analyzed using Med-Calc® 

Software (Mariakerke, Belgium). 

Results: The prevalences of folate deficiency in female for both RBC (6.33%, 95% 

CI, 4.39, 8.27) and serum (4.85%, 95% CI, 2.74, 6.97) before the FF were significantly 

(P < 0.0001) decreased after FF to 0.31% (95% CI, 0.22, 0.39) for RBC and 0.38% 

(95% CI, 0.26, 0.50) for serum; in male for both RBC (3.63%, 95% CI,2.28, 4.97) 

and serum (6.85%, 95% CI, 3.74, 9.42) before the FF were significantly (P < 0.0001) 

decreased after FF to 0.36% (95% CI, 0.23, 0.50) for RBC and 0.38% (95% CI, 0.26, 

0.50) for serum. There was no difference in prevalence between female and male for 

all comparison. Overall, the prevalence of RBC folate deficiency was significantly 

decreased (P < 0.0001) from 4.84% [95% confidence interval (CI), 3.70, 5.99] before 

the FF to 0.28% (95% CI, 0.23, 0.34) after the FF. The prevalence of serum folate 

deficiency was also significantly decreased (P < 0.0001) from 5.58% (95% CI, 3.87, 

7.30) to 0.37% (95% CI, 0.28, 0.46). 

Conclusions: Considering the very low prevalence of folate deficiency, routine 

testing of folate is not warranted except for severe malnutrition, malabsorption and 

otherwise unexplained macrocytosis. Prior to ordering, the indications for ordering 

this test should be thoroughly assessed in order to increase pre-test probability and 

reduce unnecessary testing. 

B-17 

Tighter biological variation precision target required for lactate testing 

in patients with lactic acidosis 

G. S. Cembrowski 1 , A. Kunst 1 , M. Rimkus 1 , D. Chin 1 , S. Redel 1 , D. Tran 2 . 

1 

University of Alberta Hospital, Edmonton, AB, Canada, 2 University of 

Calgary, Calgary, AB, Canada 

Background: Allowable analytical errors are generally based on biologic variation in 

normal, healthy subjects. Some analytes like blood lactate have low concentrations in 

healthy individuals and the resultant allowable variation is large when expressed as a 

coefficient of variation (CV). In Ricos’ compendium of biologic variation, the relative 

within individual lactate variation (s b 

) averages 27% and with the desirable lactate 

imprecision becomes 13.5%. We have used a unique methodology to derive biologic 

variability (s b 

) from consecutive patient data and demonstrate that s b 

of lactate is 

significantly lower. 

Methods: A data repository provided all of the lactate results measured over a 1.5 year 

period in the General Systems Intensive Care Unit in University of Alberta Hospital in 

Edmonton. These measurements were made on either of two point of care Radiometer 

800 blood gas systems operated by Respiratory Therapy. A total of 54,000 lactates 

were measured. We tabulated the pairs of intra-patient lactates that were separated by 

0- 1, 1 to 2, 2 to 3, . . . up to 16 hr. The standard deviations of duplicates (SDD) of 

the paired lactates were calculated for each time interval. The graphs of SDD vs. time 

interval were approximately linear; the y intercept provided by the linear regression 

equation represents the sum of the biologic variation, s b 

and short term analytic 

2 

variation (s a 

): y 0 

=( s a 

+s b2 

) 1/2 . The short term analytic variation (s a 

) was determined 

from the short term imprecisions provided by Radiometer and confirmed with onsite 

control analysis. The derivation of biologic variation was performed for multiple 

patient ranges of lactate. 

Results: The Table summarizes the biologic variations for lactate for various patient 

lactate ranges. 

Conclusion: The relative desirable lactate imprecision for patients with lactic 

acidosis is about half of that of normal individuals. As such, evaluations of lactate 

measurements must incorporate lower allowable error. 

Range, 

Mean 

Patient lactates Lactate s a 

y 0 

s b 

s b 

(%) 

0 to 4 mmol/L 1.43 0.04 0.28 0.28 19.66 

0 to 10 mmol/L 1.67 0.05 0.39 0.39 23.28 

0 to 15 mmol/L 1.82 0.05 0.41 0.41 22.45 

4 to 10 mmol/L 6.01 0.15 0.64 0.62 10.39 

4 to 15 mmol/L 7.31 0.22 0.75 0.72 9.84 

B-18 

Establishing a Clinical Laboratory Quality Assurance System in 

Bhutan 

R. -. Jamtsho. Jigme Dorji Wangchuk National Referral Hopital, Thimphu, 

Bhutan 

Introduction: Quality Assurance (QA) plays a vital role in ensuring reliable results 

for patients. However, QA systems are not well established or effective in many 

developing countries due to various reasons [1]. A prior review of the laboratory 

system in Bhutan reported that these included the high cost of commercial quality 

control (QC) material; poor Internal Quality Control (IQC) system; shortage of 

laboratory expertise; erratic supply of reagents; and poor maintenance of laboratory 

equipments [2-4]. In order to address the problems of poor quality in the laboratories, 

the Ministry of Health in Bhutan collaborated with Pathologist Overseas, a non-profit 

USA based organization, established a QA pilot program in Bhutan. 

Methods: Thirteen laboratories were selected for the pilot study. The QA team 

conducted extensive training on basic QA for the laboratory staff and initiated SOP 

development. The training was both on the bench and in didactic sessions. The QA 

team also distributed frozen IQC material provided by Pathologists Overseas. Similar 

brands of reagents and IQC material were used for testing in most laboratories, and 

standardization of equipments was also implemented. The impact of this training and 

implementation of the QA activities were monitored using EQA and IQC performance 

criteria as well as a 10-category Quality survey. The EQA and IQC results were 

monitored remotely with active feedback including monthly reports, phone calls, and 

visits by members of the QA team. Two rounds of survey were conducted on quality 

of laboratory services at the regional and district laboratories. The survey involve 

collecting data containing the mean, CV and the control range used during the last 

three months prior to the date of survey, so the two rounds represent 6 months of 

quality measurements. 

Results: Overall laboratory performance and quality assurance system showed 

improvement in the second round of survey. In the first survey, the maximum score 

was 47% and minimum was 23%. The second survey showed dramatic improvement 

with maximum sore of 91% and minimum of 36%. The performance on IQC showed 

remarkable improvement following the establishment of IQC system. Unacceptable 

results in the first survey ranged from 12% to 46% and in from 0% to 32% in the 

second round. The percentage results in peer range in the beginning of RCPA cycle 

ranged from 22% to 62% improved to 56% to 96% towards the last cycle. 

Discussion: The QA team with support from the Ministry of Health and Pathologist 

Overseas, made considerable progress in improving the quality of laboratory services 

in Bhutan. However, four laboratories out of 13 could not be improved probably due 

to poor equipment functioning and pipetting technique. We conclude that extending 

the system of strengthened IQC, EQA and instrument standardization; can further 

improve the quality of results generated by district laboratories in Bhutan. 

B-19 

QC Rules for Low Sigma Clinical Diagnostic Processes 

C. A. Parvin, L. S. Kuchipudi, J. C. Yundt-Pacheco. Bio-Rad Laboratories, 

Hercules, CA 

Objective: Traditional QC rules have poor error detection ability for low sigma 

processes even with a large number of QCs. We sought more powerful QC rules for 

low sigma processes. 

Relevance: QC rules with improved power characteristics for low sigma processes 

can reduce the risk of unreliable patient results. 

Methods: Recommended QC multi-rules for low sigma processes were compared to a 

new family of QC rules based on a Z 2 statistic. A Z 2 QC rule with N 1 

QCs and rejection 

limit L 1 

computes Z = (X - T)/SD for each QC result, where X = QC result, T = QC 

target value, and SD = QC standard deviation. The Z 2 rule sums the N 1 

Z 2 values and 

rejects if the sum exceeds L 1 

. A single repeat sample Z 2 rule first tests N 1 

QCs. If the 

sum of the N 1 

Z 2 values is


Management 

Results: Let Sigma = 3 and SE c 

= 3 - 1.65 = 1.35. 

Power of QC Rules for a 3.0 Sigma Process 

QC Rule N 1 

L 1 

N 2 

L 2 

N Q 

P fr 

P ed 

(SE c 

) 

1 3s 

/2 2s 

/R 4s 

/4 1s 

4 - - - 4 0.03 0.36 

1 3s 

/2of3 2s 

/R 4s 

/3 1s 

6 - - - 6 0.08 0.63 

Z 2 (L 1 

) 4 9.49 - - 4 0.05 0.56 

Z 2 (L 1 

) 6 12.59 - - 6 0.05 0.69 

RZ 2 (L 1 

,L 2 

) 2 3.60 2 8.46 2.30 0.05 0.50 

RZ 2 (L 1 

,L 2 

) 2 2.80 4 11.32 2.97 0.05 0.60 

RZ 2 (L 1 

,L 2 

) 2 1.96 6 14.39 4.25 0.05 0.70 

RZ 2 (L 1 

,L 2 

) 4 4.89 6 17.36 5.78 0.05 0.80 

Conclusions: A single sample Z 2 rule is more powerful than the multi-rules, but still 

has

Management 


Results: Seven weeks of data was used to determine baseline performance of the 

existing ISP process (N=272 samples), and indicated that only 25% of samples 

met the new TAT goal of 2 pm. Implementation of changes resulted in an increased 

number of samples meeting the TAT goal (N=235 samples; 80% reported by 2:00 

pm over 8 weeks). Initially, the majority of delays were attributable to suboptimal 

analysis schedules (50%) and samples collected too late in the day (30%). After 

implementation of changes, special causes associated with TAT delays were 

dominated by late collections (50%) and delays in getting specimens to the lab (28%). 

Conclusions: Adjusting ISP collection and analysis processes improved the 

laboratory’s ability to meet physician-requested TAT of 2:00 pm each day. Process 

improvement efforts required involvement from two laboratory sites, transportation 

services, phlebotomy, pharmacy and nursing staff. To further improve TAT, efforts 

should focus on collection and transit time, which likely requires phlebotomist and 

nurse education. 

B-26 

Improving patient care through test-utilization strategies for NT- 

ProBNP ordering practices in the inpatient setting 

E. Kaleta 1 , K. Scheele 2 , J. Patel 2 , A. Roy Hughes 2 , L. Pearson 2 , J. 

Hernandez 2 , C. Snozek 2 . 1 Mayo Clinic, Rochester, MN, 2 Mayo Clinic, 

Scottsdale, AZ 

Background: In the environment of changing cost structure and a trend toward more 

conservative ordering strategies, particularly for Medicare patients with reimbursement 

based on capitation, test-utilization is gaining greater focus. This study concentrated 

on test-utilization and ordering practices of NT-ProBNP as a marker for congestive 

heart failure (CHF). Studies on the clinical utility of NT-ProBNP demonstrate that 

a single measurement is appropriate for identifying and staging patients with CHF, 

but significant intra-individual variation limits the utility of serial measurements 

for monitoring trending of CHF. Literature reveals that a reference change value of 

>27% for day-to-day variability is required for a significant decrease in NT-ProBNP 

concentration to show clinical improvement, and a >54%, for an increase to show 

clinical progression of CHF. This study assessed inpatient ordering practices of our 

institution to determine the frequency and appropriateness of NT-ProBNP orders; the 

results were used to guide clinical services toward appropriate test-utilization with 

evidence-based medicine. 

Objective: To assess the ordering practices of NT-ProBNP and guide test-utilization 

within the inpatient setting. 

Methods: Orders for NT-ProBNP and BNP at Mayo Clinic in Arizona (MCA) 

were extracted from the electronic medical record and entered into a test-utilization 

database. This database included all inpatient orders from 2011 and included area 

of admission, reason for hospital stay, length of stay, ordering physician, laboratory 

results and ordering date. This database was queried to determine the frequency of 

NT-ProBNP/BNP orders per hospital stay for each patient, stratified by admission 

department and ordering physician to provide a report card of ordering habits to each 

hospital area. Ordering date was used to determine if the NT-ProBNP/BNP order 

was placed on a recurring (e.g., daily) basis. Of those patients for whom multiple 

NT-ProBNP/BNP tests were performed, an evaluation was done to assess whether a 

statistically significant change in result was found, using literature values of >27% 

decrease or > 54% increase to indicate “appropriate” utilization. 

Results: In 2011, 2630 NT-ProBNP/BNP tests were performed, the majority of 

which were ordered by the Emergency Department (30.2%) and Hospital Internal 

Medicine (29.6%); the remaining 40% were divided amongst all other hospital areas. 

As anticipated, the reasons for ordering were predominantly dyspnea, CHF and 

pneumonia, followed by other pulmonary and cardiac concerns. Of the 644 tests that 

were placed on recurrent order sets, only 37.6% had clinically significant changes. Of 

the 1617 tests ordered on the same patient more than once per hospital stay, including 

those on recurrent order sets, 48.3% had clinically significant changes. Any test that 

did not have a significant change, for this study, was deemed an “unnecessary” test, 

and using the list price of $163.00 for NT-ProBNP, resulted in $95,355.00 in overordered 

tests. 

Conclusion: Over-utilization of NT-ProBNP/BNP was recognized in the practice at 

MCA, likely resulting in loss of revenue due to lack of DRG reimbursement in the 

inpatient setting. This study evaluated the extent of this over-utilization, and provided 

evidence-based data to practicing physicians in high-use clinical areas to modify 

ordering strategies. This study serves as the model for future test-utilization studies 

within MCA. 

B-29 

Strategies to improve Clinical Laboratory outcomes: Ten year 

experience through Balanced Scorecard Management System. 

M. Salinas 1 , M. Lopez Garrigos 1 , M. Gutierrez 1 , J. Lugo 1 , R. Lillo 1 , A. 

Santo-Quiles 1 , C. Leiva-Salinas 2 . 1 Hospital Universitario San Juan, San 

Juan, Spain, 2 Hospital Universitario y Politécnico La Fe, Valencia, Spain 

Background: Balanced scorecard (BSC) is a management system conceived to 

give managers and executives of private business a more ‘balanced’ view of the 

organizational performance. The aim of the study was to show how designing 

strategies through the BSC use, might improve the performance of clinical laboratory. 

Methods: We established key performance indicators (KPIs) regarding each of the 3 

BSC perspectives objectives: customer, internal business processes, and learning and 

growth of the members of the organization. Those were, respectively, the turn-around 

time (TAT) improvement for certain laboratory tests analysed in our personalized unit 

(PU), the maintenance or improvement of PU individualized attention and the number 

of work groups meetings and visits to the laboratory intranet. To check individualized 

attention in the PU, we measured the laboratory test modifications: tests added to 

the physician’s request, requested tests that were cancelled, or replaced by a more 

appropriate one. We set target objectives for each KPI and monitored those over ten 

years to check the strategies success. 

Results: The TAT KPIs improved dramatically after strategies implantation. The 

number of tests that were individualized in PU was maintained over time until primary 

care electronic order establishment in 2010. The number of work groups meetings to 

discuss about the laboratory organization and the number of visits to the laboratory 

intranet increased significantly over the years (Figure). What still remains problematic 

was to measure the financial consequences, the fourth BSC perspective. Hospital stay 

has shortened over time. It would be interesting to ascertain if a shorter laboratory 

TAT had a real contribution in a shorter hospital stay. 

Conclusions: Laboratory performance can be enhanced, through a KPI strategy 

using BSC as a management system. It keeps the organization’s members focused 

on strategy, aligned towards the same goal through the integration of the strategic 

process in the operation. 


A177


Management 

B-30 

Continuous Improvements Decrease Cardiac Troponin Turnaround 

Time (TAT) to Meet Cardiac Critical Care Standards 

L. Roquero, W. Kelly, J. Carey, J. Zajechowski, E. Herberholz, V. I. Luzzi, 

C. Feldkamp. Henry Ford Hospital, Detroit, MI 

Background and Aim: To meet 2000 American College of Cardiology/American 

Hospital Association Guidelines for the management of patients in the Emergency 

Department (ED), our Core/STAT Laboratory continued practicing Lean techniques 

to achieve the new clinical target for Troponin I (TnI) TAT (reporting 90% of negative 

TnI results within 30 minutes of receipt in the laboratory). Prior pre-analytical and 

analytical improvements did not meet the new goal. We applied new technology for 

more effective communication and to maintain focus on these critical samples. 

Methods: Microsoft Access-based electronic pending log (ePending log) was used 

to track sample receipt-to-testing-to-report within the laboratory. A color monitor 

displays specimen status in three different colors: gray = samples in lab, yellow = 

TAT nearing target, and red = TAT exceeded. We compared within-lab TnI TAT (5 

representative days) before and after implementation of ePending log. The target is 

to report >90% of negative ( 6,5 

LMA M3 

mmol/dL 

myelogram 

Sodium 

< 120 or > Prothrombin time 

> 5,0 

160 mmol/dL RNI 

Partial 

thromboplastin R > 4,0 

time 

Fibrinogen < 100 mg/dL 

Blasts 

First sample 

Result: Our laboratory performed a total of 61.071.219 tests from August to January 

, and 6.253 represented panic value results. The area of biochemistry was largely 

responsible for these results, with 54.92% (3,434), followed by hematology, with 

44,09% of the total (2,756), and microbiology 0.99% (62). Regarding hematology 

testing, neutrophil counts were the most frequent panic value detected (46%, 

n=1,265), followed by INR measurements (31%, n=855) and platelet count (12%, 

n=335). As for biochemistry testing, potassium (38%, n=1310) was the most frequent 

one, followed by glucose (26,5%, n=912) and total calcium score (12,5%, n=427). 

Conclusion : We can conclude that only 0.010% of our outpatient examinations 

generate panic values , hematology was largely responsible for the numbers and 

costs related to urgently inform patients and physicians of the results, primarily 

regarding examining neutrophil counts. Therefore, reviewing these data enables us 

to better manage samples, optimizing the process with the doctors and consequently 

diminishing costs and waste in health systems. 

B-34 

Laboratory-initiated follow up of TSH values that are markedly 

elevated and where serial levels do not indicate appropriate response. 

I. A. Hashim 1 , S. Hirany 2 , J. Ulloor 1 , S. S. Hathiramani 1 , M. J. McPhaul 1 . 

1 

University of Texas Southwestern Medical Center, Dallas, TX, 2 Parkland 

Memorial Hospital, Dallas, TX 

B-33 

Panic/critical values: Experiences from a large laboratory 

A. L. de Aquino Daher, O. Fernandes, M. Tonetti, M. A. P. Junior, E. G. 

Labes. DASA, Sao Paulo, Brazil 

Introduction: Panic/critical values are of paramount importance at the laboratory 

routine because they represent a high risk to the patient, and must be treated as high 

priority accordingly. Workers are trained for a faster response to these events in order 

to provide accurate and immediate treatment whenever necessary. 

Objective: This study aims to present our panic/critic values statistics, showing their 

distribution throughout the different departments of the laboratory, and specific tests. 

Method: A retrospective analysis to review the values considered to be of critic/ 

panic in our Laboratory information system from August 2012 to January 2013, 

dividing them into three main areas of the laboratory: hematology, biochemistry, and 

microbiology. Other areas that do not present critical/panic values were not included 

here. The following table depicts the panic/critical values we took as reference in our 

laboratory, according to the areas mentioned above. 

Introduction: Availability as well as analytical performance of Thyroid Stimulating 

Hormone (TSH) assays is acceptable and meets expectation in most cases with the 

exception of some analytical interference. However, the role of the clinical laboratory 

is likely to expand beyond reporting results on the specimen received. Here we report 

our experience and outcome of a periodic notification and follow up of TSH values 

that remain elevated or continue to increase. 

Methodology: A report of TSH values greater than 40 mIU/L and associated patients 

medical numbers is generated every two months. The report is sent to the respective 

physician for review and clinical follow up. Twelve months of data were used for the 

purpose of this study. 

Results: A total of 769 TSH values above 40 mIU/L belonging to 389 patients over a 

12 months period were obtained. TSH values greater than 40 mIU/L represented 1.0% 

of all TSH samples analysed by our laboratory during the study period. 

TSH values above the selected threshold of 40 mIU/L were as high as 957 mIU/L 

with a median of 75 mIU/L. Only 41.1% of patients (n=160) had subsequent TSH 

measurements. Review of clinical charts indicated that replacement therapy had 

been prescribed to most. Of the patients with repeat TSH measurements, 64.4% had 

subsequent decline in TSH values over time suggesting therapeutic compliance and 

appropriate follow up with a mean percentage TSH decline of 36%. Few patients 

(n=5) representing 3.1 % of those with subsequent TSH samples showed no change in 

TSH value during the study period, whereas the remaining 32.5 % of patients (n=52) 

showed unabated increase in TSH values. 

Conclusion: The role of the laboratory is likely to extend beyond that of ensuring a 

timely and accurate reporting of a test result. In this report we describe an example 

of laboratory-initiated follow up of reported TSH results and active participation in 

continued patient care. Elevated TSH values that either did not decline to normal 

limits, remained elevated or continued to increase triggered follow up communication 

with appropriate physicians and may represent a noncompliant, high risk population. 


Management 


B-35 

Evaluation of Temperature Stability during Specimen Transport 

M. J. Shashack, J. R. Petersen, A. O. Okorodudu. University of Texas 

Medical Branch, Galveston, TX 

Background: Core testing laboratories are commonly utilized as a primary testing 

center for numerous satellite clinics. Proper specimen temperature must be maintained 

when transporting samples from satellite clinics. Pre-analytical variables including 

specimen transport have been reported to account for approximately 70% of diagnostic 

laboratory errors. The objective of the study is to evaluate transportation temperature 

as a variable in the pre-analytical phase of diagnostic service. 

Methods: The core testing facility in this study serves 80+ clinics where specimens 

are collected for transport via a net work of six courier routes. Each courier carries 

a minimum of one Igloo cooler for each temperature range [room temperature (17- 

28°C), refrigerated (2-8°C), and frozen (


Management 

cost in 24,%, increase in FTE productivity in 7%, TAT < 24h in 94,5% of the tests, 

conformity with the service level agreement in 99,1% and a repetition index of 1,6%. 

Conclusion: The rollout of the DASA corporate LIS brought to the Mato Grosso 

Laboratory significant improvements across the whole chain of processes, showing us 

the importance of having a robust and 

integrated LIS even in a regional lab that can be classified as a small one. The data 

showed some dramatic improvements in productivity, efficiency, traceability, speed, 

integration and patient safety, allowing the management team to better measure and 

control the overall operational performance. 

B-39 

Infection control software HEPIC integrated to the Microbiology 

Laboratory for identification of colonyzed or infected patients with 

multiresistant microorganisms admitted to a Hospital 

A. L. Destra, A. Sola, R. Tranchesi, L. B. Faro, L. Almeida, A. C. C. 

Pignatari, O. V. P. Denardin. DASA, SÃO PAULO, Brazil 

Background: Nosocomial infections are responsible for high patient morbidity 

and mortality, with eleveted hospitalization costs, particularly for those infected by 

antimicrobial multiresistant microorganisms. Effective infection control measures 

include early identification of colonized or infected patients with these bacteria 

admitted to a hospital, particularly for patients readmitted after hospitalizations, that 

could be carriers of microorganisms acquired in previous hospitalization. 

Methods: All readmitted patients with previous antimicrobial multiresistant bacteria 

isolated from surveillance or clinical samples were identified at presentation to 

a large general hospital at Sao Paulo, Brazil, by an integrated computer network 

including the laboratory information system, the Hospital management system 

and the epidemiological surveillance and infection control software HEPIC . The 

Hospital`s nosocomial infection control service guideline defined the most important 

antimicrobial multiresistant microrganisms for precaution and isolation of patients as 

follows: Acinetobacter baumannii resistant to carbapenems (MRAb), Pseudomonas 

aeruginosa resistant to carbapenems (MRPa), Klebsiella pneumonia resistant to 

carbapenems (KPC), Enterococci resistant to vancomycin (VRE). 

Results: From January to December 2012, 144 admission alerts (at the from the 

admission of) of 79 patients previously admitted to the hospital were provided to 

the respective wards and the infection control team. Patients were readmitted to 

the hospital more than once during the year and could be carrier of more than one 

multiresitant bacteria. The following microorganisms were include in these alerts, 59 

for MRPa, 52 for KPC, 50 for MRAb, 21 for VRE, and 4 for Enterobacter spp resistant 

to carbapenems. These alerts allowed the health assistance team to implement the 

recommended infection control measures including precaution and isolation 

immediately after the readmission of the patient. 

Conclusion: The HEPIC software integrates the microbiology laboratory, the infection 

control data bank and the administrative admission hospital system, allowing an early 

identification of previously colonized or infected by multiresistant bacteria patients, 

and contributes for an effective nosocomial infection control program. 

B-40 

Use of Quality Metrics for Assessment and Prevention of Chemistry 

Laboratory Errors 

B. Chung, L. Filson, C. Brana-Mulero, A. Patel, G. Salas, M. Jin. University 

of Illinois Hospital and Health Sciences System, Chicago, IL 

Background: Patient safety initiatives have focused on reducing preventable medical 

errors, especially those resulting in longer hospital length of stay or additional 

treatment. Laboratory errors often translate to significant patient morbidity and 

mortality and considerable increased cost to health care systems. Therefore, it is 

imperative in the clinical laboratory to have a comprehensive quality assessment 

program with metrics in place to demonstrate improvements. In this study, we 

analyzed data from a large teaching medical center to identify the leading causes of 

errors in the clinical chemistry laboratory setting for targeted error prevention efforts. 

An additional objective was to evaluate the impact of the error prevention policies and 

interventions on quality improvement. 

Methods: Retrospective review and analysis of error frequencies from 14,573,539 

tests were performed to evaluate pre-analytical, analytical, and post-analytical phase 

errors that occurred in the clinical chemistry laboratory during 2010-2012. 

Results: 

2010 2011 2012 

Error Type Error Freq. Freq. Error Freq. Freq. Error Freq. Freq. 

No. (%) (ppm) No. (%) (ppm) No. (%) (ppm) 

Pre-analytical 135 52% 28.3 119 55% 24.1 86 49% 17.7 

Phlebotomy 7 3% 1.5 7 3% 1.4 6 3% 1.2 

Ordering 39 15% 8.2 21 10% 4.3 24 14% 4.9 

Processing 39 15% 8.2 12 6% 2.4 24 14% 4.9 

Sample integrity 47 18% 9.8 76 35% 15.4 31 18% 6.4 

Miscellaneous 3 1% 0.6 3 1% 0.6 1 1% 0.2 

Analytical 105 40% 22.0 64 30% 13.0 50 28% 10.3 

Result 19 7% 4.0 15 7% 3.0 11 6% 2.3 

Instrument 79 30% 16.5 34 16% 6.9 26 15% 5.4 

Dilution 3 1% 0.6 11 5% 2.2 8 5% 1.6 

Miscellaneous 4 2% 0.8 4 2% 0.8 5 3% 1.0 

Post-analytical 22 8% 4.6 32 15% 6.5 41 23% 8.4 

Transcription 21 8% 4.4 25 12% 5.1 40 23% 8.2 

Miscellaneous 1 0.4% 0.2 7 3% 1.4 1 1% 0.2 

Total 262 100% 54.8 215 100% 43.5 177 100% 36.4 

* Freq. (%) = frequency (percentage, errors), Freq. (ppm) = frequency (parts per 

million, tests) 

Conclusions: During 2010-2012, errors from the pre-analytical phase (52%) were 

the most common source of laboratory error followed by analytical (33%) and postanalytical 

(15%). Sample integrity (10.5 ppm), instrument error (9.6 ppm), and 

transcription error (5.9 ppm) were the most frequent errors in each phase, respectively. 

During this period, a decreasing trend in the number of pre-analytical and analytical 

errors per million tests was noted. We concluded that lab staff re-training, regular 

biweekly quality assurance review and discussion of observed errors, weekly 

monitoring and review of instrument flags and quality control outliers, and monthly 

technical issue discussions with vendors, contributed to the reduction of these errors. 

Post-analytical errors exhibited an increasing trend and additional efforts will focus on 

improving technologist education and LIS reporting to address this issue. 

B-41 

Description of Notification of Panic Values in Laboratory of 34 

hospitals in Brazil in 2012 

C. Rodrigues, M. L. N. Figueiredo, L. B. Faro, P. A. J. Augusto, M. L. 

Garcia, N. Silva, S. A. Malaman, O. Fernandes. DASA, SÃO PAULO, Brazil 

Background: 

Critical value is defined as a result suggesting that the patient was in an imminent 

danger unless appropriate therapy was initiated promptly. It can be called panic value. 

Initially values were defined by Clinical Laboratory Improvement Amendments 

(CLIA) in 1988, but the recent focus in patient safety, has brought increasing attention 

to the issue of laboratory critical value reporting, and is part of the requirements 

for accreditation by The Joint Commission International (JCI) and the College 

of American Pathologists (CAP). The laboratory panic value must be reported 

immediately, because of the imminent risk of patient’s life. Such notification must be 

immediate, effective and using the read-back technique. 

Methods: Were evaluated 145,832 panic value reports in 34 Hospitals in Brazil 

including São Paulo, Bahia, Porto Alegre, from January to December 2012. The 

epidemiological data were obtained from reports generated from the Laboratory 

information system named Motion®, system TOUCH. Data were analyzed and we 

calculated the difference between the panic values reported and communicated to the 

healthcare team (nurses and physicians). The panic values were appointed by Motion® 

system and they were reported by a telephone call to the physician responsible. 

Results: From January to December 2012, we identified 145,832 panic values reported 

by Motion® in 34 Brazilian hospitals, and 144,567 (99.1%) of them were adequately 

communicated to the healthcare team. It shows a high effectively communication the 

Laboratory with the health care team, and the attention to the safety patients, using 

the read-back technique. 

Conclusion: This work demonstrates an adequate percentage of panic values 

communication (above 95%), which shows a high effective communication strategy 

between the clinical laboratory and the hospitals. These parameters may be considered 

an important laboratory outcome measurement because they reflect clinical 

effectiveness, patient safety and operational efficiency. And fundamental requirement 

in Accreditation Quality. 


Point-of-Care Testing 


B-42 




On-Site Colorimetric Detection of Sweat Chloride Ion for Diagnosing 

Cystic Fibrosis 

X. Mu 1 , X. Tian 2 , K. Xu 2 , Z. Zheng 1 . 1 Institute of Basic Medical Sciences, 

School of Basic Medicine, Chinese Academy of Medical Sciences and 

Peking Union Medical College, Beijing, China, 2 Department of Respiration, 

Peking Union Medical College Hospital, Beijing, China 

Background: The detection of chloride ion in sweat is the gold standard to diagnose 

Cystic Fibrosis (CF). Most of conventional methods involve two independent steps: 

sweat collection and instrumental detection. However, such paradigm suffers from 

variations due to sweat evaporation during the collection, transfer and storage, and 

requires specialized expensive equipments, making it difficult to detect on-site. 

Methods: Here, we developed a “Band-Aid like” microfluidic paper-based analytical 

device (μPAD) for on-skin detection of sweat chloride ion (Figure A). The device can 

exchange chloride ion with hydroxide ion by the ion exchanging (IE) paper (DE81). 

The increase of OH- can turn the color of pH paper from yellow to green. The intensity 

of changed color is recorded with a cell phone camera and measured in cyan channel 

in CMYK color spaces (Figure B). The device also inherently controls the color of pH 

paper, the pH of sweat as well as the amount of detected sweet. When a certain amount 

of sweet is absorbed, the volumeter would turn purple (Figure C). A transparent and 

adhesive Tegaderm film firmly attaches the whole device to the skin (of forearm). 

Results: The required minimal volume for detection was 2 μl of sweat, and linear 

dynamic range was from 0 to at least 100 mM chloride ion (Figure D). The correlation 

coefficient was 0.9945, while within-run CV was below 5%. Since the chloride ion is 

the dominating anion in the sweat, other anions (sulfate and nitrate ions) show little 

interference. The device can distinguish healthy people (green triangle) and a mock 

sample of CF (red diamond), using the reference value of 40-60 mM chloride ion. Test 

results with CF patients will be presented. 

Conclusion: Our method integrated the separated steps of sweat analysis and 

provided a convenient and cost-effective way of colorimetric quantitative detection, 

demonstrating new opportunities in the diagnosis of CF. 

B-43 

Evaluation of platelet inhibition efficacy for patients undergoing 

coronary intervention. Clinical application of Point of Care Testing 

A. I. Alvarez-Ríos, G. Pérez-Moya, J. Romero-Aleta, A. León-Justel, J. M. 

Guerrero. H.U. Virgen del Rocio, Sevilla, Spain 

Background: Guidelines recommend that antiplatelet therapy using aspirin and 

clopidogrel should be administered to the majority of patients with acute coronary 

syndromes, including those undergoing coronary 

intervention. Clopidogrel inhibits platelet P2Y12 ADP receptors, while ADP, as an 

inductor of aggregation, stimulates both P2Y12 and P2Y1 platelet receptors. 

Objective: To evaluate the platelet inhibition efficacy in patients under regular 

maintenance dose of aspirin or clopidogrel by VerifyNow-P2Y12® assay. 

Methods: The assay VerifyNow-P2Y12 is a turbidimetric immunoassay devised 

to measure platelet function according to the ability of activated platelets to bind 

fibrinogen. The VerifyNow-P2Y12 is a rapid assay that test platelet activity over 3 

min and uses of the combination of ADP and prostaglandin E1 (PGE1) to directly 

measure the effects of clopidogrel on the P2Y12 receptor. ADP is used to maximally 

activate the platelets by binding to the P2Y1 and P2Y12 platelet receptors, while 

PGE1 is used to suppress the ADP-induced P2Y1-mediated increase in intracellular 

calcium levels. A total of 30 patients undergoing coronary intervention procedure and 

receiving anti-platelet drugs in regular maintenance dose for at least 1 week were 

enrolled. 10 patients treated with Aspirin, 10 not treated with Aspirin, and 10 with 

Clopidogrel after 5 days of suspensionbefore intervention. None of our patients were 

treated with low molecular weight heparin. 

Results from the VerifyNow-P2Y12 assay are reported in Aspirin Reaction Units 

(ARU) and in P2Y12 Reaction Units (PRU), as platelet reactivity (including baseline) 

as platelet inhibition rate. The dosage of anti-platelet drugs, combination with any 

other drugs, and clinical characters in baseline of all enrolled patients were analyzed. 

ARU ≥ 550 was used as cut-off to identify an absence of effect of aspirin and values 

< 550 reflects platelet dysfunction. The results for the clopidogrel were calculated as 

degree of inhibition (%), the reference range is 194-418 PRU. 

Results: In this study, the patients who were not under prophylactic aspirin had an 

ARU of 620 ±20 (range 563-677), while those that followed an antiplatelet therapy 

with aspirin had an ARU of 496 ±48 (range 421-540), while the degree of inhibition for 

the group taking clopidogrel was



total hemoglobin concentrations. The assay was also run in the presence of various 

potential interfering agents, including labile HbA1c, glucose, bilirubin, ascorbic acid, 

modified hemoglobins. Finally, using 30 samples of individual patient, a comparison 

study of the assay was performed against a DCCT traceable HPLC system (Bio-Rad 

Variant II). 

Results: The HbA1c cartridge assay takes about 4 minutes with only 1.5 μL of whole 

blood. The intra laboratory precision was confirmed to be 2.7%(4.6% HbA1c, n=20), 

1.9%(6.0% HbA1c, n=20), and 1.6%(8.5% HbA1c, n=20). No major interference 

has been identified for common interfering substances found in other methods. The 

comparison test with HPLC system showed a linear correlation across the normal and 

elevated range of %HbA1c (y=1.05x-0.3, n=30, P99% accurate) and 

provide a robust estimate of time since ovulation (93% agreement with LH surge 

reference). 

B-47 

Evaluation of Point of Care (POC) Prehospital Testing for Troponin 

I (cTnI) while in Hospital Transit via the Scottish Ambulance Service 

(SAS)- a Preliminary Study using the Samsung LABGEOIB10 

Analyzer 

S. Scotland 1 , P. Lunts 2 , G. Nicoll 2 , K. Barclay 3 , C. Baxter 3 , I. Archibald 3 , 

G. Miller 3 , B. I. Bluestein 4 , E. Brennan 4 , D. Kim 5 , J. Grant 6 , K. Dean 6 . 

1 

Scottish Centre for Telehealth and Telecare/NHS24, Edinburgh, United 

Kingdom, 2 NHS Borders General Hospital, Melrose, United Kingdom, 

3 

Scottish Ambulance Service, Galashiels, United Kingdom, 4 Nexus-DX, 

San Diego, CA, 5 Samsung Electronics Co.,Ltd., Suwon, Korea, Republic of, 

6 

Cisco-IBSG, San Jose, CA 

B-45 

Analytical Performance of Home Pregnancy test that estimates 

time since ovulation based on hCG threshold concentration at week 

boundaries 

S. R. Johnson 1 , P. Perry 1 , T. Alonzo 2 , M. Zinaman 3 . 1 SPD Development 

Company Ltd, Bedford, United Kingdom, 2 

University of Southern 

California, Monrovia, CA, 3 Tuft’s University School of Medicine, Boston, 

MA 

Background: A new urine pregnancy test is available in the USA, which consists 

of two immunoassay strips (one low and one high sensitivity), optical detection 

system and microprocessor which enables determination of pregnancy status and 

also estimates the number of weeks since ovulation based on hCG threshold levels. 

Results are displayed on an LCD as 1-2, 2-3 and 3+ weeks if a “Pregnant” result 

is returned. Studies have been conducted with the objective of investigating the 

analytical performance of this device. This is the first device available that equates 

urinary hCG levels to time since ovulation. Therefore it is of clinical relevance to 

understand performance of the device with regard to accuracy, specificity, precision, 

batch variation and comparison to time since ovulation by a reference method. 

Methods: Quantitative measurement of hCG was conducted on all clinical samples 

by AutoDELFIA (Perkin Elmer) for comparative purposes. Laboratory testing of 

urine samples from pregnant (n=107) and non-pregnant volunteers (n=187) was 

conducted to determine accuracy of the pregnancy test (Clearblue pregnancy test with 

weeks estimator). Test specificity was investigated using samples from pre-, peri- and 

postmenopausal non-pregnant women (n=301). Precision was examined by testing 

3 batches, across days and operators on 38 standards (0-10807mIU/ml) (n=90 per 

standard). Comparison to time since ovulation was accomplished by recruitment of 

women pre-conception and collection of daily urine samples to detect the lutenizing 

hormone (AutoDELFIA, with ovulation defined as surge+1day). Urine sample 

collection continued through early pregnancy to enable laboratory comparison of 

device results to time since ovulation (n= 153 women). A similar sample collection 

protocol also enabled pregnancy detection rate to be calculated with respect to day of 

the expected period (n=135 pregnancy cycles). 

Results: The device was >99% accurate in detecting pregnancy and no “Pregnant” 

results were seen following testing of urine samples from non-pregnant Pre, Peri and 

Background: The Scottish Borders is a large sparsely populated area with a 

population of 108,000. Within its immediate geographic confines, there is no major 

medical center with capability of interventional cardiology and its largest town has a 

population of 16,000. While patients presenting with chest pain are rapidly confirmed 

as having myocardial infarction (MI) if their electrocardiogram (ECG) demonstrates 

an ST-segment elevation (STEMI), diagnosis of non-ST segment elevation (NSTEMI) 

require more information and time to confirm a positive diagnosis. In addition to 

clinical symptoms, NSTEMI diagnoses are dependent on assessment of both clinical 

symptoms and biochemical evaluation of cTnI cardiac marker elevations. The purpose 

of this pilot study was to demonstrate the feasibility of testing NSTEMI chest pain 

patients by measurement of cTnI in the ambulance during transit. Patients excluded 

from the study were all STEMI patients who were immediately transferred directly to 

the Catheter Lab at Edinburgh Royal Infirmary. 

Principle and Methods: All ambulances were equipped with Samsung LABGEO IB10 

Analyzers, small portable lightweight (2.4 kg) immunochemistry systems capable of 

measuring from 1 to 3 cardiac biomarkers on a single 500 μL whole blood aliquot 

in approximately 20 minutes. Test devices are similar in configuration to a compact 

disc. 57 paramedics were trained to operate the LABGEO Analyzers and perform the 

cTnI tests. For this pilot study results were reported in print but the Analyzer may also 

be configured to transmit data electronically. The main objective of this first phase 

was to assess the feasibility of performing such testing accurately and precisely in 

a moving vehicle. Secondary objectives were to investigate the potential impact of 

pre-hospital cTnI testing on subsequent patient pathways based on determinations of 

clinical sensitivity and specificity. 

Results: For proficiency and training, external QC was run daily for this phase of 

the study and was within manufacturer specification. Initiation of cTnI testing in the 

ambulance reduced the average time to first cTnI result by a mean of 2.5 h compared 

to waiting until arrival at Borders General Hospital (BGH). Of 41 measurements taken 

in the ambulance, 38 were negative when repeated at the hospital (92.7% specificity). 

The other 4 were positive by both the LABGEO cTnI method and the BGH Lab cTnI 

method. 

Conclusions: While preliminary in nature, these findings suggest that early 

measurement of cTnI in NSTEMI patients, when definitively elevated, can aid in 

disposition triage decisions in a fashion similar to STEMI ECG findings. If negative 

on initial measurement, standard of care protocols require serial measurements of 

cTnI over 2 to 3 different time intervals. Based on this preliminary study, ambulance 

measurement provides a documented Time 0 presentation greater than 2 h earlier than 

waiting for hospital testing which leads to a reduction in actual time between a first 

and 2 nd serial measurement. 




B-48 

Evaluation of the Gem Premier 3000 hematocrit and hemoglobin 

parameters: a comparison between a POCT device and a CBC 

analyzer in critically ill patients 

E. Goedert 1 , T. Souza 1 , C. Silva 1 , C. F. A. Pereira 2 , P. Melo 3 , L. B. Faro 2 . 

1 

DASA, Recife, Brazil, 2 DASA, São Paulo, Brazil, 3 H. Jayme da Fonte, 

Recife, Brazil 

Background: Point of care testing (POCT) is defined as medical testing at or near 

the site of patient care. This increases the likelihood that the patient, physician, 

and care team will receive the results quicker, which allows for immediate clinical 

management decisions to be made. The intensive care unit scenario offers one of 

the best opportunities for these emergent technologies to flourish. The Diagnostic 

companies are developing year over year more integrated, portable and affordable 

instruments. Red blood cells (RBC) parameters, as hematocrit and hemoglobin levels, 

provide indirect data about the oxygenation and blood volume in critically ill patients. 

In certain emergency circumstances, these results allow a quick decision on clinical 

intervention, thereby increasing the chances of survival in these patients. These 

parameters are traditionally evaluated by robust, dedicated and specialized analyzers. 

We decided to evaluate the performance of one POCT device for the RBC parameters 

comparing it with a regular bench top Complete Blood Cells (CBC) Analyzer. 

Methods: Laboratory instruments from companies Instrumentation Laboratory® 

(Gem Premier 3000) and Sysmex ® (XT 1800i) were used for the measurement of 

erythrocyte parameters in 70 adult patients from intensive care unit of Jayme da Fonte 

Hospital, Recife, Brazil. The Gem Premier (GP) 3000 uses the direct conductivity 

methodology for hematocrit (Ht) and hemoglobin (Hb) determinations. The Sysmex 

XT (XT) 1800i uses the spectrophotometry for Hb dosage and electrical impedance 

for the Ht determination. The mean values and standard deviation were analyzed for 

both parameters and methodologies, as well as the coefficient of determination (R 2 ). 

Results: The medium Hb measurement obtained in GP and XT instruments were 

respectively 9.3g/dL ± 1.9 and 9,5g/dL ± 1.8. The medium Ht estimate in GP was 

30% ± 6.3; in the XT we obtained a score of 29.8% ± 5.1. There was no statistically 

significant difference when analyzing the variance of the different hemoglobin levels 

(p = 0.59) and hematocrit (p = 0.78). The determination coefficient was calculated at 

approximately 85% for both parameters. 

Conclusion: Physicians in intensive care units need to obtain accurate and reliable 

results in a very short period of time to manage appropriately critical care patients. 

Therefore, the availability and use of a POCT device that provides trustful results of 

hematological parameters can be cost-effective. The Gem 3000 instrument HT and Hb 

results were evaluated and considered in agreement with the same tests provided by 

XT 1800i, and are now offered regularly in this diagnostic scenario. 

B-49 

Evaluation of three whole blood point of care lactate methods by 

comparison to plasma lactate and a laboratory developed whole blood 

flow-injection MS/MS method. 

N. V. Tolan 1 , A. M. Wockenfus 1 , C. D. Koch 1 , D. J. Dietzen 2 , B. S. 

Karon 1 . 1 Mayo Clinic, Rochester, MN, 2 St. Louis Children’s Hospital and 

Washington University School of Medicine, St. Louis, MO 

Introduction: Compliance with international sepsis resuscitation guidelines, 

including point of care (POC) whole blood lactate testing, contributes to decreased 

ICU mortality from sepsis. This study evaluated three whole blood POC lactate 

methods against two plasma lactate methods and a flow-injection MS/MS method 

testing ZnSO 4 

precipitated whole blood. 

Methods: The Nova StatStrip (Nova Biomedical), i-STAT CG4+(Abbott Point 

of Care) and Radiometer ABL90 (Radiometer Medical ApS) lactate methods were 

evaluated. The mean of plasma lactate measured on the Cobas Integra 400 Plus (Roche 

Diagnostics) and Vitros 350 (Ortho Clinical Diagnostics) provided a plasma reference. 

Additionally, methods were compared to a flow-injection MS/MS assay measuring 

lactate in whole blood extracts. Intra- (n=20) and inter-assay (n=20) coefficients of 

variation (CV) were determined for the POC methods using QC material covering 

the ranges between 0.3-1.3, 1.5-2.5 (except Nova) and 5.4-9.6 mmol/L lactate. 

Method comparison was performed by collecting specimens from normal donors at 

rest (n=15), exerted (n=41) and with lactic acid-spiked samples (n=25). Due to rare 

outliners observed during Nova precision studies, samples were run in duplicate on 

two separate meters, whereas all other methods involved only duplicate testing. For 

the MS/MS method, whole blood aliquots were immediately precipitated with 0.1M 

ZnSO 4 

. This method incorporated 13 C 3 

-lactate IS and lactate measurement by flowinjection 

tandem mass spectrometry (AB Sciex API 3200 QTrap) in negative MRM 

mode. POC results were compared to the plasma values and MS/MS concentrations 

by mean bias, Bland-Altman plots, and through clinical concordance. 

Results: Intra-assay precision was



B-51 

Novel Cellular Hemoglobin A1c Control Linearity Set - Correlation 

between Analyzers, Linearity and Stability 

K. Das, S. M. Wigginton, J. M. Lechner, W. L. Ryan. Streck, Inc., La Vista, 

NE 

Background: Over 347 million of the world population and over 25 million of the 

US population are affected by diabetes, causing increasing threat to our healthcare 

and economy. Effective diabetes management includes routine monitoring and 

maintenance of a healthy lifestyle. Measuring hemoglobin A1c offers several 

advantages over measuring blood glucose. American Diabetic Association (ADA) 

criteria for diabetes diagnosis include an A1c ≥6.5%. Although the A1c values 

vary from 5±0.5% to around 12±0.5%, in rare occasions extremely low (≤4.5%) or 

high (≥16%) A1c values are reported. 1,2 These inaccuracies are attributed to various 

causes such as the low concentration of hemoglobin, or interference by hemoglobin 

variants and medications. To reliably report any abnormal results it is important to 

validate a wide range of A1c values. Additionally it is critical to assure that the entire 

instrumental analytical process, including lysing step, are functioning correctly. A1c- 

Cellular® Linearity set is a five level calibration set that encompasses 3%-20% A1c 

range. A1c-Cellular Linearity is the only cellular linearity/calibration verification 

material with intact RBC. Therefore, it can test the entire assay procedure, including 

the lysing step. Herein, we report the cross-instrument correlation of A1c values, 

linearity of A1c values within each instrument assay range, and the stability of A1c- 

Cellular Linearity. We also present a comparison of cross-instrument correlation 

between the A1c values of A1c-Cellular Linearity and whole blood sample. 

Methods: A1c-Cellular Linearity material is obtained from Streck, Inc (Omaha, NE). 

Blood samples were collected from donors with informed consent. The A1c values of 

these samples were correlated across several major A1c platforms including but not 

limited to Tosoh G8, Siemens Dimension, Bio-Rad D10. Methods and calculations 

were performed based on CLSI guidelines. 

Results: The mean A1c values of the A1c-Cellular Linearity levels are ~3.6±0.5%, 

~6.7±0.4%, ~10.1±0.6%, ~13.7±0.8% and ~18.0±0.2% respectively. The R 2 values 

are ~0.995 within the assay range for each instrument. The SD 

values for 10 successive runs on a single platform are in the range of 0.2-0.8%. The 

stability of all 5 levels was monitored on Tosoh G8, for 100 days, yielding the SD 

values of 0.1, 0.2, 0.4, 0.6 and 0.7 for Level 1 - Level 5 respectively. The ready-touse 

liquid A1c-Cellular Linearity controls have intact red cells and resemble a whole 

blood sample. 

Conclusion: The A1c values of A1c-Cellular Linearity are linear within each 

instrument ranges. The A1c values of A1c-Cellular Linearity are 

correlated between the major A1c analyzers across the entire reportable ranges of the 

instruments. The linearity set is stable for 3 months at 6 °C in a closed vial and 7 days 

at 6 °C in open vial. Furthermore, 

Streck A1c-Cellular control is the only cellular assay calibration kit with 

intact human RBC. 

Reference: 

1. Gross BN et. al. Falsely low hemoglobin A1c levels in a patient receiving Ribavirin 

and Peginterferon alfa-2b for hepatitis C. Parmacotherapy 2009; 29: 121. 

2. Zhu Y et. al. Falsely elevated hemoglobin A1c due to S-β + -thalassemia interference 

in Bio-Rad Variant II Turbo HbA1c assay. Clin Chim Acta 2009; 409:18 

B-52 

Multivariable Regression Analysis Techniques for Comparing Two 

Point of Care Devices with the Laboratory Method for Blood Glucose. 

A Practical Example Using Patient Specimens. 

V. M. Genta 1 , D. Graubner 1 , S. S. Church 2 , L. Wyer 2 , S. Spingarn 3 , Y. Shen 1 . 

1 

Sentara Virginia Beach General Hospital, Virginia Beach, VA, 2 Sentara 

Healthcare, Norfolk, VA, 3 Sentara Norfolk General Hospital, Norfolk, VA 

Background: In our Hospital patient’s blood glucose values are determined routinely 

with a laboratory method (LM) and, when a rapid response is required, with two point 

of care devices (POCD). The relationship between the performance of the POCD and 

that of the LM was evaluated by comparing patient blood glucose values obtained 

with the POCDs with those as obtained with the LM, using multivariable least squares 

regression analysis techniques. 

Methods: Cobas 6000® (Roche), SureStep Flexx® (Lifescan, Johnson and Johnson), 

i-STAT® cartridges (CG8+ ®, Chem8+ ®, Abbott Laboratories). After verifying 

that the methods were in statistical control, 168 patient specimens obtained by 

venipuncture were assayed in parallel and within 15 minutes with the three methods 

by one of us (D. G.). The observed glucose values were in the interval 40-500 mg/dL. 

The observations were collected electronically and transferred to Minitab® (Version 

16, Minitab Inc.) statistical software. Since the plot of the differences between the 

values obtained with the POCD by those as obtained with the LM showed increased 

variability for increasing blood glucose values, the observations were analyzed with 

multivariable weighted least squares regression analysis techniques (MWLSR), their 

diagnostics for adequacy of the model and their graphic representations. 

Results:The MWLSR equation was : POCD = 3 + 1.00 LM - 1.95 coded POCD, 

(code: 1 if SureStep Flexx, 2 if i-STAT cartridge), Sy/x=0.8, R^2=99.2, Variance 

inflation factor (VIF) for LM=1.039, VIF for coded POCD=1.039, PRESS=104.6. 

The test for lack-of-fit by data subsetting did not show statistically significant lack 

of fit (P>=0.1).The plots of the standardized deleted residuals (sdr) showed a quasinormal 

distribution, with no appreciable pattens (Darbin-Watson test=1.88), and one 

possible outlier (sdr= -4.53). The leverage (Hi



samples, comprising different concentration levels, ranged 0.4 to 2.5% for HbA1c and 

0.6 to 4.4% for lipids and demonstrating good precision. Method comparisons versus 

Roche cobas c 501 demonstrated close and highly significant agreement. Total error 

over the combined sites was less than 7% for HbA1c, 3% for TC, 8% for HDL and 

11% for TG. Results of performed lot-to-lot assessment and sample matrix assessment 

(capillary and venous whole blood, plasma) also showed good agreement. The quality 

of experimental data was comparable among the evaluation sites emphasizing 

reproducibility and accuracy of the cobas b 101 analyzer. A total of 78 errors (0.96%) 

existed in 8162 cobas b 101 measurements. Practicability was rated as easy to use by 

healthcare professionals; the design of system and disc, the low sample volume, and 

the routine workflow requiring no calibration activities were positively rated. 

Conclusions: The analytical performance of the cobas b 101 analyzer was fully 

suitable for its clinical use. Main advantages of the instrument are ease of use and 

convenience of handling, small sample volumes, usability of various sample types 

and calibration free system. Accordingly, the analyzer is a useful tool for monitoring 

HbA1c and the main lipid constituents in POC settings. 

B-54 

Development of a handheld multiplex point of care diagnostic for 

differentiation of Lassa fever, Dengue fever and Ebola Hemorrhagic 

Fever 

A. Jones 1 , M. Boisen 1 , R. Radkey 2 , R. Blidner 2 , A. Goba 3 , K. Pitts 1 . 

1 

Corgenix, Inc., Broomfield, CO, 2 Nanomix, Inc, Emeryville, CA, 3 Lassa 

Fever Program Kenema Government Hospital, Kenema, Sierra Leone 

Background: Lassa virus is a zoonotic virus causing severe disease and hemorrhagic 

fever (HF), infecting hundreds of thousands of people each year. Dengue virus is 

a pandemic mosquito born virus causing 50-100 million infections and several 

hundred thousand cases of HF each year. Ebola virus infection is rare but severe and 

a cause of HF with sporadic outbreaks in Central Africa. The symptoms and causes 

of HF can be difficult to distinguish but necessitate different treatment, isolation and 

epidemiological responses. There is a clear need for diagnosis of viral HF in endemic 

and austere environments, in military zones or biothreat scenarios. We have developed 

the Nanomix POC IVD Panel, a handheld electronic, carbon nanotube biosensor 

multiplex assay for the detection of Lassa, Dengue and Ebola virus hemorrhagic 

fevers. 

Methods: The POC IVD Panel assay consists of a reader/processor and sealed, 

disposable assay cartridges containing the necessary biological and chemical reagents. 

Cartridges were prepared with reaction pads coated with capture antibodies specific 

for Lassa, Dengue and Ebola. Low volume samples were mixed with a reporter pellet 

containing lyophilized HRP-conjugated antibodies and injected into the cartridge. 

The reader/processor performed the assay and wash steps and reported nano-voltage 

results in ten minutes. Lassa positive samples were also assayed with the ReLASV TM 

Lassa antigen detection ELISA. Samples included non-infectious recombinant 

proteins (Lassa, Ebola), inactivated viral culture supernatants (Dengue) and infectious 

human samples collected at Kenema Government Hospital, Sierra Leone. 

Results: Lassa, Dengue and Ebola antigens were successfully detected with the assay 

with no cross reactivity. The mean voltage of Dengue antigen positive samples was 

1417 compared to mean voltages less than 50 for LASV negative and malaria positive 

samples, p



markers. The ROC curve shows confidence interval of 95%: 0.62 to 0.68 of the 

CK-MB activity to diagnostic in function of cTp I and confidence interval of 95%: 

0.65 to 0.72 of the cTpI on CK-MB activity. The data showed that among patients 

possessed only the first test for markers in hospitals analyzed, 516 cases had CK-MB 

activity, with normal cTp I, 104 with changes in both markers, 20 cases with values 

within the normal range for both and others remaining within the limits of risk. For 

those who had serial measurements, the data showed that 69.6% of patients with CK- 

MB activity, normal in the first test, had positive results in the second measure. The 

adjusted residual analysis shows that, among patients with cTp I changed in the first 

test, 62.1% had CK-MB activity within the normal range. 

Conclusion: More than half of patients admitted with AMI were positive in the 

second dose of CK-MB activity. The cTp I significantly higher positivity for diagnosis 

compared with serial measurements of CK-MB activity. Positive results were 

predominant in males. For emergency services that utilize the strengths of CK-MB 

activity, emphasizes the importance of serial measurements necessarily to increase 

the detection of the method, especially in women. And the more worrying that 68% 

of patients seen had only one measurement of cardiac markers. Would they have been 

released or transferred to other hospitals... 

B-57 

Thromboelastometry analysis and management of life-threatening 

hemorrhage in multifocal bleeding: a case report 

A. I. Alvarez-Rios, J. Romero-Aleta, B. Pineda-Navarro, J. A. Noval- 

Padillo, J. M. Guerrero. H.U. Virgen del Rocio, Sevilla, Spain 

Background:The thromboelastometry (TEM) is a diagnostic method whose purpose 

is the detection, within a few minutes, of the hemostasis alterations that may have 

an impact on coagulation. A TEM equipment has been introduced to the surgical 

area of our hospital. It is a device that measures the viscoelastic properties of blood 

dynamical and globally. It is based on measuring the elasticity of the blood by charting 

the consistency of a clot during its formation and later fibrinolysis. It is also the “gold 

standard” for studying the fibrinolysis. TEM has been used in different clinical areas 

where implementation has caused a major change in the attitude of anesthesiologists 

and intensivists, who have daily contact with bleeding disorders. Shore-Lesserson 

et al. showed that the routine use of TEM, implies a reduction in the transfusion of 

blood products compared to standard care, based on routine laboratory testing in 

patients undergoing major cardiovascular surgery. This implies a reduction in costs 

and unnecessary exposure of the patient to blood and its derivatives. 

Objective: To describe a case report of multifocal hemorrhage after fibrinolytic 

therapy for acute myocardial infarction (AMI) which was finally treated as directed 

by a TEM study. 

Methods:A 55 year-old man with a history of ischemic heart disease with expression 

of AMI and peripheral artery disease that presented spontaneous intracerebral 

hemorrhage with moderate intraventricular component, acute hydrocephalus and 

subarachnoid hemorrhage in the context of previous AMI which was treated with 

fibrinolysis, triple antiplatelet and anticoagulation rescue percutaneous angioplasty. 

The patient, during his evolution, presented multifocal bleeding with hematemesis, 

hematuria, gingival bleeding, and hemodynamic instability. The intensivists contacted 

to our laboratory and asked for a TEM study to discard fibrinolysis as the first cause 

of bleeding. 

Results:After the study, data discarded persistent fibrinolysis (continuous graphical 

recording of the consistency of a clot during coagulation did not show that the 

maximum firmness of the clot did not decrease) and deficit of fibrinogen (FIBTEM 

was normal) as causes of bleeding. We did not observe the lengthening of coagulation 

time nor maximum firmness of clot. The cause of the bleeding was primarily due 

to platelet dysfunction. In view of these data, the patient was treated with platelet 

transfusions presenting a favorable clinical course. 

Conclusion: The knowledge of the function of patient coagulation is essential for the 

proper management of bleeding. The study by TEM facilitates, within a few minutes, 

data that allow us to manage and treat major hemostatic alterations, avoiding patient 

exposure to blood products unnecessarily and reducing economic costs. 

B-58 

Affect of format on ability to conduct and interpret home pregnancy 

tests by untrained users 

J. Pike, S. R. Johnson. SPD Development Company Ltd., Bedford, United 

Kingdom 

Background: Clinical analytical tests are now often being marketed to untrained 

people, in formats normally only used in the laboratory environment. For example, 

although many home pregnancy tests are designed to be used by women with no 

training, direct copies of laboratory tests in strip and cassette formats are also available. 

The objective of this randomised study was to determine whether these types of tests 

could be used accurately by a lay-person, in comparison to tests specifically designed 

for home use. It is important to challenge the assumption that tests formatted to be 

simple to use by trained individuals in a clinical environment, such as simple strips 

or cassette styles which require pippetting of sample, can also be used by lay people 

in the home environment. Therefore it is of relevance to investigate how the affect of 

environment and training can influence test accuracy. 

Methods: Pregnancy tests of different formats (digitally read midstream test, visually 

read midstream test, budget visual midstream test, strip test and cassette test) that are 

available to purchase from pharmacies, were tested by lay women (n=112) in their 

own homes. The women completed questionnaires regarding their ability to conduct 

the test. The same women then attended a study centre where they conducted the same 

tests on standards (0, 25, 50mIU/ml hCG) and were observed by a trained technician. 

Technicians also performed the same testing on standards. Accuracy of test results 

was determined for each format. Additional questionnaires were completed regarding 

study conduct. All testing was randomised. 

Results: Despite strip and cassette tests only being suitable for use with collected 

urine samples, women still tried to use these tests in-stream when testing at home 

(n=9 for strips and n=1 for cassette). With midstream tests, where there is an option 

for in-stream testing, most women chose to test in-stream (80-86% for the different 

midstream formats). When women used the tests at the study centre observed by a 

technician, many mistakes in testing were observed, for example, not dipping for the 

required amount of time. Accuracy of women reading the correct result was 99% for 

digital midstream, 97% for visually read midstream, 75% for budget midstream, 69% 

for cassette and 59% for strip test. Women reported the midstream tests as being easier 

to use and read. 

Conclusion: Laboratory format pregnancy tests are not suitable for at home use 

because women can not use the tests correctly, nor interpret the results. This is likely 

to be due to lower ease of use of these formats and also problems with interpretation 

of instructions for use. These types of tests should only be used by laboratory 

professionals. Only tests formatted to facilitate use by untrained people, with simple 

to understand instructions, should be available for home use. 

B-59 

Point-of-Care Testing (PoCT) for decentralised testing of lipids: 

independent evaluation protocol of a PoCT device 

L. Rossi 1 , L. Della Bartola 2 , O. Giampietro 2 , E. Matteucci 2 . 1 Azienda 

Ospedaliera Pisana, Laboratorio Patologia Clinica, AOUP, Italy, 2 Pisa 

University, Dept Clinical and Experimental Medicine, Pisa, Italy 

Background: PoCT decentralised laboratory testing is performed at sites of 

immediate patient care and its results are used for clinical decision-making. Quality 

control is required to ensure that PoCT laboratory testing is high quality and cost 

effective, in order to contribute to optimal patient care. Few studies have assessed the 

clinical agreement between lipid PoCT results compared to laboratory results. The 

aim of this study is to evaluate the accuracy and precision of PoCT devises for lipid 

screening compared with laboratory lipid test results in healthy subjects and patients 

with dyslipidaemia. 

Methods: 2 CardioChek PA Analysers (CCA) (PTS, Indianapolis, USA), which 

employ light reflectance to measure enzymatic chemical reactions using PTS PANELS 

Lipid Panel test strips to measure total cholesterol, HDL cholesterol and triglycerides 

in whole blood, were evaluated on 20 consecutive days by designed quality control kit 

(ChekMate) and PTS Panel Quality Control materials. Fasting venous samples from 

50 subjects were analysed on both CCA whose results were compared with the routine 

clinical laboratory assay of plasma lipids (COBAS 6000, Roche Diagnostics, Milano, 

Italy). Fasting finger-stick samples of 25 subjects were analysed on one CCA device 

and compared with laboratory venous results. 




Results: There was no statistically significant difference between portable 

measurements of total cholesterol, HDL cholesterol, and triglycerides vs. clinical 

laboratory results using paired Student t test. Capillary values of total cholesterol, 

HDL cholesterol, and triglycerides well correlated with laboratory results on venous 

blood (r from 0.96 to 1.0, p

Wednesday, July 31, 9:30 am – 5:00 pm 


Paired t-test: The p value was 4 mmol/L. Laboratories with recurrent flags and large deviations from the 

assigned value were required to submit investigations to report the causes of the flags. 

Results: The median of the POC glucose peer group CVs (4.5%; range 0.8%-14.5%) 

was higher than the median CV obtained in laboratory glucose peer groups (1.6%; 

range 0.6%-3.2%) at glucose concentrations of 4.6 - 17.9 mmol/L based on a total of 

166 and 179 assessments by peer group in the POC and laboratory glucose surveys, 

respectively. The median of the number of participants in the POC and laboratory 

glucose peer groups were 54 and 9, respectively. All reported laboratory glucose 

results were within the acceptable limits and no flags occurred despite the tighter 

APLs used. However, 305 (0.6%) results exceeded APLs in the POC glucose surveys. 

Investigations from 277 (0.5%) results reported pre- and post-analytical errors that 

accounted for 77% of the discordant findings. Using wrong PT items, sample mix-up 

on the bench, reporting results for wrong samples were the most frequent reasons, 

while 20% of discordant findings identified manufacturer issues, and 3% were of 

unknown origin. If laboratory glucose APLs had been applied to POCT glucose 

results, 6888 results (13%) would have been flagged. 

Conclusions: POC glucose errors vastly outnumbered any errors associated with 

laboratory glucose measurements. Additionally, the high imprecision reflects the 

looser performance criteria permitted for POC glucose testing (±20% compared to 

laboratory reference values). Although this study is based on PT samples and interlaboratory 

data, the findings could approximate the various errors encountered within 

hospitals when testing patients. In order to decrease pre- and post-analytical errors that 

are frequent in POC testing, greater attention is needed in the training of personnel 

and taking precautions to prevent transcription errors. Lastly, tighter analytical 

requirements for glucose meters are needed to serve hospital patients especially when 

POC results are used interchangeably with laboratory values. 

B-66 

Evaluation of Dialysate Fluid* on the Siemens RAPIDPoint 500 Blood 

Gas System 

N. Greeley, C. Savignano. Siemens Healthcare Diagnostics, Norwood, MA 

Introduction: Dialysis is a treatment for patients who exhibit later-stage kidney 

failure or chronic renal insufficiency. This treatment is used to clean the blood by 

removing wastes, such as urea and creatinine, as well as excess fluid from the body. 

Dialysate fluid* is a concentrated aqueous solution that is used in hemodialysis 

to filter the blood. In healthy patients, the kidneys maintain the body’s internal 

equilibrium of water and minerals, including sodium (Na + ), potassium (K + ), chloride 

(Cl - ), and calcium (Ca ++ ), which can be measured by the Siemens RAPIDPoint ® 500 

Blood Gas System. 

Methods: Test methods were adapted from the Clinical Laboratory Standards 

Institution Method Comparison and Bias Estimation Using Patient Samples (CLSI 

EP09-A2). Dialysate fluid samples (altered and unaltered) that spanned the analytical 

range for each analyte were evaluated on RAPIDPoint 500 systems, RAPIDLab ® 

348 systems, the Roche Diagnostics AVL ® 9180 Series Electrolyte Analyzer, and the 

Nelson Jameson 926S ® Chloride Meter. 




Results: Deming regression analysis comparing the RAPIDPoint 500 system to the 

predicate devices for the analyte(s) of interest passed acceptance (see Table 1). 

Conclusions: Method comparison testing showed that Na + , K + , Ca ++ , and Cl - results 

on the RAPIDPoint 500 system operated in dialysate fluid mode were substantially 

equivalent to those on the predicate devices. 

Table 1: Method Comparison Results for Na + , K + , Ca ++ , and Cl - 

RP500 vs. RL348 

n Slope R 2 Sy.x 

Na + 137 1.010 0.9988 -1.21 

K + 131 1.005 0.9994 -0.020 

RP500 vs. AVL9180 

Na + 132 0.980 0.9976 1.77 

K + 125 1.030 0.9983 -0.115 

Ca ++ 135 0.970 0.9976 -0.051 

RP500 vs. 926S 

Cl - 263 1.010 0.9975 -0.60 

Footnotes 

1 

Not available for sale in the US. Product availability varies by country. 

B-67 

Clinical and Analytical Evaluation of Three POCT Glucose Meters 

J. L. Shaw 1 , M. P. A. Henderson 1 , L. Oliveras 2 , C. Seguin 2 , T. Moran 2 , S. L. 

Perkins 1 . 1 The Ottawa Hospital and The University of Ottawa, Ottawa, ON, 

Canada, 2 The Ottawa Hospital, Ottawa, ON, Canada 

Objective: To evaluate the clinical usability and analytical performance of three 

POCT glucose meters. Input from clinical end users is rarely collected as part of 

instrument evaluation. Here, a novel approach to collection and analysis of these data 

is presented as well as the results of an in-depth analytical evaluation. 

Methods: Three commercial glucose meters, the Abbott Precision Xceed, Nova 

StatStrip and Roche Accu-Check Inform II, were evaluated by end users including 

nurses and nurse educators (n=82) from nine clinical areas across three campuses, 

including infection control. Respondents were given a demonstration of and the 

opportunity to operate each meter. Users were asked to numerically score the meters 

on the following criteria: meter size, shape and weight, screen size and readability, 

ease of operation, battery life, docking requirements, ease of cleaning, login screen, 

electronic entry, ease of performing quality control (QC), strip opening and insertion, 

sample application and time to result. 

The analytical performance of each meter was assessed according to CLSI guidelines 

(EP5, 6 and 9) including: imprecision, linearity, interferences (β-hydroxybutyrate, 

ascorbic acid, bilirubin, galactose, hematocrit and maltose) and relative bias, as 

compared to measurements made by the Siemens Vista 1500 chemistry analyzer. 

Results: End users reported the Abbott meter as the most ergonomic. Nova scored 

well on screen size and readability and time to result. Roche scored highest in the 

majority of categories, with the exception of ergonomics. Roche received particularly 

high scores in the categories of battery life, docking requirements and ease of cleaning. 

Analytically, β-hydroxybutyrate did not interfere with glucose measurements made 

by any of the meters. Bilirubin (200 mmol/L) caused negative interference with 

the Abbott and Nova meters at low glucose concentrations (10-15% at 2 mmol/L). 

Galactose produced a significant, positive interference on the Roche meter (100% at 2 

mmol/L). Elevated hematocrit caused negative interference with the Nova and Roche 

meters (25% at 2 mmol/L). Maltose showed no interference with any of the meters. 

All meters demonstrated acceptable linearity and precision. The Abbott meter showed 

a constant negative bias, of approximately 1 mmol/L, compared to the Siemens Vista 

glucose method. Minimal bias was noted for the other two meters. 

Discussion: Interference studies demonstrated significant positive interference of 

galactose with glucose measurements made by the Roche meter. This could be an 

issue in neonates with hypoglycaemia and galactosemia. Additionally, hematocrit 

interference can pose a risk in neonates where elevated hematocrit is relatively 

prevalent. Maltose did not interfere with any of the glucose meters. This had been an 

issue previously with some commercial glucose meters and was of particular concern 

in patients on peritoneal dialysis. 

The current study outlines an extensive evaluation of three POCT glucose meters 

both analytically and clinically. It can be difficult to capture input from Clinical 

Stakeholders and the approach here outlines a unique approach and model for 

collecting and analyzing these data in a large tertiary care setting. Overall, the Roche 

meter scored highest on both analytical and clinical criteria and was deemed the most 

suitable meter from an infection control perspective. 

B-68 

Integrated QC System in Point-of-Care Analyzer 

S. Mansouri, J. Cervera, N. Raymond. Instrumentation Laboratory, 

Bedford, MA 

Use of clinical analyzers in point-of-care (POC) environment by nonlaboratory 

personnel necessitates an integrated quality control (QC) system with ability to 

evaluate the complete analytical process automatically. A key requirement in 

developing such an integrated QC system is the capability to detect errors during 

each stage of the testing process, that is, pre-analytical, analytical and post analytical. 

Intelligent Quality Management (iQM) is an example of such an integrated QC system 

incorporated in the GEM analyzers for measurement of blood gases, electrolytes, 

metabolites and Co-oximetry at the point-of-care. The primary method of error 

detection in iQM is based on monitoring sensor baseline drift and using drift limit as 

a control parameter for detecting errors caused by patient blood samples containing 

interfering substances, blood clots, etc. The source of error is detected through 

identifying specific pattern in the sensor baseline drift that is indicative of a known 

failure mode. 

In this paper, we describe utilization of sensor response pattern check during sample 

measurement for further enhancing and expediting error detection capabilities of iQM. 

The methodology is based on fitting the sensor response to a logarithmic polynomial 

function for determining the fit coefficients. The magnitude of the fit coefficients is 

being used to determine normality of the response shape and detecting analyte errors 

by identifying abnormality in their response pattern. 

MATERIALS AND METHODS: Sensor outputs during sample exposure in the 

GEM® Premier 4000 analyzer (Instrumentation Laboratory, Bedford, MA) were 

collected at one second intervals and the response from 15 to 30 seconds was fit to 

a second degree logarithmic polynomial. A linear logarithmic fit was used for the 

electrolytes. For calculating the fit coefficients, outliers in the sensor response data 

were identified by studentized residual technique and removed. 

RESULTS: A total of about 1,000 samples from six GEM Premier 4000 analyzers 

covering the reportable range of the analytes were used to calculate the mean and 

standard deviations (SD) of the fit coefficients. A preliminary analyte response 

normality check was established based on the fit coefficient being within the mean ± 

5SD range. Analyte results with abnormal fit coefficient were found to be significantly 

deviated from their target values. Those included samples contaminated with sodium 

thiopental which reported erroneous pCO2 results and samples contaminated 

with thiocyanate reporting erroneous chloride results. In case of the thiopental 

contamination, there were a few marginally erroneous results that were not detected 

by the response pattern check but were flagged for interference by the existing iQM 

check. Ability for detecting analyte errors in sample result due to air bubble hangup 

over sensors was investigated by purposely creating stream of air bubbles in the 

sample. There were few erroneous results for the sodium and chloride that were 

detected by the sample normality pattern check but were not detected by the existing 

iQM check of baseline monitoring. 

CONCLUSION: This study demonstrated utility of the sample normality pattern 

check in complementing and enhancing iQM error detection in the GEM system. The 

new checks could expedite detection of certain errors to the time of measuring sample 

result. 

B-69 

Demonstration of the MBio CD4 System for T-cell counting at the 

point-of-care 

M. Lochhead 1 , M. Givens 1 , A. Weaver 1 , Y. Yu 1 , S. Bickman 1 , J. Ives 1 , E. 

Noormahomed 2 , C. Logan 3 , C. Benson 3 , R. Schooley 3 . 1 MBio Diagnostics, 

Inc., Boulder, CO, 2 

Universidade Eduardo Mondlane, Maputo, 

Mozambique, 3 University of California, San Diego, San Diego, CA 

Background: Destruction of CD4 helper T cells is the hallmark of HIV infection. 

Worldwide, the CD4 T cell count is used for disease staging and management of 

HIV-infected individuals. Flow cytometry provides 

accurate measurements of CD4 T cells and is the current standard-of-care in most 

settings. Unfortunately, flow cytometry is typically performed in centralized 

laboratories, rendering access to CD4 count as a challenge in high disease burden, 

resource-limited settings. Results are presented here demonstrating performance of a 

simple, robust, point-of-care CD4 counting system. 


A189



Methods: The MBio CD4 System consists of single use disposable cartridges and a 

simple reader. For this performance evaluation, single-use lyophilized reagent tubes 

were also prepared as part of a heat-stable reagent development program. A total of 

49 HIV-infected blood donors in San Diego, CA and Maputo, Mozambique provided 

venous blood tube specimens under IRB-approved protocols. Specimens were run in 

triplicate on the MBio System. Reference testing was by flow cytometry. The MBio 

protocol was as follows. Ten microliter whole blood samples were added to the dried 

reagent tube and then were immediately transferred to the MBio cartridge. After a 20 

minute incubation, cartridges were analyzed on the MBio CD4 Reader which provides 

an absolute CD4 T cell count in cells per microliter whole blood. 

Results: A total 49 samples were run in triplicate. Median cell count for the collection 

based on flow cytometry was 291 cells/uL, and specimens ranged from 0 cells/uL to 

1206 cells/uL. There was one cartridge failure so a total of 146 results were reported. 

The Bland-Altman method was used to compare the MBio results to reference flow 

cytometry. B-A parameters were as follows: mean bias: -11 cells/uL (95% CI = -22.1 

to -0.6 cells/uL); upper limit of agreement: 118 cells/uL (95%CI = +99.8 to +127.0 

cells/uL); and lower limit of agreement: -141 cells/uL (95% CI = -159.7 to -122.5 

cells/uL). Results accuracy in this demonstration is within a clinically useful range. 

Conclusion: The point-of-care system presented here has been successfully 

demonstrated to deliver absolute CD4 counts over a clinically useful range. The 

system has particular utility for resource-limited settings. 

B-70 

Performance evaluation of a new one-step quantitative prostatespecific 

antigen assay, the FRENDTM PSA test 

H. Park 1 , S. LEE 2 , D. Jekarl 1 , Y. Kim 1 , C. Lee 3 , S. Han 3 , C. Chung 3 , J. 

Chang 3 . 1 Catholic University of Korea, Seoul, Korea, Seoul, Korea, 

Republic of, 2 Incheon St. Mray’s Hospital, Catholic University of Korea, 

Seoul, Korea, Incheon, Korea, Republic of, 3 NanoEnTek, Inc., Seoul, 

Korea, Republic of 

Background: The aim of this study was to evaluate a new one-step quantitative 

prostate- specific antigen (PSA) assay, the FREND TM PSA test (NanoEnTek Inc, 

Seoul, Korea) that has been developed for point-of-care testing. It is a lateral-flow 

fluorescence immunoassay for determining PSA level on a chip card by measuring 

laser-induced fluorescence on a test device. 

Methods: The imprecision, linearity, hook effect and detection limit (LoD) of the 

FREND PSA test were evaluated according to Clinical and Laboratory Standard 

Institute (CLSI) guidelines. For methods comparison, aliquots of 61 clinical samples 

over the analytical measuring range claimed by manufacturer’s instruction (0.1-25.0 

ng/mL) were measured in duplicate during 5 days with FREND PSA test and other 

three comparative PSA assays as follows: Access Hybritech ® PSA assay (Beckman 

Coulter, Inc.) using UniCel DxI 800 Access Immunoassay System; Architect ® Total 

PSA assay (Abbott Diagnostics Division) using Architect i2000 SR; cobas ® total PSA 

assay (Roche Diagnostics) using cobas e 601 analyzer. Data were analyzed using 

StatisPro TM version 2.00.00 (Analyses-it ® software Ltd. and CLSI ® ). 

Results: Total CVs of the imprecision for low (0.19 ng/mL), medium (2.76 ng/ 

mL), and high PSA levels (16.63 ng/mL) were 14.7%, 9.9%, and 8.9%, respectively. 

Linearity was observed from 1.10 to 18.87 ng/mL and hook phenomenon did not 

appear up to 171.48 ng/mL. The calculated LoD value was 0.094 ng/mL. In the 

comparison study, the regression equations of the FREND PSA test (y) with Access 

Hybritech, Architect, and cobas PSA (y) were obtained as follows: y = -0.0169 + 

1.243*x (r=0.959), y = 0.4141 + 0.941*x (r=0.947), y = 0.0889 + 1.019*x (r=0.954), 

respectively. At a medical decision point of 4.0 ng/mL, the differences between 

FREND PSA and Architect PSA, and between FREND PSA and cobas PSA were 

0.592 ng/mL and 0.609 ng/mL, respectively, which were less than desirable (18.7%) 

specification for bias, while the FREND PSA was higher than Access Hybritech PSA 

by 1.50 ng/mL. 

Conclusions: The FREND PSA test showed a reliable performance and results 

overall comparable to those of 3 other widely accepted PSA assays. The test was a 

simple and rapid method for measuring PSA, suggesting that it has clinical benefit for 

point-of-care testing. 

B-71 

Development of an easy-to-use C-reactive protein (CRP) point-of-care 

test (POCT) for analysis from easily accessible capillary whole blood 

samples 

D. Schwanzar, J. Baumgaertner, M. Grimmler, T. Hektor. DiaSys GmbH, 

Holzheim, Germany 

Background: C-reactive protein (CRP) has been extensively studied and compared 

for its efficacy as a marker of inflammation and bacterial infection. In a point-ofcare 

setting, a serial monitoring of patients’ CRP-values is vital to patient outcomes. 

The optionally battery-assisted DiaSys InnovaStar® CRP IS® setup allows access 

to this information through a convenient and minimally-invasive capillary puncture 

even in remote rural settings. Assisting in antibiotic treatment decisions by ensuring 

easy access to a patient’s CRP value, InnovaStar CRP IS point-of-care-test (POCT) 

will help to protect against the mounting global problem of antibiotic resistance. 

The detection of untreated bacterial infections remains the primary cause of death 

of children below the age of 5. More than 90 % of these deaths occur in the poorest 

countries of Asia and Africa. 

Objective: Development of a CRP POCT that additionally detects the hemoglobin 

concentration to calculate plasma corrected values, thus allowing the measurement of 

CRP from easily accessible capillary whole blood samples. 

Methods: We developed a latex-enhanced immunoturbidimetric assay on the DiaSys 

InnovaStar POC analyzer and evaluated the results of whole-blood and plasma pairs. 

These were correlated to CRP plasma values from an automated clinical Hitachi 917 

analyzer. The performance characteristics were evaluated according to the CLSI 

guidelines which included analytical sensitivity, linearity, precision and accuracy. 

Results: For whole blood and plasma pairs we acquired the following results for the 

CRP IS POCT: 

CRP IS showed a Limit of Blank (LoB) of 1.27 mg/L (CLSI EP17-A) and a Limit of 

Quantitation (LoQ) of 2.76 mg/L (CLSI EP17-A). The upper limit of linearity was 

400 mg/L (R 2 =0.99) (CLSI EP06-A). At a plasma concentration of 5 (30) mg/L we 

established for whole blood a CV of 3.7 (3.1) % for repeatability and between-run and 

between-day CVs of below 2 % (CLSI EP05-A2). No prozone effect was observed 

for CRP concentrations of up to 1800 mg/L. A preliminary method comparison using 

Passing-Bablok regression (n=47) with a competing CRP POCT resulted in a slope of 

1.0754 with an intercept of -2.24 (R 2 =0.98). 

Conclusions: Our results clearly demonstrated that the DiaSys InnovaStar CRP IS 

POC analyzer’s performance characteristics are comparable to a fully-automated 

clinical chemistry analyzer. The CRP IS is an easy-to-use POCT. Utilized in a pointof-care 

setting, the emergency room, in rural and remote areas or for serial monitoring 

of patients it provides a substantial benefit for treatment decisions. 

B-72 

Enzymatic assays on whole blood for lysosomal storage diseases using 

a digital microfluidic platform 

R. Sista 1 , T. Wang 1 , C. Graham 1 , N. Wu 1 , A. Eckhardt 1 , D. Millington 2 , D. 

Bali 2 , V. Pamula 1 . 1 Advanced Liquid Logic, Research Triangle Park, NC, 

2 

Duke University, Durham, NC 

Background: Lysosomal storage diseases (LSD) can benefit from early detection 

through newborn screening (NBS), and some states in the U.S. have started to screen 

newborns for LSDs. Current confirmatory diagnostic testing is performed using dried 

blood spots, skin fibroblasts or leukocytes prepared from whole blood. Performance 

of assays using leukocytes involves several manual steps, including centrifugation. 

We previously developed a fluorometric, multiplex enzymatic assay platform using 

digital microfluidic technology to rapidly perform assays for Pompe, Fabry, Hunter, 

Gaucher, and Hurler diseases using a single DBS punch. In this work, we present 

performance of these assays directly using whole blood, thus fully automating the 

assays. 

Methods: Whole blood samples were prepared in-house under cGMP conditions by 

mixing different ratios of leukocyte reduced blood, unprocessed cord blood and heatinactivated, 

charcoal-stripped serum. Quality control samples included base (BP), 

low (L), medium (M) and high pools (H) with 0%, 5%, 50%, and 100% leukocytes 

respectively. These activity levels span affected, carrier and normal enzyme activity 

ranges for acid-α-glucosidase (GAA; Pompe), α-galactosidase (GLA; Fabry), 

glucocerebrosidase (GBA; Gaucher) and α-iduronidase (IDU; Hurler). Thirty-two 

samples for each level were analyzed for the aforementioned enzymes on the digital 




microfluidic platform with an incubation time of 1 hour. Once samples were loaded 

onto a cartridge, all subsequent assay steps including mixing, incubation, reaction 

quenching, and detection were performed within the digital microfluidic cartridge. 

Results and Conclusion: Figure 1 illustrates the enzymatic activities for each level 

for GAA, GBA, GLA, and IDU. Enzymatic activities are reported in μmol/L/h; error 

bars represent standard deviation. 

There was good separation between each level for all enzymes. The ratio of 

enzymatic activity between different levels was in good agreement with the amount 

of leukocytes. These results demonstrate feasibility of determining enzymatic activity 

for LSDs using whole blood and the digital microfluidic platform. 

B-73 

Preclinical development of a disposable, instrument free device for 

measuring hematocrit 

S. P. Tyrrell, D. Kingston, B. Vant-Hull, S. Webb. IntraMed Diagnostics, 

LLC, Blue Earth, MN 

AnemiaCheck is a new disposable, instrument free device for measuring hematocrit 

(Packed Cell Volume) from capillary or venous blood. The hematocrit test result is 

easily determined by the user, and is similar to reading a thermometer. The device 

combines precise geometries and tight fluidic control to magnify the lateral separation 

of blood cells from plasma using traditional glass fiber filters. The WHO estimates 

that anemia affects 1.6 billion people worldwide. Early diagnosis and treatment of 

anemia holds the promise of preventing or reducing the incidence of a variety of 

serious medical complications. 

Methods: The shape of the indicator strip, comprised of a narrow central resolving 

region and wider ends provides for analytical resolution. The resolution is proportional 

to the ratio of the total area of the strip to the width of the indicator region. The 

analytical range is determined by the length and width of the resolving region and 

the relative areas of the two ends of the strip. The test strip also includes a dye at the 

distal end that changes color when saturated with blood plasma, thus indicating the 

test endpoint. The indicator strip is contained in a laminated assembly that precisely 

controls blood movement within the device. This assembly ensures that the test only 

begins when sufficient blood has been added and is insensitive to additional blood 

making sample volume control unnecessary. Test timing is not needed. Once the 

indicator strip is saturated by blood, approximately 15 minutes in the current design, 

further flow stops. This produces a stable endpoint permitting the test result to be read 

anytime thereafter. Manufacturing methods utilize automated, high throughput servo 

controlled converting presses enabling high precision with low manufacturing costs. 

Results: The current design shows an analytical range of 15% - 41% hematocrit 

(Hct.). A developmental assessment of accuracy, comparing the AnemiaCheck to 

spun hematocrit test results using 34 EDTA venous blood samples yielded a slope = 

0.97, y intercept = 0.62, R 2 = 0.96 and a 95% CI of (+/-) 4.2% Hct. This assessment 

used two devices per sample to estimate precision; the average %CV was 3.4%. 

Two samples, 18% Hct. and 35% Hct. were measured on 10 devices each to assess 

within-run precision, results were %CV = 4.1% and %CV = 2.1% respectively. A 

temperature study (range 10°C - 45°C) was performed to assess the impact of ambient 

temperature on results. Two Hct. levels, 18% and 35% were evaluated. Results were 

within (+/-) 3% Hct. between 18°C - 45° C with a clear bias towards under estimation 

at temperatures 15°C and below. 

Conclusions: The AnemiaCheck device only requires the user to place approximately 

two drops of blood in the area indicated; the remainder of the process is automatic and 

will be a valuable tool for detecting and monitoring anemia in the developing world, 

in low resource settings and for patient self-testing. 

B-74 

An Optimal Approach to Selecting the Appropriate Cutoff for Platelet 

Function Tests 

J. R. Dahlen 1 , S. S. Brar 2 . 1 Accumetrics, Inc., San Diego, CA, 2 Kaiser 

Permanente, Los Angeles, CA 

Background: Various platelet function tests (PFT) have been described for their 

ability to identify patients at increased risk for future cardiovascular events. The 

association between on-treatment platelet reactivity and incidence of cardiovascular 

events is largely attributed to the level of pharmacodynamic effect of the antiplatelet 

medication. The optimal cutoff for describing the prognostic utility of PFT has been 

frequently determined through ROC analysis and selection of the cutoff with the 

highest J statistic. This approach has resulted in variability in the reported “optimal” 

cutoff. The objective of this study was to evaluate the variability in “optimal” cutoff 

selection based on ROC curve analysis of a prognostic evaluation (Px) dataset 

compared to a diagnostic evaluation (Dx) dataset. 

Methods: A dataset comprised of naïve and on-treatment PRU measurements from 

147 subjects was used for the Dx dataset. ROC 

analysis was used to characterize the ability of the PRU result to distinguish ontreatment 

samples from naïve samples after pooling the naïve and on-treatment PRU 

results. A dataset comprised of on-treatment PRU measurements form 3059 subjects 

was used for the Px dataset. ROC analysis was used to characterize the ability of the 

PRU result to distinguish subjects that had a future cardiovascular event from those 

that remained event-free during long-term followup. The J statistic was determined 

for each cutoff according to the formula J = sensitivity+specificity-1, and the standard 

deviation (SD) of the J statistic was calculated for each cutoff. A 2xSD range was 

used to describe the bounds of the J statistic. Uncertainty in cutoff selection for each 

dataset was described by determining the range of PRU cutoffs where the upper bound 

of the J statistic was greater than the J statistic for the optimal cutoff. To neutralize 

the effect of differences in sample size and the associated differences in average SD, 

the uncertainty analyses was repeated using a fixed variability of 0.05 in the J statistic 

at the optimal cutoff, representing a 5% absolute difference in the combination of 

sensitivity and specificity. 

Results:The J statistic range for the Px dataset was 0-0.192, compared to a 0-0.769 

range for the Dx dataset. The range of PRU cutoffs with a J statistic upper bound 

greater than the “optimal” cutoff J statistic was 160-271 for the Px dataset compared 

to 182-266 for the Dx dataset. When imposing a fixed variability of 0.05 units to the 

J statistic, the range of PRU cutoffs with a J statistic upper bound greater than the 

“optimal” cutoff J statistic was 167-261 for the Px dataset compared to 196-260 for 

the Dx dataset. 

Conclusion: The use of datasets evaluating prognostic performance introduces 

greater uncertainty in optimal cutoff selection compared to datasets evaluating 

diagnostic performance. This uncertainty is largely attributed to differences in 

the range of the J statistic, which is typically much lower for datasets evaluating 

prognostic performance. Cutoff selection for PFT should be performed based on 

diagnostic performance for detecting the drug effect and the diagnostic cutoff should 

be validated on the basis of prognostic performance. 

B-75 

Neonatal Blood Measurement using the i-STAT Portable Clinical 

Analyzer 

S. Kittanakom 1 , N. Squires 2 , C. M. Balion 1 . 1 Department of Pathology and 

Molecular Medicine, McMaster University, Hamilton, ON, Canada, 2 St. 

Joseph’s Healthcare Hamilton, Hamilton, ON, Canada 

Background: Neonatal transport is responsible for the care and transport of critically 

ill infants. The need for blood gas analysis and electrolyte measurements by point 

of care testing is important for neonatal patients during transport. The objective of 

this study was to compare the analytical performance of the i-STAT CG4 and CG8 

cartridges to the GEM Premier 4000 blood gas analyzer using neonatal blood. 

Methods: Eighty neonatal blood samples were collected from patients in the 

neonatal intensive care unit. Two capillary samples (125 uL) were drawn to obtain 

sufficient sample to analyze on the i-STAT (Abbott Point of Care) and the GEM 4000 

(Instrument Laboratory). The CG4 cartridge measures pH, pCO2, pO2, lactate, and 

the CG8 cartridge measures pH, pCO2, pO2, Na, K, iCa, glucose, and hematocrit 

(Hct). To evaluate Hct, we obtained the results from EDTA blood that were analyzed 


A191



by the Beckman Coulter LH750 hematology analyzer. The total allowable error (TEa) 

was obtained from Ontario’s Quality Management Program-Laboratory Services 

(QMP-LS). Data were analyzed using the Method Validation software Analyze-it. 

Results: Comparative results between the i-STAT and GEM 4000 are summarized 

in the Table. Although the biases were small is most cases, the overall spread of data 

indicated by the 95% limits of agreement exceeded the performance goals for all tests 

(CG4 and CG8). 

Test n Range Bias, % 95% Limits of Agreement TEa Goal Met 

CG4 

pH 41 7.23 to 7.49 0.007* -0.06 to 0.0771 0.03* No 

pCO2 41 25.0 to 84.0 -0.30% -42.80 to 42.1 9 No 

pO2 42 28.0 to 88.0 -1.60% -32.00 to 28.9 15 No 

Lactate 40 0.6 to 2.60 1.30% -37.30 to 39.8 10 No 

CG8 

pH 39 7.22 to 7.47 0.0127* -0.03 to 0.0598 0.03* No 

pCO2 39 25.0 to 67.0 3.80% -9.50 to 17.1 9 No 

pO2 39 27.0 to 86.0 -2.20% -41.70 to 37.2 15 No 

Na 30 125.0 to 143.0 3.4* -1.00 to 7.8 4* No 

K 29 2.6 to 9.10 0.70% -26.10 to 27.5 6 No 

iCa 38 0.99 to 1.43 0.10% -10.50 to 4.5 7 No 

Glucose 39 1.9 to 7.5 0.01 -7.30 to 9.2 7.5 No 

Hct 39 0.224 to 0.683 1.20% -9.00 to 11.4 7* No 

* Absolute value 

Conclusions: The accuracy of the i-STAT CG4 and CG8 cartridges using neonatal 

blood was higher than our preset performance goals. Despite this limitation they were 

considered fit for purpose for the needs of neonatal transport. 

B-76 

First European Performance Evaluation of the VerifyNow II Syste 

T. Godschalk 1 , T. O. Bergmeijer 1 , J. R. Dahlen 2 , M. Kühbauch 2 , C. M. 

Hackeng 1 , J. M. ten Berg 1 . 1 St. Antonius Hospital, Nieuwegein, Netherlands, 

2 

Accumetrics, Inc., San Diego, CA 

Background: The VerifyNow System has been well-characterized for its ability to 

provide accurate and rapid information about the antiplatelet effect of aspirin and 

P2Y12 inhibitors such as clopidogrel, prasugrel and ticagrelor. The results from the 

VerifyNow Aspirin Test and VerifyNow P2Y12 Test have been clinically validated to 

identify patients at increased risk for thrombosis and bleeding on the basis of their 

platelet reactivity. The VerifyNow II System is a next-generation test system that uses 

the same reagents as the VerifyNow System, but incorporates several new features to 

improve the user experience, including the ability to use various commonly-used blood 

collection tubes and a reduced sample wait time prior to performing measurements of 

response to aspirin therapy. The objectives for this study were 1) to show equivalence 

between the VerifyNow II System results and the VerifyNow System results, 2) to 

demonstrate the suitability of alternative blood collection tubes, and 3) to evaluate the 

blood sample wait time prior to performing the VerifyNow II Aspirin Test. 

Methods: A total of 23 subjects receiving treatment with a P2Y12 inhibitor and 

aspirin were enrolled. All testing was performed according to the manufacturer’s 

instructions. Results obtained from the VerifyNow II Aspirin and P2Y12 Tests were 

compared to results from the same samples tested with the VerifyNow Aspirin and 

P2Y12 Tests. Evaluation of alternative blood collection tubes was performed using 

the VerifyNow System-recommended Greiner Bio-One partial fill Vacuette tube 

compared to the standard BD Vacutainer blood collection tube with 1.8 cc and 4.5 cc 

fill volume. All blood collection tubes contained 3.2% sodium citrate. The sample wait 

time prior to VerifyNow II Aspirin testing was evaluated by comparing VerifyNow II 

Aspirin measurements performed after a 30 minute waiting period (as required with 

the VerifyNow Aspirin Test) to measurements performed after a 10-15 minute waiting 

period. Data were analyzed using linear regression and Lin’s concordance correlation 

coefficient. 

Results: PRU, % inhibition, and ARU results obtained with the VerifyNow II System 

were equivalent to the VerifyNow P2Y12 System, with Lin’s concordance correlation 

coefficients of 0.98, 0.96, and 0.96, respectively. VerifyNow II System PRU, % 

inhibition, and ARU results obtained with standard blood collection tubes were 

equivalent to partial-fill blood collection tubes, with Lin’s concordance correlation 

coefficients of 0.97, 0.94, and 0.98, respectively. There was no difference between 

1.8 cc and 4.5 cc fill volumes for the standard blood collection tubes. VerifyNow II 

Aspirin results obtained after a 10-15 minute sample wait time were equivalent to 

results obtained after a 30 minute wait time (Lin’s r = 0.95). 

Conclusion: The results of this investigation confirm that the VerifyNow II System 

produces results that are equivalent to the original VerifyNow System, with the added 

benefits of allowing use of standard blood collection tubes and a reduced sample wait 

time prior to VerifyNow II Aspirin testing. 

B-77 

Comparison of whole blood and serum creatinine and estimated 

glomerular filtration rate for screening of at-risk patients prior to 

radiographic procedures 

C. Botz, L. Sorenson, B. Karon. Mayo Clinic - Rochester, Rochester, MN 

Background: To prevent contrast-induced renal damage, serum or whole blood 

creatinine and estimated glomerular filtration rate (eGFR) are commonly measured 

prior to contrast enhanced radiologic examinations. In this study we measured 

correlation in creatinine values and concordance in eGFR between two whole blood 

creatinine methods and a serum enzymatic creatinine assay, used as the reference 

method. 

Methods: In our practice both iSTAT1 (Abbott Point of Care, Princeton NJ) and 

Radiometer 827 (Radiometer, Bronshoj Denmark) whole blood creatinine methods 

are used to screen at-risk patients for renal disease prior to radiological examinations. 

We retrospectively obtained all iSTAT1 and Radiometer 827 whole blood creatinine 

results performed on the same day of service as a serum creatinine for the period 

January 1- December 31, 2011. All serum creatinine measurements were performed 

with the Roche enzymatic creatinine assay on a Roche Cobas C-501analyzer (Roche 

Diagnostics, Indianapolis IN). Creatinine value, patient age and gender were utilized 

to calculate eGFR via the Modification of Diet in Renal Disease (MDRD) formula. 

Whole blood creatinine/eGFR was compared to reference serum values by mean 

(SD) bias, percent of whole blood creatinine values within 0.2 mg/dL of serum value, 

and concordance of eGFR around cut-offs of < 60 and < 30 mL/min/1.73m 2 used for 

radiology screening. 

Results: Mean bias (SD) between Radiometer whole blood and Roche enzymatic 

serum creatinine was of -0.06 ± 0.13 mg/dL among the 3244 patients (1400 female, 

1844 male) with values on the same day of service. Mean (SD) bias between iSTAT 

whole blood and Roche enzymatic creatinine was 0.03 ± 0.13 mg/dL for the 2042 

patients (1013 female, 1028 male) with same day measurement. 3039 of 3244 (94%) 

Radiometer whole blood creatinine values were within 0.2 mg/dL of the serum 

enzymatic value; while 96% (1960/2042) of iSTAT creatinine values were within 0.2 

mg/dL of serum values. Sensitivity of the Radiometer for detection of serum eGFR 

< 30 mL/min/1.73 m 2 was 90% (26/29); while the iSTAT detected 86% (12/14) of 

patients with serum eGFR < 30 mL/min/1.73 m 2 . The sensitivity of Radiometer eGFR 

for detection of serum eGFR < 60 mL/min/1.73m 2 was 74% (520/703). The specificity 

of Radiometer eGFR for prediction of serum enzymatic eGFR ≥ 60 ml/min/1.73m 2 

was 99% (2517/2541). Overall concordance of Radiometer to serum eGFR around 

a cut-off of 60 mL/min/1.73m 2 was 94% (3037/3244). Both the sensitivity and 

specificity of the iSTAT for prediction of serum eGFR < 60 and ≥ 60 were 93%. 

Overall concordance of iSTAT whole blood eGFR classification around a cut-off of 

60 mL/min/1.73m 2 was 94% (1915/2042). 

Conclusion: Both Radiometer and iSTAT whole blood creatinine methods correlate 

well with Roche serum enzymatic creatinine. Concordance of whole blood to serum 

eGFR is good (94%) with both methods when the common screening cut-off of 60 mL/ 

min/1.73m 2 is used. The iSTAT demonstrated better sensitivity, and the Radiometer 

better specificity, for prediction of abnormal Roche serum eGFR. 

B-78 

Optical Slide for Metabolic Snapshot using a Drop of blood at the 

Point-of-Care 

P. Ahuja 1 , M. Peshkova 2 , M. Gratzl 1 . 1 Case Western Reserve University, 

Cleveland, OH, 2 St. Petersburg State University, St. Petersburg, Russian 

Federation 

Background: The metabolic status of critically ill patients in the intensive care unit 

(ICU) is of critical importance and requires frequent monitoring. Tests done outside 

of the ICU with slow turnaround may cause undesirable patient outcomes. Numerous 

disposable test strips required for patient care increase already high costs of care in 

the ICU. We have developed a low-cost, reusable optical slide to provide a metabolic 

snapshot of multiple parameters at the point-of-care from a single drop of blood. The 

slide incorporates optode-based sensing zones that change color according to the 

concentrations of the respective analytes. Results can be read by the naked eye, or 

digitally with an inexpensive reader. 

Methods: pH sensors: pH-sensitive optode membranes were prepared by mixing 

PVC:DOS (mass ratio 1:2) and adding 25mmol chromoionophore (L), 100 mmol 

sodium ionophore (NaIV), and 27.5 mmol HFPB, and finally dissolving them in 

THF. 0.3μL of this solution was cast into designated sensing wells. Glucose sensors: 




0.3μL pH-sensitive membranes were cast into designated sensing wells. To introduce 

glucose oxidase, GOX, to the sensing layer, GOX was immobilized above the pH 

optodes. Reference spots: Reference wells were filled with Titanium dioxide: PVC 

films to provide a uniform white color. Protective membrane and sample holder: 

HEMA membranes, 7 μm thick, were polymerized using UV exposure and placed 

on the substrate, covering the sensing wells. PMMA slabs with holes were placed on 

top, attached to the substrate. pH and glucose calibrations: sensors were exposed to 

solutions of various pH and glucose concentration to determine the color response 

and response time of the slide. Sodium interference studies: pH-sensitive optodes 

were tested to determine pH response with different sodium concentrations in PBS. 

Image acquisition and analysis: Images of the slide were acquired using a low-cost 

monochrome camera with Red, Green, and Blue LED light sources. ImageJ software 

was used to measure RGB spectral components of the individual sensing and reference 

wells. Each sensing capsule was then normalized to the reference capsule, followed by 

Pythagorean normalization. 

Results: Red and blue intensity color response of pH sensing wells in PBS, serum, 

and blood, with resolution of 0.08 pH units were achieved. Response times for pH 

changes ranged from 4 to 12 minutes, varying with the different pH change measured. 

Reversibility of sensors to pH changes showed minimal hysteresis. Glucose response 

in PBS and blood was shown to be linear between 0 – 200 mg/dl using two sensing 

wells with different chromoionophore:NaIV ratios of the pH-sensitive optode layer. 

Examining ratios of Red/Blue intensities increased the dynamic range. Sodium 

interference studies showed that there is minimal sodium interference of pH-sensitive 

optode in the pH range of 5.5-8.0. 

Conclusion: Utilizing a single reusable slide for multiple screenings for the same 

patient makes the device more cost-effective than commercial devices, and improves 

compliance for disease management. The device is ideally suited for both developed 

and developing economies. In a pilot clinical trial in the ICU, the performance of 

the proposed tester compared favorably with parallel results obtained in the central 

clinical lab. 

B-79 

A SPE-HPLC-MS/MS Method for Measuring Steroids in Human 

Plasma 

X. Zang, I. Gavin, A. Oroskar, A. Oroskar. Orochem Technologies Inc., 

Lombard, IL 

Background: Steroid hormones are produced by human body, and they play key 

roles in the development of reproductive tissues (like testosterone, progesterone, 

and estradiol), or in the regulation of ions /water absorption (aldosterone). Plasma 

or serum levels of these steroids are measured in the clinical laboratory to detect 

disorders associated with steroid hormone imbalance. 

Steroids are used as drugs to cure certain disorders, and they are also used by some 

athletes as performance enhancement drugs, such as prednisolone and testosterone. 

Regular testing of these types of steroids is also required in the clinical laboratory. 

HPLC-MS/MS is replacing immunoassays for detecting steroids in patient samples. 

It requires a selective sample preparation method. In this study, we developed a solid 

phase extraction (SPE)-HPLC-MS/MS method for detecting six steroids (Aldosterone, 

Prednisolone, Corticosterone, Progesterone, Testosterone, and Estradiol) in human 

plasma. 

Methods: We chose six steroids with different polarity range to develop a selective 

and sensitive assay. We tested several different extraction methods. 

Initially we used liquid-liquid extraction (LLE) method with hexane or 

dichloromethane as extraction solvents. One hundred microliters of plasma samples 

were extracted with 300 μL of organic solvents, after vortexing and centrifuging, the 

organic solvent layer was extracted and evaporated. 

We also tested SPE methods with two different types of polymer SPE cartridges, 

different types of wash solvents and elute solvents. The goal of our test is to find a 

relative easy procedure with high recovery and precision. 100 μL of plasma samples 

were used for SPE. Samples were loaded directly to SPE cartridges (Celerity Deluxe 

or Sagacity HL ), and washed with 10-30% acetonitrile. Analytes were eluted from 

cartridges either by acetonitrile, methanol, hexane, or dichloromethane. 

We developed a HPLC-MS/MS method to separate and detect six steroids in plasma 

extract. Extracted sample was separated by Reliasil C18 HPLC column, with gradient 

mobile phase starting from 25% to 75% acetonitrile in 0.1% formic acid. Total run 

time was 8 minutes. Analytes were detected by multiple reaction monitoring using 

API3000 mass spectrometer equipped with the Turbo Ionspary ion source. Every 

analyte was detected with both quantifier ions and qualifier ions. 

Results: Currently, many labs use LLE method (either using hexane or dichloromethane 

) to extract steroids. We compared our SPE method with LLE method. SPE method 

gave better recovery. 

In LLE experiments, hexane extract gave less matrix effect than dichloromethane, 

however, dichloromethane extract gave better recovery, recoveries of all six steroids 

were in the range of 56-81%. 

Between two types of SPE cartridges, Celerity Deluxe SPE cartridges gave better 

recovery. Aldosterone couldn’t retain on the cartridge with 30% acetonitrile as 

wash solvent. So, we chose 20% ACN as wash solvent. Regarding elute solvents, 

acetonitrile gave the best overall recovery. Using Celerity Deluxe SPE cartridges, 

recoveries for five steroids (excluding aldosterone) were in the range of 99% to 106%, 

with the precision range from 7-9%. Recovery for aldosterone is 87% with 17% 

variation (without internal standard). 

Conclusion: We developed a SPE-HPLC-MS/MS to analyze six steroids in human 

plasma, which gave better recovery and precision than traditionally used LLE method. 

B-80 

The Real World Relationship Between VerifyNow PRU and Device- 

Reported Percent Inhibition: Analysis from the GRAVITAS Trial 

J. R. Dahlen 1 , M. J. Price 2 . 1 Accumetrics, Inc., San Diego, CA, 2 Scripps 

Clinic, San Diego, CA 

Background: The VerifyNow P2Y12 Test is a rapid, point-of-care platelet function 

test that has been extensively validated as a tool for measuring the antiplatelet effect 

of P2Y12 receptor inhibitors. The VN P2Y12 Test reports results as P2Y12 Reaction 

Units (PRU) and device-reported percent inhibition of platelet reactivity (%I), 

based on using thrombin receptor-induced platelet aggregation as a substitute for a 

baseline, P2Y12 inhibitor naïve PRU result. The PRU result is highly specific for 

P2Y12 receptor blockade due to the effect of a P2Y12 inhibitor and is an absolute 

measure of the drug effect. The %I result is a relative measure of the drug effect 

because the absolute effect is normalized using baseline, thrombin-receptor induced 

platelet aggregation. PRU results have been clinically validated to identify patients at 

increased risk for thrombosis and bleeding due to the presence of a P2Y12 inhibitor 

antiplatelet effect. %I results have been clinically validated to correlate to a return 

to baseline platelet function following P2Y12 inhibitor cessation. The relationship 

between these two results has not been extensively described. The objectives for this 

study were to 1) compare the actual relationship of PRU and %I results to a model 

based on true baseline platelet reactivity and 2) determine the agreement of PRU and 

&I results at published clinical decision points. 

Methods: Matched PRU and %I results were evaluated using measurements obtained 

from the GRAVITAS trial. A total of 10,375 VerifyNow P2Y12 Test measurements 

from 5,429 subjects were used for the analysis. The manufacturer-reported 95% 

confidence interval PRU reference range of baseline platelet reactivity (194-418) 

represents the range of PRU results when the “true” %I is 0%. A PRU result of 0 is the 

expected result when “true” %I is 100%. Taken together, a model for the relationship 

of PRU and %I was constructed using an inferred range of PRU results at each level 

of “true” %I. Because the reference range is the 95% confidence interval of baseline 

PRU results, the model is therefore a prediction of the relationship between PRU and 

%I for at least 95% of the observations. The percent of actual measurements that were 

in agreement with the model was determined, and the agreement of results using PRU 

< 208 and %I > 20% cutoffs also was determined. 

Results: 96.8% of the matched PRU and %I results were within the theoretical model, 

which was within the expected >95% of results. The PRU > 208 cutoff reported 

to define high on-treatment platelet reactivity was 95% specific for the %I < 20% 

reported to define a baseline platelet function. 

Conclusion: The results of this investigation confirm there the PRU and devicereported 

%I results from the VerifyNow P2Y12 Test are highly correlated and are 

consistent with a prediction model of their relationship. These observations suggest 

that device-reported %I is an acceptable surrogate for true percent inhibition calculated 

from a pre-drug and on treatment PRU result. In addition, the results indicate that 

there is consistency between the clinically validated PRU and device-reported %I 

decision points. 


A193



B-81 

An Implementation of the Quality Control Assessment Program of 

Point of Care Glucose Testing at Primary Care Units by Using Whole 

Blood Control Samples 

W. Treebuphachatsakul 1 , W. Theansun 2 , R. Maneemaroj 2 . 1 Point of Care 

Testing Unit for Training, Research, and Technology Development, Faculty 

of Allied Health Sciences, Naresuan University, Phitsanulok, Thailand, 

Phitsanulok, Thailand, 2 Department of Medical Technology, Faculty of 

Allied Health Sciences, Naresuan University, Phitsanulok, Thailand, 

Phitsanulok, Thailand 

Background: Point of care (POC) glucose testing was used the most at primary care 

unit (PCU) in Thailand. However, the policy of quality control (QC) for point of care 

testing (POCT) in Thailand has not been unclear. This study was first to introduce the 

Quality Assessment Program (QAP) for POC glucose testing at PCU by using whole 

blood samples as control samples. 

Methods: QC whole blood samples was treated with glyceraldehydes and prepared 

for low, medium, and high glucose concentrations at Point of Care Testing Unit for 

Training, Research, Technology Development, Faculty of Allied Health Sciences, 

Naresuan University, Thailand. All samples were aliquot 0.5 mL into microtubes and 

kept in refrigerator until used. All QC whole blood samples were sent out to our health 

care members including District Health Promoting Hospitals and primary care units. 

The QC samples were tested for blood glucose within 12 hours after preparations. All 

participants performed QC once per month from August to October. The statistical 

standard deviation index (SDI) of blood glucose was calculated. Mean of glucose of 

each participant was compared to mean of group by using t-test. Data of POC glucose, 

glucose meter, and QC were survey at beginning. Satisfaction of QAP was evaluated 

at the end of the program. 

Results: All participants used the same brand of glucose meters (n=33) in the QAP 

and blood glucose was performed approximately 120 tests per day. Assessed time 

to test blood glucose was 4 ± 1.5 hours and there was no significantly different 

among participants (P>0.05). SDI of blood glucose testing was ranged from 0 to 2.5. 

There were three meters (10.3%) those SDIs were exceeded 2.0 at the first month, 

but decreased to less than 2.0 at the second and third months. All participants were 

satisfied of QAP with satisfaction score equal to 5.0. 

Conclusions: This is the first study of the QAP for POC glucose testing at primary 

care settings in Thailand by using whole blood samples. This study provides an 

evidence for continuous improvement of quality of blood glucose testing at PCUs 

and also can motivate the users to consider and avoid quality of their glucose meters. 

B-82 

Rapid Blood Gas Testing Decreases Ventilator Time of the Post Isolated 

Coronary Artery Bypass Patient 

L. Vitry, S. Clark, M. Hammel. Centura Health, Denver, CO 

Background: Fast, accurate blood gas testing is a critical component to managing the 

post Isolated Coronary Artery Bypass (iso-CAB) patient in the Intensive Care Unit/ 

Coronary Care Unit (ICU/CCU). These patients come to the ICU/CCU on a ventilator. 

Evidence Based Medicine supports weaning these patients as soon as possible, after 

admission to ICU/CCU. The national goal, per the Society of Thoracic Surgeons 

(STS), is to wean these patients from the ventilator in less than six hours. 

Methods: This study will compare 2 different blood gas testing methods used to 

manage the post iso- CAB patient and post iso-CAB patient ventilator time in the ICU. 

Results: ICU was sending blood gas samples on post iso-CAB patients to the main 

laboratory for analysis. Average turnaround time (TAT) for this analysis was 30 

minutes. Average ventilator time was 12.1 hours. After the installation of rapid blood 

gas testing in the ICU, the average blood gas TAT was 2 minutes, and the average 

ventilator time was 8.8 hours. 

Conclusion: Having blood gas test results faster accelerated the patients’ treatment 

and weaning process. This leads to decreased time on a ventilator, decreased length 

of stay, decreases risk factors of adverse outcomes as a result of prolonged ventilator 

time, such as ventilator acquired pneumonia and a decrease the overall cost of treating 

the iso-CAB patient. 

B-83 

Evaluation of the Bayer Ketostix® for Detection of Ketone Bodies in 

Blood 

M. Bagheri, K. Kelly, A. Butch, L. Song. UCLA, Los Angeles, CA 

Background: The blood ketone test is used as an adjunct for the diagnosis of 

ketoacidosis. The Bayer Acetest® is an approved test for measuring ketones in serum/ 

plasma and has recently been commercially unavailable. The Ketostix® reagent strip 

(Bayer) is approved only for detection of ketones in urine. In this study we evaluated 

the performance of the Ketostix reagent strip for detecting serum ketones. 

Methods: Serum pools negative for ketones were spiked with either lithium 

acetoacetate or acetone to obtain samples containing 5 - 100 mg/dL of acetoacetic acid 

or samples containing 5 - 30 mg/dL of acetone, respectively. The serum samples were 

tested in triplicate by the Acetest and Ketostix tests to determine accuracy. Sensitivity 

was determined by analysis of samples containing 0 and 5 mg/dL of acetoacetic acid 

20 times each. Forty three serum samples were tested for ketones using Ketostix strips 

and the results were compared with those obtained by the Acetest. 

Results: Both the Ketostix and Acetest correctly classified samples spiked with 

varying concentrations of acetoacetic acid. Both tests also produced negative and 

trace ketone results (20 times) for samples spiked with 0 and 5 mg/dL of acetoacetic 

acid, respectively. Therefore, the sensitivity for Ketostix to detect acetoacetic acid in 

serum is 5 mg/dL. The Acetest correctly detected trace amounts of acetone whereas, 

as expected, the Ketostix test failed to detect acetone. Agreement between tests for the 

43 serum samples is shown below. 

Conclusion: Ketostix has similar sensitivity to Acetest for detecting acetoacetic acid. 

Ketostix does not detect acetone, however, acetone only accounts for 2% of the serum 

ketones. There was 88% concordance between the two test methods and discordant 

results differed by only 1 grade. These data indicate that the Ketostix reagent strips 

can be used as a replacement for the Acetest for detecting serum ketones. 

Comparison of Serum Ketone Results by Ketostix and Acetest 

Ketostix 

Acetest 

Negative 

Trace Small Moderate Large 

(5 mg/dL) (15 mg/dL) (30-40 mg/dL) (>80 mg/dL) 

Negative( 24 0 0 0 0 

Trace(10 mg/dL) 0 3 2 0 0 

Small (15 mg/dL) 0 2 7 0 0 

Moderate(40 mg/dL) 0 0 0 4 1 

Large (>80 mg/dL) 0 0 0 0 0 

B-84 

Performance Characteristics of Cardiac Biomarkers on the Samsung 

LABGEOIB10 Immunoassay Analyzer for use in Point of Care (POC) 

and Near Patient Settings* 

E. Shin 1 , C. Jin 1 , C. Ku 1 , A. Ramos-Chavez 1 , S. Patel 1 , B. I. Bluestein 1 , A. 

Belenky 1 , D. Park 2 , C. Kim 2 , B. Lee 2 , J. Kim 2 , Y. Lee 2 . 1 Nexus-DX, San 

Diego, CA, 2 Samsung Electronics Co., Ltd, Suwon, Korea, Republic of 

Background: Multiple studies have shown that POC systems reduce turnaround time 

(TAT) due to elimination of preanalytical issues such as sample transport, specimen 

centrifugation and secondary laboratory processing. The Samsung LABGEO IB10 

Analyzer is a portable, light weight (2.4 kg) immunochemistry system capable of 

quantitatively measuring up to 3 biomarkers simultaneously on a single whole blood 

aliquot in approximately 20 minutes. Test devices are similar in configuration to a 

compact disc. 

Principle and Methods: Discs are configured to combine solid phase sandwich 

immunochemistry with microfluidics and centrifugal flow to prepare plasma from 

whole blood that can then be moved through channel(s) to rehydrate, solubilize and 

mix with lyophilized reagents. Using a combination of active flow and capillary 

action, specific single or multiple analytes are quantitatively measured. Results are 

reported in print and by electronic transmission. 

Results: Analyte discs have been developed and validated for cardiac Troponin I, 

alone and in combination with CK-MB, and myoglobin . NT-proBNP and D-dimer 

are also available individually or as a panel with TnI. Measurements of these analytes 

are well accepted for the rapid evaluation of patients with symptoms of acute coronary 

syndrome (ACS) and/or congestive heart failure (CHF). Test methods were evaluated 

according to CLSI protocols for sensitivity, endogenous/exogenous interferences, 

precision and accuracy compared to 510(k) cleared predicate devices. The VITROS ® 




immunodiagnostic products were used for comparison of all analytes except D-dimer 

which was measured on the Cobas Integra ® . Performance characteristics for each 

analyte are shown in the table below. 

Conclusion: The Samsung LABGEO IB10 Analyzer is a POC instrument suitable for 

use in hospital and alternate care settings such as emergency departments, critical 

care units, and other sites where near patient testing is practiced and rapid answers are 

required in order to make informed decisions. *U.S. Export Only 

Analyte Range -units Ref cut off Slope ρ %CV Total 

cTnI 

CKMB 

MYO 

NT- proBNP 

D-dimer 

B-85 

0.05-30 ng/mL 

2.0-60 ng/mL 

30-500 ng/mL 

30-5000 pg/mL 

100-4000 

FEU ng/mL 

0.10 ng/mL 

99% ile 

8.6 ng/mL 

95% ile 

99.8 ng/mL 

95%ile 

125pg/mL 75 y.o. 

0.80 0.92 10-14 

1.29 0.88 10-15 

1.0 0.90 12-13 

0.91 0.96 9-14 

447 FEU ng/mL 95%ile 1.21 0.87 6-9 

Audit of Quality Error Rates in Blood Gas Analysis in the Central 

Laboratory and Point of Care Setting 

M. Chong, L. Ong, S. Saw, S. Sethi. National University Health System, 

Singapore, Singapore 

Background: Arterial blood gas (ABG) analysis is thought to be more vulnerable to 

pre-analytical errors, especially in the point of care (POC) setting. We evaluated the 

number of pre-analytical errors reported in POC versus central lab ABG analysis, and 

identify common areas for future quality improvement. Such information is helpful 

in risk-benefit analysis especially in the area of training and education of POCT users 

and clinicians requesting for ABG testing. 

Methods: We collated information for all ABG analyses done in our hospital 

in 2012, including all requesting locations and quality errors. ABG errors in the 

central laboratory were tracked using lab comment codes entered into the laboratory 

information system (LIS) by the laboratory staff, while POC ABG errors flagged in 

the POC middleware were keyed in by laboratory POC staff into the LIS. 

Results: POC ABG testing made up of 87.4% of the 69775 total ABG requests. Of 

this, the error rate was 0.13%, compared to 4.98% at the central laboratory. Majority 

of the POC ABG pre-analytical errors were associated with patient identification 

errors (86% of POC ABG errors; 0.11% of all POC ABG requests) whereas errors in 

the central laboratory stemmed from specimen quality issues such as clotted samples 

(78% of all central laboratory ABG errors; 3.87% of all central lab requests). This 

variability in error types between POC and lab blood gas may due to underreporting 

of errors such as clotted or insufficient samples at the POC site, as these were usually 

repeated immediately and might not be highlighted to the laboratory POC staff. 

Conclusions: The central lab ABG testing error rate is unacceptably high and suggests 

need for further training and education of ABG testing personnel in proper specimen 

requisition and handling prior to transportation to the laboratory. 

B-86 

Assessment of pH in Pleural Fluid on Siemens RAPIDPoint Systems to 

Aid Clinicians in Diagnosis of Common Diseases 

B. M. Carney, K. LaRock, D. Tagliaferro. Siemens Healthcare Diagnostics, 

Norwood, MA 

Introduction: Pleural fluid is found in the pleura, the double-layered serous 

membrane that surrounds the lungs. Pleural fluid enables the walls between the lungs 

and the chest to mechanically couple while preventing friction when the lung and 

chest walls slide with respect to each other. Common diseases including heart failure, 

pneumonia, esophageal rupture, tuberculosis, rheumatoid disease, and malignant 

cancers can cause excess fluid to develop in the walls surrounding the lungs. It is 

estimated that 1 million pleural effusions are diagnosed in the United States each 

year¹ to diagnose common diseases and conditions such as heart failure, pneumonia, 

esophageal rupture, tuberculosis, rheumatoid disease, and malignant cancers 1 . Point 

of care testing provides an accurate pleural fluid pH measurement. The RAPIDPoint® 

Series blood gas systems provide a method for the measurement of pleural fluid pH in 

a maintenance-free cartridge 2 . An internal validation of pleural fluid pH measurement 

is presented on the Siemens RAPIDPoint®400, 405, and 500 blood gas analyzers. 

Method: The test method was adopted from CLSI guideline Evaluation of Precision 

Performance of Quantitative Measurement Methods (CLSI EP05-A2). A total of 80 

prepared pleural fluid samples at three levels of diagnostic interest (7.0 - 7.5 pH Units) 

were analyzed in a precision study on each Siemens RAPIDPoint® model. 

Results: Precision analysis was performed for pleural fluid samples prepared at three 

clinically relevant pH levels. Mean pH (Units) within-laboratory standard deviation 

and repeatability were calculated for each level, as illustrated in Table 1. 

Conclusions: 

The RAPIDPoint® point of care instruments meet the pooled Total SD (Within Lab) 

and pooled Within Run SD (Repeatability) acceptance criteria for pleural fluid pH 

analysis. 

Table 1. pH Precision Results of Prepared Pleural Fluid Samples. 

RAPIDPoint 

Level Mean n Within Laboratory (pH Units) Repeatability (pH Units) 

System (pH Units) 

Low 7.102 80 0.011 0.010 

400 Mid 7.286 80 0.011 0.010 

High 7.471 80 0.008 0.007 

Low 7.102 80 0.011 0.009 

405 Mid 7.286 80 0.012 0.012 

High 7.471 80 0.007 0.007 

Low 7.102 80 0.016 0.006 

500 Mid 7.286 80 0.018 0.011 

High 7.471 80 0.019 0.011 

Footnotes 

1 

‘Pleural Effusion’, by J. Rubins, MD, eMedicine, Feb. 15, 2007 

2 

Pleural Fluid analysis is pending FDA approval for clearance in the United States. 

B-87 

Concordance between successive Troponin I by point of care and 

TroponinT by central laboratory in patients presenting to Emergency 

Department. 

I. A. Hashim, W. Wells, D. Pillow, J. A. de Lemos. University of Texas 

Southwestern Medical Center, Dallas, TX 

Introduction: Bedside measurement of Troponin level is becoming widely adopted. 

Because only Troponin I is currently available as point of care use in the United 

States, institutions using Troponin T assays in their central laboratory typically 

perform Troponin I by point of care testing in the emergency room and subsequent 

measurements are usually performed in the laboratory using Troponin T. In this study 

we reviewed consecutive Troponin I and T measurements on patients presenting to 

our Emergency Department. 

Methods: Troponin I level obtained by point of care testing (POCT) (iSTAT analyzer, 

Abbott Diagnostics, USA) and Troponin T level by laboratory-based instrumentation 

(Cobas, Roche Diagnostics, USA) were measured at the time of presentation in 

consecutive patients evaluated for chest pain over a one month period. A positive test 

for Troponin I was >0.1 ng/mL and for Troponin T was >0.01 ng/mL (99 th percentile 

values). Concordance for both troponin levels was determined. 

Results: A total of 105 patients presented to the emergency department during the 

study period. Troponin I values ranged from below detection



to 3.40 ng/ml (median 0.08) for Troponin T. Troponin I was negative in 86 patients 

(81.9 %), whereas Troponin T was negative in 79 patients (75.2%). Concordance for 

negative troponin results was 68.6 % whereas concordance for positive tests was only 

10.5 %. Percentage of positive Troponin I with a negative Troponin T was 6.7%, 

compared with 13.3 % for those with negative Troponin I and a positive Troponin 

T results. 

Conclusion: Concordance between Troponin I by POCT and Troponin T by 

laboratory-based methodology was only moderate. False negative and false positive 

results were seen. This may results in patients being erroneously admitted or more 

seriously discharged. POCT Troponin I may identify individuals for additional 

investigation, but reliance on a single value for rule out may result in false negative 

evaluations for MI and inappropriate discharge. A specific rule out protocol is required 

when using POCT. 

B-88 

A novel electrochemical immunoassay point of care system 

R. A. Porter, E. Hutchinson, M. Chard, W. Paul. AgPlus Diagnostics, 

Sharnbrook, United Kingdom 

Background: ELISA and Clinical Lab Analyzers are routinely used for immunoassays 

where robust, reliable results are required for clinical decisions to be made. However, 

with the changing landscape in healthcare provision, the need for a more mobile, 

rapid and responsive diagnostic tool that can be used in a range of environments has 

become much greater. 

Objective: The aim of AgPlus Diagnostics research is to develop a diagnostic 

platform that would meet all the needs of the Point of Care (PoC) diagnostics market 

for a rapid, portable system, giving results comparable to the gold-standards of central 

laboratory analysers, to ensure it can deliver a measurable benefit to users where 

clinical confidence in the diagnostic result is required. 

AgPlus with the National Physical Laboratory have developed an electrochemical 

metalloimmunoassay based on silver nanoparticles, in a disposable microfluidic 

device, with a portable reader to deliver clinical results in 10 minutes or less. 

Assay methodology: The system employs silver nanoparticles as an electrochemical 

label and magnetic particles as the solid phase. The assay is run on a fluidic device, 

which contains all required reagents dried on the chip and solutions in to fluid filled 

blisters, which are deployed by an actuator. This means the assay can be carried out in 

a single step format controlled by the reading device. 

For the prototype system, TroponinI was developed. Once a sample has been added to 

the microfluidic chip, the sample incubates in the measurement chamber and is mixed 

with the antibody-coated particles. If the analyte is present a complex is formed with 

the magnetic and silver particles. After incubation, magnets are activated, which holds 

the silver-magnetic complexes down in the measurement zone so the wash solution 

can clear away any unwanted materials. Once this occurs, the reading solution of 

ammonium thiocyanate is released and cleaves the silver nanoparticles from the 

complex and forms a negatively charged monolayer around the silver nanoparticle, 

which can be drawn down to the sensor under a positive potential. The nanoparticle are 

electrochemically converted to electro-active metal ions, for each 40nM nanoparticle 

it can be converted to 1x10 12 ions thus allowing for signal amplification. The amount 

of silver particles is directly proportional to the amount of analyte in the sample. 

Results: The system is showing results in un-optimised assay formats with TnI having 

a current dynamic range of 1pg/ml-50pg/ml with CV

Infectious Disease 


B-89 




Identification of Models to Predict Sepsis in Emergency Department 

Patients 

F. Cate, J. Colón-Franco, S. Litt, T. Rice, A. Wheeler, D. Plummer, W. 

Dupont, A. Woodworth. Vanderbilt Univeristy Medical Center, Nashville, 

TN 

Background: Initiation of early, goal directed therapy reduces sepsis related 

mortality. No single predictor accurately identifies sepsis in emergency department 

(ED) patients. 

Objective: To identify sepsis prediction models for ED patients with systemic 

inflammatory response syndrome (SIRS) and/or other sepsis risk factors. 

Methods: This retrospective cohort study utilized 128 ED patients with SIRS 

and/or another sepsis risk factor (hypotension (SBP



B-94 

Development and Validation of a Novel IFN-gamma ELISPOT Assay 

for Sensitive and Specific Detection of Antigen-Specific T Cell Response 

to Borrelia burgdorferi 

C. Jin 1 , D. Roen 1 , M. Kellermann 1 , G. Kellermann 2 . 1 Pharmasan Labs, Inc., 

Osceola, WI, 2 NeuroScience, Osceola, WI 

Background: Lyme disease, caused by infection of Borrelia burgdorferi, is an 

emerging infectious disease in the United States. However, the limitation of the 

conventional antibody-based immunoassays is that they have low sensitivity and 

specificity, causing significant false negative and false positive results. In contrast, 

Borrelia-specific T cell-based immune assays have not yet been well developed. 

The enzyme-linked immunospot (ELISPOT) technology has proven to be extremely 

sensitive in detecting low frequency of antigen specific reactive T cells and has been 

approved by FDA for use in the diagnosis of tuberculosis. 

Objective: The aim of this study is to develop and validate a novel T cell-based assay 

for diagnosis of Lyme disease using an ELISPOT technology. 

Methods: To develop the novel T cell-based diagnostic assay for Lyme disease, we 

detected the Borrelia antigen-specific memory T cells that were activated ex vivo by 

recombinant Borrelia-specific antigens, using Th1 cytokine Interferon-γ ELISPOT at 

the single cell level. The human PBMC were stimulated with single or a combination 

of recombinant Borrelia-specific antigens, DbpA, OspC, p100 and VlsE. In addition, 

we added cytokine IL-7 into the culture to increase the detection of T memory cells. 

The results of ELISPOT were analyzed and reported as IFN-γ Spot Forming Units 

(SFU). To validate this assay, 25 diagnosed Lyme patients and 80 control subjects 

were studied and the results were compared with Western Blot test. The performance 

of the Lyme ELISPOT assay, including clinical sensitivity, clinical specificity, 

accuracy and precision, is also evaluated. 

Results: The frequency of Borrelia-specific T memory cells can be detected by 

Interferon-γ ELISPOT and therefore can be used as a biomarker for Borrelia infection. 

The detection of antigen specific T cells was significantly increased by a combination 

of recombinant Borrelia antigens and addition of IL-7. The signal enhancing effect of 

IL-7 was observed even at saturating antigen concentration in terms of frequency, but 

IL-7 did not increase the amount of IFN-γ secreted by individual cells. The ELISPOT 

assay cut-off value was determined using Receiver Operating Characteristic (ROC) 

curve analysis. A cut-off value of >25 SFU maximized assay sensitivity and 

specificity. The ELISPOT has a significantly higher specificity (94%) and sensitivity 

(84%) compared with Western Blot (Sensitivity 24%). It has a positive predictive 

value of 81% and a negative predictive value of 95%. The Area Under the ROC Curve 

(AUC) is 0.943, demonstrating that Lyme ELISPOT Assay has an excellent diagnostic 

accuracy. The results also demonstrated a dissociation between B cell response 

and T cell response during Borrelia infection, suggesting that a comprehensive 

immunological diagnostic panel should include both B cell and T cell diagnostics. 

Conclusion: A novel T cell-based assay for diagnosis of Lyme disease -Lyme 

ELISPOT was developed and validated. This novel ELISPOT assay may be a 

helpful laboratory diagnostic test for Lyme disease, especially for seronegative Lyme 

patients and in monitoring treatment. A comprehensive evaluation of both antibody 

response and T cell response to Borrelia infection will provide new insights into the 

pathogenesis, diagnosis, treatment and monitoring the progress of Lyme disease. 

B-95 

IGRA, TST, and Mycobacterium tuberculosis PCR assay in 

combination with high-resolution computed tomography for rapid 

diagnosis of smear-negative pulmonary tuberculosis in Korea 

S. P. Suh 1 , O. Lee 1 , S. Lee 1 , H. Choi 1 , S. Kee 1 , M. Shin 1 , J. Shin 1 , B. Park 2 , 

D. Ryang 1 . 1 Department of Laboratory Medicine, Chonnam University 

Medical School, Gwangju, Korea, Republic of, 2 Mokpo National University, 

Muan, Korea, Republic of 

Background: It is challenging to early detect pulmonary tuberculosis (PTB), 

especially in smear-negative PTB cases. There are several assays for rapid diagnosis 

of PTB, including whole-blood interferon-γ release assay (IGRA), tuberculin skin test 

(TST), polymerase chain reaction (PCR), and high-resolution computed tomography 

(HRCT). However, little is known about the diagnostic performance of such methods. 

The purpose of this study is to compare whole-blood IGRA, TST, sputum PCR, and 

HRCT in the diagnosis of smear-negative PTB. 

Methods: Retrospective comparison of the performance of whole-blood IGRA 

(QuantiFERON-TB Gold-In Tube; Cellestis, Australia), TST, sputum PCR using 

Roche Cobas Amplicor Mycobacterium tuberculosis assay (Roche Diagnostics, 

Switzerland), and HRCT in the rapid diagnosis of PTB was conducted at a university 

hospital in Korea. 

Results: Of 319 patients available for all the rapid assay results in the study, 237 

were smear-negative, including 78 patients with PTB and 159 with non-TB. The 

sensitivities and specificities were 79.5% and 59.4% for IGRA, 60.3% and 77.4% 

for TST, 39.7% and 96.9% for PCR, and 71.8% and 90.6% for HRCT, respectively. 

The positive and negative predictive values were 50.9% and 84.5% for IGRA, 56.6% 

and 79.9% for TST, 86.1% and 76.6% for PCR, and 78.9% and 86.8% for HRCT, 

respectively. Among 62 patients suspected of having PTB based on HRCT, 42 patients 

showed positive IGRA results, 41 (97.6%) of which were culture-confirmed. Among 

149 patients suspected not to have PTB based on HRCT, 77 patients showed negative 

IGRA results, 72 (93.5%) of which were diagnosed as non-TB. Among 71 patients 

suspected of having PTB based on HRCT, 36 patients showed positive TST results, 

34 (94.4%) of which were culture-confirmed. Among 166 patients suspected not to 

have PTB based on HRCT, 119 patients showed negative TST results, 110 (92.4%) 

of which were diagnosed as non-TB. Among 71 patients suspected of having PTB 

based on HRCT, 25 patients showed positive PCR results, 24 (96%) of which were 

culture-confirmed. Among 166 patients suspected not to have PTB based on HRCT, 

155 patients showed negative PCR results, 140 (90.3%) of which were diagnosed as 

non-TB. 

Conclusion: In smear-negative PTB patients, IGRA in combination with HRCT could 

help finding more TB cases than PCR or TST in combination with HRCT. However, 

PCR in combination with HRCT could be helpful to rule out more non-TB cases than 

IGRA or TST in combination with HRCT. 

B-96 

Evaluation of Klebsiella pneumoniae carbapenemase (KPC) 

production in Enterobacteriaceae with decreased susceptibility to 

carbapenems 

N. B. Alves, J. S. Viana, P. H. N. Bicalho, F. M. D. Neves, G. F. Souza, C. 

A. Araújo, A. L. Rocha, M. A. B. Sousa. Instituto Hermes Pardini, Belo 

Horizonte, Brazil 

Background: Bacterial resistance has increased indexes mortality, morbidity and 

costs of treating infectious diseases, especially those caused by Gram-negative 

bacteria against which the carbapenems represent important alternative treatment. 

The emergence of carbapenemases KPC types limits the therapeutic options in case 

of infection caused by Enterobacteriaceae, becose these enzymes are capable of 

inactivating carbapenems, penicillins, cephalosporins and monobactams. This study 

aimed to identify the gene blaKPC in Enterobacteriaceae with decreased susceptibility 

to carbapenems, isolated from clinical specimens from hospitalized patients, and the 

profile’s evaluation of antimicrobial susceptibility of these microorganisms. 

Methods: In 541 strains of Enterobacteriaceae, isolates were found 48 (8.87%) that 

were resistant or intermediately resistant to imipenem and / or meropenem, identified 

by MicroScan ® system. For phenotypic analysis of the production of carbapenemase 

KPC type of test was performed Hodge, and the confirming was done by PCR for 

gene blakpc. The susceptibility test tigecycline and Ertapenem was performed by 

disk diffusion method, and to test the susceptibility Polymyxin B, determination 

of minimum inhibitory concentration (MIC) was determined by E-test ® strips on 

Mueller-Hinton agar according to the manufacturer’s recommendations. The results 

were interpreted according to Brazil’s National Agency for Sanitary Vigilance 

Technical Note 01/2010. 

Results: Among the 48 isolates, the most frequent was Klebsiella pneumoniae 

(50%), followed by Providencia stuartii (22.9%), Enterobacter aerogenes (8.3%), 

Enterobacter cloacae (8.3%), Escherichia coli (6.3%), Proteus penneri (2.1%) and 

Serratia marcescens (2.1%). Detection of gene blaKPC was positive in 81.3% of the 

samples. The Hodge test was positive for 85.4% of the strains. In 95.1% of positive 

cases in the Hodge test, the presence of production of carbapenemase KPC type 

by detecting blaKPC gene by PCR was confirmed. Results showed that the Hodge 

test had a sensitivity of 100% and specificity of 81.8%. The positive and negative 

predictive values were, respectively, 95.1% and 100%. 

We observed a high resistance pattern to the most part of antibiotics. Tigecycline and 

Polymyxin B proved to be the best treatment options for the majority of isolates, and 

this indicates the need for automation panels which contain these antimicrobials to 

achieve faster test results. Nevertheless, 01 strain of Enterobacter aerogenes and 05 

strains of Klebsiella pneumoniae were resistants to Polymyxin B. 




Conclusion: The results demonstrate the need for constant surveillance, so that 

containment effective measures against of bacteria producing KPC carbapenemase 

type can be taken as soon as possible. Thereby, it is possible to prevent the avoiding 

the spread of this resistance mechanism. Furthermore, it is crucial to progress the 

technological development of new more efficient drugs for the treatment of infections 

caused by multidrug-resistant Gram-negative bacteria.The results surprisingly 

showed an accelerated growth of the resistance gene transmission to various bacterial 

specimens in Belo Horizonte (Brazil). It’s an worrisome informations, because the 

first report of a Enterobacteriaceae strain resistant to carbapenems in our institution 

was in January 2009. 

B-97 

Total lymphocytes count (TCL) as predictor of imunossupression in 

people living with hiv. Is CD4 count still needed? 

G. F. Souza 1 , W. Pedrosa 1 , B. Alves 2 , C. Quadros 2 , I. Pereira 2 , J. Heimann 2 , 

L. Damião 2 . 1 Instituto Hermes Pardini, Belo Horizonte, Brazil, 2 Faculdade 

de Saúde e Ecologia Humana, Vespasiano, Brazil 

Introduction: HIV infection results in qualitative changes and leukocyte depletion, 

mainly the lymphocyte T CD4+. Counting the lymphocyte subpopulation allows 

predicting the disease progression and defines when to start treatment in naive 

patients. There are few dedicated laboratories for CD4 count in developing world and 

the sample presents very low stability when transport for long distances are needed. 

The total lymphocyte count (TLC) is cheaper and available in small laboratories and 

in special situations could be used to predict severe immunosuppression (CD4



was divided into three subgroups: patients with chronic hepatitis B (CHB), cirrhosis, 

and hepatocellular carcinoma (HCC). Subjects with genotype AG of rs2285452 were 

significantly less susceptible to HCC than those with AA genotype (P=0.04,OR=0.25, 

95%CI=0.07-0.95). Serological marker model of “HBsAg+, HBeAg+, HBcAb+” was 

predominate among patients with HBV infection. However, there was no association 

between genotype distribution of 5 SNPs and serological marker models(P>0.05). 

Conclusions: Our findings suggest that allele A of rs2221903, rs4833837 in IL-21 

and rs1053023 in STAT3 may influence the production of anti-HBs. Furthermore, 

genotype AG of rs2285452 in IL-21R could reduce the risk of HCC, when compared 

with genotype AA. However, further research needed to prove that host genetics is 

likely to influence the outcome of HBV infection. 

B-101 

Detection of human papilloma viruses using PANArrayTM HPV kit in 

microarray technology. 

S. Kim, G. Joe, S. Ha, S. Ha, I. Wo, M. Kil, S. Cho, E. Kim, H. Park. 

PANAGENE.Inc, Daejeon, Korea, Republic of 

Background: Human papilloma viruses (HPV) are the major cause of cervical 

cancer. Hence, HPV genotype detection is a helpful preventive measure to combat 

cervical cancer. HPV type is associated with different risks for the development 

of cervical cancer. So, detecting and genotyping HPV has increasingly become an 

integral part of cervical cancer control. Recently, several HPV detection methods 

have been developed, and each has different sensitivities and specificities. To detect 

HPV infection, HPV DNA testing is necessary. HPV DNA testing is required as a 

primary genotyping tool for HPV vaccination. In these days, HPV DNA testing is 

recommended for cervical cancer since it is more sensitive and specific than Pap 

smear method which has much possibility to have false negative result. We have 

developed PANArray HPV Genotyping Chip using peptide nucleic acid (PNA) as 

probes instead of DNA probes. PNA, DNA analogue, has a strong binding affinity to 

its complementary DNA sequences and results in fast hybridization rather than DNA. 

Methods: PANArray HPV Genotyping Chip is made by immobilizing 33 HPV 

type-specific PNA probes on PNA chip. On one well, 33 probes are positioned; 19 

HPV genotypes with high risk (16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 

66, 68, 69, 70, and 73) and 13 HPV genotypes with low risk (6, 11, 32, 34, 40, 42, 

43, 44, 54, 55, 62, 81, and 83). In addition, PNA probes for beta-globin gene for PCR 

confirmation and position markers are also immobilized on the same well.We have 

comparatively analyzed the value of PANArray HPV Genotyping Chip and DNA 

sequencing with 197 clinical samples. 

Results: We analyzed a total of 197 clinical samples by PANArray assay and validated 

its usefulness by comparing results to those of the sequencing method. The PANArray 

results show positive with 66 samples (including 9 samples of multiple infections), 

negative with 131samples. The PANArray results have 97% high concordance (192 

out of 197) with DNA sequencing in detecting genotype. The PANArray HPV chip 

was highly accurate, suitable for detection of single and multiple infections, rapid 

in detection, less time-consuming, and easier to perform comparing to the other 

methods. It is concluded that for clinical and epidemiological studies, all genotyping 

methods are perfectly suitable, and provide comparable results. 

B-102 

The Tm Mapping Method: A novel rapid, easy, and cost-effective 

method that identifies unknown pathogenic microorganisms within 

three hours of sample collection 

H. NIIMI 1 , T. Ueno 1 , S. Hayashi 1 , A. Abe 2 , T. Tsurue 2 , M. Mori 3 , H. Tabata 4 , 

H. Minami 4 , M. Goto 5 , S. Saito 1 , I. Kitajima 1 . 1 Toyama University Hospital, 

Toyama, Japan, 2 Kitami Information Technology Co., Ltd., Hokkaido, 

Japan, 3 Ishikawa Prefectural University, Ishikawa, Japan, 4 Hokkaido 

Mitsui Chemicals, Inc., Hokkaido, Japan, 5 University of Iowa Carver 

College of Medicine, Iowa, IA 

BACKGROUND: The earliest possible identification of pathogenic microorganisms 

is critical for selecting an appropriate antimicrobial therapy and for obtaining 

a favorable outcome for infected patients. However, as the current pathogenidentification 

methods using microbial culture require several days, empirically 

selected antimicrobial agents are administered until the pathogenic microorganisms 

are identified. Though mass spectrometry is can be utilized as a rapid identification 

method of pathogens, it requires the blood culture process, so it takes more than 10 

hours after sample collection. We developed a novel rapid, easy, and cost-effective 

method that identifies the dominant bacteria in a sample within three hours of sample 

collection. Using only seven primer sets, more than 100 bacterial species can be 

identified, and the number of identifiable bacterial species is easily expandable. We 

named this method the “Tm mapping method”. 

METHODS: To detect pathogenic bacteria by PCR with high sensitivity, we 

developed a novel “eukaryote-made” Taq polymerase, which is free from bacterial 

DNA contamination (J Clin Microbiol. 2011 Sep; 49(9):3316-20). We also developed 

the Tm mapping method for the rapid identification of a broad range of pathogenic 

microorganisms. We developed this system, and already obtained international 

patents in Japan (2010), in the U.S. (2012), and in Europe (2013), which proves it is 

unique and original. The method identifies pathogenic microorganisms by mapping 

the unique shape of seven melting temperature (Tm) values in two dimensions. This 

unique shape reflects the different DNA base sequences present among bacterial 

species. Comparing the shape of the mapped Tm values to the shapes in the database, 

the pathogenic bacteria is identified. To use this method from anywhere easily, we 

also developed identification software program that is available on the Web. The 

Tm mapping method does not need to use either bacterial cultures or a sequencing 

analysis, and therefore rapid, easy, and less expensive identification of pathogens is 

possible. 

RESULTS: To evaluate the accuracy of the Tm mapping method, we first performed 

blind tests using the 107 kinds of bacterial DNA registered in the database. In the 107 

trials, 106 Tm mapping results matched with the pre-sequenced bacterial DNA. Next, 

using 140 bacterial colonies (51 

bacterial species), we evaluated the accuracy of the Tm mapping method compared 

with the sequencing method. As a result, the identification rate was 97%. Finally, using 

42 patient samples (22 from whole blood, 11 of amniotic fluid, nine of cerebrospinal 

fluid), we evaluated the accuracy of the Tm mapping method compared with the 

sequencing method. Excluding the eight samples not suitable for the Tm mapping 

method because the Difference Values were greater than 0.5 (our judgment criteria), 

97% (33/34) of the Tm mapping results matched with the sequencing results. 

CONCLUSION: The Tm mapping method would be especially useful for infectious 

diseases that require prompt treatment, such as sepsis and bacterial meningitis, and 

would contribute to the rescue of patients with severe infections, as well as a decrease 

in the development of antibiotic resistance. 

B-103 

Potential Utility of a Novel Automated Point-of-Care Image Based 

Hematology Analyzer for the Diagnosis of Malaria as Part of a Routine 

CBC 

M. B. Jorgensen, R. A. Levine, S. C. Wardlaw. QDx, Inc., Branford, CT 

Background: Prompt and accurate malaria diagnosis permits effective treatment, 

decreases drug resistance development, and directs epidemiologic responses. When 

malaria is diagnosed, its treatment is based, in part, upon the patient’s hematologic state, 

including the hemoglobin concentration, platelet count, and degree of parasitemia; the 

latter is important in determining the severity of the infection and monitoring the 

patient’s response to therapy. The objective of this study was to determine the ability 

of a new image-based hematology analyzer to detect intraerythrocytic infection with 

Plasmodium falciparum in whole blood samples. 

Methods: 300 nL blood samples were placed in a novel transparent four micron 

high chamber containing acridine orange and an isovolumetric sphering agent in a 

localized area. The sample was digitally imaged with sequential transillumination at 

413 nm and epi-illumination at 470 nm. Images were captured showing the optical 

density (OD) of the monolayer of red blood cells (RBCs) and fluorescent emission 

due to the nucleic-acid selective fluorophore. P. falciparum infected blood cultures 

and human specimen were analyzed with available results within ten minutes, also 

reporting a full complete blood count (CBC). 

Results: Uninfected sphered RBCs exhibited homogenous optical density (A, dashed 

arrows), whereas infected RBCs exhibited localized areas of decreased optical 

density due to the displacement of hemoglobin by the parasite (A, solid arrows). The 

concomitant fluorescent images revealed no fluorescent emission in uninfected RBCs 

(B, dashed arrows) and the presence of fluorescent falciparum merozoites (B, solid 

arrows) in the areas of OD decrements. When combined, these two measurements 

provided a sensitive and specific (100% sensitivity and 97.7% specificity at 0.025% 

parasitemia) method for the detection of P. falciparum in sub-microliter blood 

samples. 




B-105 

The Use of Procalcitonin in the Clinical Practice 

U. Ray, M. Smillie, N. Jordan, J. Houston. Royal Hobart Hospital 

University of Tasmania, Hobart, Australia 

Conclusion: The detection, confirmation, and quantification of malaria infection as 

part of the performance of an automated CBC is feasible. Preliminary observations 

also indicate potential utility in diagnosing Babesia. 

B-104 

Significant Increase of Sensitivity on Rapid Influenza Antigen Assays 

Using Silver Amplification Immunochromatography Method. 

S. C. Kimura, H. OHTO, H. YAMAGUCHI, S. FUKUOKA, E. NAKAMA, 

Y. UMEDA. Showa University Northern Yokohama Hospital, Yokohama 

City, Japan 

Background: Rapid diagnosis of influenza is commonly performed with 

immunochromatography method (IC) using specimens taken from upper respiratory 

tract. Although IC is easy and relatively cheap, its sensitivity is not perfect especially 

in early stage of disease because of low concentration of viral antigens. Applying a 

newly developed “silver amplification” principle, we generated a new assay method 

to increase sensitivity. The aim of this study is if our method has higher sensitivity and 

specificity than conventional IC assays. 

Materials and Methods: One hundred and twenty cases of influenza-like symptoms; 

fever, rhinorrhea, cough, and/or general fatigue who visited pediatrics department of 

our hospital from November 2011 to April 2012 were entitled. Cotton swab specimens 

were applied to Fuji Drychem IMMUNO AG1 TM (FUJIFILM Medical, Tokyo, Japan). 

Simultaneously, a conventional IC method was performed with Quick Chaser FLU A/ 

B TM by Mizuho Medy (Tosu, Japan). A real time PCR with TaqMan probe was also 

done for gold standard. This study was authorized by local ethic committee. 

Results: With silver amplification method, 23, 15 cases were influenza A, B positive, 

respectively. On the other hand, 23, 8 cases were A, B, positive with conventional 

assays. PCR results were positive in all the cases which showed positive in new 

method, negative in conventional assays. Their virus concentration ranged 10 5 to 10 9 

copies/ml. 

Discussion: Though statistically not significant, the silver amplification method 

showed higher sensitivity for influenza B. Because of photo-developing principle, its 

sensitivity was reported to increase 8 to 16 times. This analyzer is small (18x20x11cm) 

and light (1.8kg), it is suitable for bedside testing. Since number of cases is limited, 

more data are required to confirm the result. 

Conclusion: Our novel assay method using silver amplification has high potentiality 

to increase sensitivity of rapid bedside testing. 

 

 

 

 

 

 

 

 

 

 

 

 

Aim: To study the role of Procalcitonin (PCT) in the diagnosis of systemic bacterial 

infection in the clinical practice at the Royal Hobart Hospital. 

Introduction: The diagnosis of systemic bacterial infection poses still a problem in 

the clinical setting throughout the globe. Both the clinicians and the laboratorians face 

the difficult task of deriving the appropriate diagnosis so that appropriate antibiotic 

can be instituted in time. The inflammatory conditions are monitored by measuring 

of C-reactive protein (CRP), white blood cells(WCC),erythrocyte sedimentation 

rate(ESR) in the initial work-up and the tissues and the fluids are sent for culture 

and antimicrobial sensitivity. The antimicrobial culture and sensitivity take 48 to 

72 hours. Until the arrival of PCT, there was no laboratory test available for the 

earliest diagnosis of systemic bacterial infection. Procalcitonin (PCT) is a 13kd 

polypeptide, transcribed by Calci-1 gene which also codes for thyroid medullary 

hormone-Calcitonin is synthesized by trigger of bacterial capsular antigen. PCT can 

be synthesized by most of the body cells but predominant synthesis takes place during 

the systemic bacterial infection. Within initial 3-6hours of the systemic invasion of 

bacteria the synthesis of PCT starts and in the local bacterial as well as viral infection 

PCT synthesis does not take place, although in many systemic fungal infection PCT 

levels have been found to be elevated.PCT level more than 0.5ng/ml is diagnostic of 

systemic bacterial infection and the degree of elevation varies with the severity of 

systemic bacterial infection. With the institution of appropriate antimicrobials therapy 

PCT levels start coming down. 

Methods: We measured CRP, WCC,PCT and culture and sensitivity of urine and 

blood for patients admitted to ICU and medical wards at the Royal Hobart Hospital. 

CRP assay was done by Architect ci 8200, PCT assay by BRAHMS PCT-Q (rapid 

assay),WCC by Sysmex Cell Counter and blood/urine cultures were done by 

conventional petri dish culture -sensitivity plates. 

Results: CRP and WCC are raised universally in all the clinical cases with 

inflammation. PCT >0.5ng/ml was elevated only in the systemic bacterial infections 

and not in any viral infection and autoimmune inflammatory conditions(p 5 / 

μL), leukocyte esterase (LE), leukocyte nitrite (LN) and ASP (cutoff, >10,000/mL). A 

positive urine bacterial culture was defined as growth of one or two uropathogens at 

a concentration higher than 10 4 CFU/mL. Results of these three routine tests with or 


A201



without ASP were compared against corresponding urine culture (reference method). 

The performance of these tests in association with culture was expressed in sensitivity 

(SN), specificity (SP) and negative predictive value (NPV). 

Results:Laboratory results of 480 patients were collected at random. The demographic 

performance (SN, SP, NPV) of individual test was 89.7%, 55.1% and 82.8% for LC, 

85.5%, 58.6% and 78.7% for LE, 36.8%, 92.1% and 56.6% for NIT, and 46.6%, 

83.8% and 58.3% for ASP, respectively. When LC, LE and NIT were combined, SN, 

SP and NPV were 92.5%, 49.3% and 85.5%, respectively When ASP was added to 

this combined panel, SN, SP and NPV were 94.4%, 46.7% and 88.3%, respectively. 

Conclusion: Whenusing alone, ASP is not superior to traditional urinalysis as a 

screening test for justify urine culture. However, the performance increases by 

including ASP in the traditional urinalysis, implicating that ASP may be potential and 

benefit traditional panel of urinalysis in terms of SN and NPV. 

B-108 

False positive rate of a 4th generation HIV-1 antigen/antibody combo 

test relative to gender and pregnancy state 

V. L. Ng, F. Saechao. Alameda Health System/Highland General Hospital, 

Oakland, CA 

Background: In late 2010 we implemented a combination HIV-1 antigen and antibody 

test (HIV-1 Ag/Ab; Abbott Diagnostics Division, Abbott Park, IL, USA). A few false 

positive results from pregnant non-HIV-1 infected women at delivery prompted 

us to review our overall false positive rate relative to gender and pregnancy state. 

Methods: All HIV-1 Ag/Ab testing and interpretation was performed in accordance 

with manufacturer’s recommendations. All specimens yielding a “reactive” HIV-1 

Ag/Ab result were sent for confirmatory testing by Western Blot (WB) and often HIV 

load (HIVL) quantification. For an HIV-1 Ag/Ab “reactive” result, a true positive 

was defined as the same specimen yielding a positive Western Blot (WB), a false 

positive yielding a negative or indeterminate WB and undetectable HIVL, and an 

indeterminate yielding an indeterminate WB with no HIVL determined. 

Results: From December 2011 through January 2013 we performed 9489 HIV-1 Ag/ 

Ab tests. 153 specimens from 122 patients were reactive for an overall 1.6% positivity 

rate (95% confidence interval, CI, of 1.4 - 1.8%). Of these 122 patients, 14 (11.5%, 

95% CI 6.7 - 18.8%) had false positive and 4 (3.2%; 95% CI 1.3 - 8%) indeterminate 

results. Gender specific analysis revealed: 

Females % (95% CI) of Females Males % (95% CI) of Males 

Total 35 87 

# true positives 23 65.7% (49-79%)* 81 93.1% (85-97%)* 

# false positives 8 22.9% (12-39%) 6 6.9% (3-14%) 

# indeterminate 4 11.4% (4.5-26%) 0 0.0% (0-4%) 

*positive predictive value (PPV) 

The false positive rates between females and males were not statistically different but 

the true positive rates were. Twelve of the 35 (34%) females with “reactive” HIV-1 

Ag/Ab results were pregnant. Of these 12, seven (59%; 95% CI 32-81%) had true 

positive results, four (25%, 95% CI 14 - 61%) false positive and 1 an indeterminate 

result. 

Conclusion: Our overall ~11.5% false positive rate, lower 65.7% PPV for women and 

even lower 59% PPV for pregnant women allows us to individualize our interpretation 

of HIV-1 Ag/Ab reactive results while awaiting confirmatory testing results. 

B-109 

Maximising Cost Effectiveness of Infectious Disease Serology Controls 

Through Consolidation of Analytical Parameters 

S. Doherty, S. Picton, A. Veerasekaran, P. Armstrong, M. L. Rodriguez, J. 

Campbell, S. P. Fitzgerald. Randox Laboratories Limited, Crumlin, United 

Kingdom 

Introduction: Currently to meet the infectious disease serology quality control 

requirements of laboratories, a multitude of controls/programmes are needed due 

to the limited number of analytical parameters in each of the controls encountered. 

These represent both a time and financial burden in the assessment of laboratory 

performance. 

Consolidating parameters in a minimal amount of controls maximises cost 

effectiveness (i.e. reducing time, shipping costs, different suppliers, participation 

costs) simplifying participation in the required external quality assessment schemes. 

Relevance This study reports on the evaluation of the applicability of a new series 

of consolidated control material for the simplified assessment of infectious disease 

serology on a range of analytical systems for use in internal and external quality 

control applications. 

Methodology: As two thousand five hundred serology laboratories participated in 

this study, it was considered that sufficient levels of data would be returned. Lists 

of parameters of interest, methods, instruments and reagents were established 

accordingly and grouped into the following related panels, HIV/Hepatitis (anti-HIV-1, 

anti-HIV-2, anti-HIV-1&2 Combi, anti-HCV, Anti-HBc, anti-HTLV-I, anti HTLV-II, 

anti HTLV-1 and 2 Combi, anti-CMV, HBsAg), ToRCH (anti-toxoplasma IgG, antitoxoplasma 

IgM, anti-rubella IgM, anti-rubella IgG, anti-CMV IgG, anti-CMV IgM, 

anti-HSV1 IgG, anti-HSV 2 IgG, anti-HSV-1&2 IgG Combi), Epstein Barr Virus 

(anti-EBNA IgG, anti-EBV VCA IgG, anti EBV VCA IgM) and Syphilis (1 parameter 

categorised by method). Each participant was sent a set of blind control materials to 

be assayed (including one positive and one negative control). Positive controls: all the 

parameters for the different panels were included at sufficiently high levels in a single 

corresponding control in order to elicit a strong reactive response for all the various in 

house and commercially available reagent materials. Negative controls: material with 

non reactive response to the parameters of interest. 

Results: The assessment of the positive control samples showed positive reported 

responses with an overall percentage agreement >85% for the majority of the 

parameters in each panel: HIV/Hepatitis (85.7% to100 %), Epstein Barr Virus (96.8% 

to 97.2%), syphilis (92.3% to 100%), ToRCH panel (93.0-99.2% for 8 out of 9 

parameters, anti-HSV2 IgG was method dependent). The negative control samples 

exhibited non reactive response with an overall percentage agreement >88.6% for all 

the parameters. 

Conclusion: This study indicates that the serology control material in which the 

positive samples contain all parameters pertaining to the different panels, elicits a 

positive response with a favourable overall percentage agreement for all the panels 

tested. The ToRCH panel also exhibited good agreement for the majority of the 

parameters, the levels of anti-HSV 2 IgG were insufficient to elicit positive response 

in the sample provided for some methods. All the panels evaluated presented good 

consensus for the negative control samples. Consolidating parameters in a minimal 

amount of controls is beneficial as this not only minimises the number of controls 

to be used but also maximises cost-effectiveness. This is applicable as it minimises 

the time required for the preparation of control materials, reducing potential errors, 

storage requirements when these controls are used for both internal and external 

quality control applications. 

B-110 

HLA-DP/DQ polymorphisms associate with the susceptibility of HBV 

infection in Chinese Uygur population 

Y. Liao, Y. Li, B. Cai, S. Shang, L. Wang. West China Hospital, Sichuan 

University, Chengdu, China 

Background: Chronic Hepatitis B is one of the most prevalent infectious diseases 

in the world. Several studies have revealed that human leukemia antigen (HLA) DP, 

DQ polymorphisms (rs3077, rs9277535, rs7453920) associate with the susceptibility 

of hepatitis b virus (HBV) infection in the Asian population including Janpanese, 

Korean and Chinese Han. Few studies involved ethnicities living in west China, 

such as the Uygur population, which has a remarkably different living habit from the 

Chinese Han. Besides, they are more predisposed to infection of genotype D HBV 

which is seldom observed in the Han population. Thus our study aims to investigate 

the correlation between HLA-DP, DQ polymorphisms and the susceptibility of HBV 

infection in the Uygur population. 

Methods: HLA-DP/DQ rs3077, rs9277535, rs7453920 genotypes were determined 

by High Resolution Melting Curve, and the results were validated through sequencing 

of the PCR product. 

Results: In total, we included 390 Uygur subjects from the west part of China, 

including 192 Uygur patients and 188 Uygur healthy controls, 234 male and 152 

female subjects. Results showed that rs3077 (P=0.005), rs7453920 (P=0.005) and 

rs9277535 (P=0.008) independently correlated with the susceptibility of HBV 

infection. Logistic regression analysis with adjustment for covariates including age, 

sex and the three single nucleotide polymorphisms (SNPs) revealed that rs9277535 

was significantly related to the increased risk of HBV persistent infection (P=0.022, 

OR=1.64,95% Confidence Interval [CI]=1.08 - 2.49), while rs7453920 correlated 

with a reduced risk of HBV infection (P=0.009, OR=0.56, 95%CI= 0.37 - 0.87). 

Detailed results were shown in Table 1. 

Conclusion: Our study confirmed that HLA-DP, DQ polymorphisms correlated with 

the susceptibility of HBV infection in the Uygur population, especially HLA-DQ 

rs7453920, which has remarkable effect on the HBV infection. 




Genotype distributions of the three SNPs between Uygur HBV group and the healthy group 

Genotype HBV Healthy Control OR 95%CI P 

rs3077 

AA 75(39.1) 98(55.7) 1.00 

AG 84(43.8) 59(33.5) 1.86 1.19-2.91 0.006 

GG 33(17.2) 19(10.8) 2.27 1.20-4.30 0.011 

rs9277535 

AA 89(46.6) 113(60.1) 1.00 

AG 70(36.6) 61(32.4) 1.46 0.94-2.27 0.094 

GG 32(16.8) 14(7.4) 2.90 1.46-5.77 0.002 

rs7453920 

GG 128(67.4) 103(53.9) 1.00 

AG 58(30.5) 75(39.3) 0.62 0.41-0.96 0.03 

AA 4(2.1) 13(6.8) 0.25 0.08-0.78 0.011 

B-111 

Comparison of four commercial assays for human papillomavirus 

detection in consecutive clinical laboratory samples including men and 

women. 

T. Santa Rita 1 , M. Caixeta 2 , C. Chianca 1 , L. Velasco 2 , L. Abdalla 2 , S. Costa 2 , 

G. Barra 2 . 1 Universidade de Brasília, Brasília, Brazil, 2 Laboratorio Sabin, 

Brasília, Brazil 

Background: Currently, there are several commercial assays for Human 

Papillomavirus (HPV) detection. However, there are substantial differences between 

their proposals, such as genotypes detected, methodology, and viral genomic target 

region that confer unique analytical performances for each one. Here, we compare 

four commercial HPV assays in consecutive samples from our HPV detection 

routine that’s include 1/3 of men and 2/3 women. 

Methods: The assays were Hybrid Capture (HC2-Qiagen), Papillocheck (Greinerbio-one), 

Clart-HPV2 (Biomerieux), and Real-Time High-Risk HPV (Abbott-PCR). 

Ninety two (61 women and 31 men) consecutive genital samples were included. 

Requesting physician performed the samples collections in Specimen Transport 

Medium (Qiagen). Results were shown as HPV positivity (any HPV detected) and 

High-Risk HPV positivity (at least one HR-HPV detected). Statistical analysis were 

chi-square test and Cohen’ Kappa agreement coefficient. In divergence investigation, 

fail was characterized by a negative result in a sample classified positive in any other 

method, except if the genotype was not detected by the method. 

Results: The overall concordance was 78.7% for women and 45.2% for men. HPV 

positivity was 19.7, 24.6, 27.9 and 27.9% (P=0.69) in women and 29.0, 58.1, 67.7 

and 32.3% in men (P=0.0035) for HC2, Papillocheck, Clart-HPV2 and Abbott-PCR, 

respectively. HR-HPV positivity was 18.0, 19.7, 24.6 and 27.9% (P=0.58) in women 

and 22.6, 38.7, 48.4 and 32.3% in men (P=0.18) for HC2, Papillocheck, Clart-HPV2 

and Abbott-PCR, respectively. The concordance and kappa between each method 

are shown in Table 1. HC2, Papillocheck, Clart-HPV2 and Abbott-PCR fail in 13.1, 

9.8, 8.2 and 0% of the samples in women and in 35.5, 12.9, 3.2, and 12.9% in men, 

respectively. Not detected genotype account for 8.2% and 19.3% of the divergence in 

women and men, respectively. 

Conclusion: For women, HC2, Papillocheck, Clart-HPV2 and Abbott-PCR shown 

similar analytic performances. For men, Papillocheck and Clart-HPV2 shows better 

analytic performance than HC2 and Abbott-PCR. 

The concordance (%) and kappa between each HPV assay 

HPV Detection 

HR HPV Detection 

Method 1 Method 2 Concordance Kappa Agreement Concordance Kappa Agreement 

HC2 Papillocheck 91.80 0.763 Good 93.44 0.778 Good 

HC2 Clart-HPV2 91.80 0.776 Good 93.44 0.806 Very good 

Women HC2 Abbott-PCR 85.25 0.597 Moderate 90.16 0.726 Good 

Papillocheck Clart-HPV2 86.89 0.662 Good 90.16 0.709 Good 

Papillocheck Abbott-PCR 83.61 0.577 Moderate 88.52 0.686 Good 

Clart-HPV2 Abbott-PCR 90.16 0.755 Good 93.44 0.831 Very good 

Method 1 Method 2 Concordance Kappa Agreement Concordance Kappa Agreement 

HC2 Papillocheck 70.97 0.456 Moderada 83.87 0.632 Good 

HC2 Clart-HPV2 48.39 0.101 Poor 67.74 0.343 Fair 

Men HC2 Abbott-PCR 77.42 0.469 Moderate 83.87 0.599 Moderate 

Papillocheck Clart-HPV2 77.42 0.521 Moderate 83.87 0.668 Good 

Papillocheck Abbott-PCR 74.19 0.512 Moderate 90.32 0.786 Good 

Clart-HPV2 Abbott-PCR 64.52 0.370 Fair 80.87 0.674 Good 

B-112 

Comparison of Disk Diffusion and Vitek 2 for Antimicrobial 

Susceptibility Test in Clinical Strains of Pseudomonas aeruginosa. 

A. Chebabo, R. G. Pereira, L. Honorio, V. Martins, D. Thielmann, O. 

Fernandes. DASA, Rio de Janeiro, Brazil 

Background: Numerous studies have reported errors involving antimicrobial 

susceptibility tests (AST) for Pseudomonas aeruginosa, especially against β-lactams 

antimicrobial agents1. Because of those data, most of laboratories still use agar disk 

diffusion (DD) for AST of P. aeruginosa. Vitek 2 Advanced Expert System (AES) has 

improved ability to identify resistance, but discrepancies still occur1. 

Objective: We compared Vitek 2 AES to agar disk diffusion for testing susceptibility 

of P. aeruginosa isolates to amikacin, aztreonam, cefepime, ceftazidime, ciprofloxacin, 

colistin, imipenem, meropenem and piperacillin-tazobactam. 

Methods: DD AST was performed according to CLSI criteria2 and was compared 

to Vitek 2 for category agreement (CA). AST-N105 card was used for Vitek 2 AST. 

Discrepancies were categorized as very major errors (VME) when Vitek 2 indicated 

susceptibility and DD indicated resistance, major errors (ME) when Vitek 2 indicated 

resistance and DD indicated susceptibility and minor errors (mE) when Vitek 2 

indicated intermediate susceptibility and DD indicated susceptibility or resistance or 

when Vitek 2 indicated susceptibility or resistance and DD indicated intermediate 

susceptibility3. 

Results: We tested 99 clinical strains of P. aeruginosa from blood culture (n=27), 

bronchoalveolar lavage (n=35), catheter tip (n=16) and surgical secretions (n=9). 

The overall CA for all 9 antimicrobials was 90%. Discrepancies were classified 

as mE in 9.2% of tests, ME were found in 0,3% of cases and VME in 0,4%. One 

VME disagreement was noted for each of the following antimicrobials: amikacin 

(1.0%), aztreonam (1.0%), ciprofloxacin (1.0%) and meropenem (1.0%). One ME 

disagreement was noted for ceftazidime (1.0%), colistin (1.0%) and imipenem 

(1.0%). With the exception to colistin, mE disagreements were detected in all 

antimicrobials tested, with 23.2% for aztreonam, 15.2% for piperacillin-tazobactan, 

11.1% for cefepime, 10.1% for amikacin and ceftazidime, 6.1% for imipenem, 5.1% 

for ciprofloxacin and 2.0% for meropenem. 

Conclusions: Although DD is not the reference method, other studies showed that 

DD is more accurate than automated methods1. FDA minimal performance guidelines 

for TSA indicates that CA should be > 90%, ME should be < 3% and VME should be 

90%. Although most of the disagreements were mE, Vitek 2 is not accurate for most 

β-lactams and should not be used for AST in P. aeruginosa isolates in the clinical 

microbiology lab. 

References: 

1. Sapino B, Mazzucato S, Solinas M, Gion M, Grandesso S. 2009. Comparison 

of different methods for determining beta-lactam susceptibility in Pseudomonas 

aeruginosa. New Microbiol;35:491-94. 

2. Clinical and Laboratory Standards Institute . Performance standards for 

antimicrobial susceptibility testing, 15th informational supplement, M100-S22, 2012. 

3. Ligozzi M, Bernini C, Bonora MG, de Fatima M, Zuliane J, Fontana R. 2002. 

Evaluation of VITEK 2 System for identification and antimicrobial susceptibility 

testing of medically relevant Gram-positive cocci. J Clin Microbiol;40(5):1681-86. 

B-113 

Performance Evaluation of a Monoclonal Based Fecal Calprotectin 

ELISA and Comparison with an Established Assay 

J. A. Erickson 1 , T. L. Van De Walle 2 , D. G. Grenache 3 . 1 ARUP Institute 

for Clinical and Experimental Pathology, ARUP Laboratories, Salt Lake 

City, UT, 2 Parasitology and Fecal Testing Technical Section, ARUP 

Laboratories, Salt Lake City, UT, 3 University of Utah School of Medicine, 

Department of Pathology, Salt Lake City, UT 

Background: Calprotectin is a calcium and zinc binding protein that accounts 

for approximately 60% of the neutrophil cytosolic protein content. Calprotectin 

is a member of the S100 protein family and has anti-microbial activities. Fecal 

calprotectin has clinical utility as a marker of intestinal inflammation and can help 

distinguish between functional symptoms and organic bowel diseases. It is also useful 

for monitoring mucosal healing and identifying disease relapse. The objectives of 

this study were to assess the performance characteristics of the monoclonal antibody 

based Bühlmann Calprotectin ELISA and to complete a method comparison study 

relative to the polyclonal Calpro PhiCal ELISA. 


A203



Methods: Fecal calprotectin was measured according to each assay manufacturer’s 

instructions. Samples included deidentified, residual random stool specimens 

sent to ARUP Laboratories and provided by Alpco Diagnostics. The performance 

characteristics evaluated were analytical sensitivity, linearity, precision including 

the extraction step and not the ELISA exclusively, analyte stability and verification 

of the recommended reference interval. Accuracy was investigated by means of a 

method comparison study against the PhiCal assay. The project was approved by the 

University of Utah’s Internal Review Board. 

Results: The limit of blank was



B-116 

Amplification and Detection of the BD MAX ExK TNA-2 

Specimen Processing Control Target for Diagnostic Purposes in a Wide 

Range of Reverse Transcription (RT)/Annealing Temperatures 

P. Larouche, D. Dugourd, I. Bourque, R. Labourdette, C. Lippé, B. Leclerc, 

V. Jean, S. Champetier, D. Beaulieu, J. Pinard-Lachapelle, J. Cormier, C. 

Ménard, C. Roger-Dalbert. BD Diagnostics, Quebec, QC, Canada 




extraction reagents (ExK) with universal PCR reagents (MMK) allowing users to 


specimen with their own user defined protocols. A Specimen Processing Control 

(SPC), consisting of an armored RNA incorporated into the extraction reagents 

controls for extraction efficiency, reagent integrity and PCR inhibition by the 

sample. The objective of this study was to demonstrate the amplification of the SPC 

over RT/annealing temperatures ranging from 55 ºC to 65 ºC, temperatures which 

accommodate most designs of target-specific primers and probes. 

Methods: Total nucleic acid extraction and amplification were performed without 

clinical sample, using the BD MAX System with BD MAX ExK TNA-2*, specific 

for stool and cerebrospinal fluid specimens, and BD MAX TNA MMK(SPC)*, a 

universal master mix incorporating SPC primers and probe. The amplification thermal 

profile consisted of an activation step, reverse transcription (55, 60 or 65 ºC), and 45 

cycles of a 2-step PCR with annealing performed at 55, 60 or 65 ºC. A threshold of 

100 units in endpoint fluorescence values (Quasar-705) was set to consider positive 

amplification. 

Results: A positive amplification signal was obtained for all conditions (n=48). A 

mean cycle threshold (Ct) of 25.99 and a mean Quasar-705 endpoint fluorescence of 

3143 were achieved. There was no statistical difference observed between tested RT/ 

annealing temperatures for Ct (p=0.659) or endpoint fluorescence (p=0.167). 

Conclusion: The BD MAX ExK TNA-2 Specimen Processing Control target is 

consistently amplified over an RT/annealing temperature range of 55 to 65 ºC, which 

gives users flexibility to design compatible primers and probes solutions for the 

detection of their RNA/DNA targets over a wide temperature range.*The BD MAX 

ExK TNA-2 and BD MAX TNA MMK(SPC) are not available for sale or use. 

B-117 

The prevalence of intestinal parasites in patients from Public Hospital 

in Belo Horizonte - Brazil: from 2000 to 2012 

L. d. Vasconcellos, L. F. Vieira, D. H. Bücker. Universidade Federal de 

Minas Gerais, Belo Horizonte, Brazil 

Background: In Brazil, intestinal parasites are a relevant problem in public health 

service. The insufficient basic sanitation resources associated to absence of personal 

hygienic habits favors the prevalence of the parasites among the population. The 

parasitological stool test is a relevant exam to diagnosis and treatment orientation. 

Is important to know the prevalence of intestinal parasites in your population. The 

objective of the study is to assess the prevalence of intestinal parasites in patients 

from Public Hospital in Belo Horizonte - Brazil, comparing two periods: from 2000 

to 2004 and 2011 to 2012. 

Methods: In the periods of May 2000 to March 2004 and January 2011 to December 

2012, 24425 and 5409 stool samples were performed, respectively. All the samples 

were processed by standard techniques, according to the clinical hypotheses, such as 

Kato-Katz, Hoffman-Pons-Janer and Baermann-Moraes techniques. 

Results: Over the period of 2000 to 2004, 17,877 samples were negative (73.2%) 

and 6575 positive (26.8%). In 2011-12, 4,251 samples were negative (78.5%) and 

1,158 positive (21.5%). In the both periods, the male patients were more affected 

(53%). Among the positive population, 31.7% were from under 20 years old, 56.6% 

were from 21-70 years, and 11.7% were from over 71 years old. One single parasite 

was observed in 57% samples, two were found in 29.9%, three in 9.6%, four in 3.1% 

and five different parasites were found in 0.4% stool samples. The prevalences of the 

parasites are set out in table 1. 

Conclusions: In the last decade, there were a few changes in the profile of intestinal 

parasites in patients from Public Hospital of Belo Horizonte - Brazil. E.coli remains 

the most prevalent parasite in stool sample test. The reduction of prevalence of some 

parasites (Ascaris lumbricoides, Trichuris trichiura and Ancylostoma) may be related 

to improvement of public sanitation. 

Table 1: Prevalence (%) of intestinal parasites in patients from Belo Horizonte, Brazil 

Parasites 2000-2004 2011-2012 

Entamoeba coli 8.3 8.4 

Blastocystis hominis 6.6 7.4 

Entamoeba histolytica 4.3 5.9 

Endolimax nana 4.1 5.1 

Giardia lamblia 3.0 3.5 

Strongyloides stercoralis 1.3 1.5 

Ascaris lumbricoides 1.1 0.2 

Schistosoma mansoni 1.0 1.5 

Trichuris trichiura 0.6 0.2 

Ancylostoma 0.6 0.2 

Hymenolepis nana 0.3 0.2 

Enterobius vermicularis 0.2 0.1 

Isospora belli 0.1 0.1 

Taenia sp 0.1 0.1 

B-118 

Geographical HPV genotype distribution among men and women in 

Brazil’s Federal District 

M. Caixeta 1 , M. Franco 1 , L. Velasco 1 , L. Abdalla 1 , S. Costa 1 , V. Schimitt 2 , 

G. Barra 1 . 1 Laboratorio Sabin, Brasília, Brazil, 2 Pontifícia Universidade 

Católica do Rio Grande do Sul - PUCRS, Porto Alegre, Brazil 

Background: The prevalence of HPV genotypes varies geographically, and HPV 

infection in men is relatively less described and understood. The aim of this study 

was to describe the geographical distribution of HPV genotypes and infection 

parameters in men and women from Federal District’s administrative regions (AR) 

by assessing our clinical laboratory results database. In 2010, the Federal District 

population is comprised of 2.562.963 inhabitants and it’s territory is divided in 31 

ARs. 

Methods: Through retrospective analysis of our HPV genotyping database, we 

assessed the samples results between February 2009 and May 2011. 4,251 samples 

were included all from HPV genotyping test of anogenital region. Samples were 

grouped by AR and only regions with more than 150 positive cases were included in 

the analysis (n=3,126). The HPV positivity, type of infection (single or multiple) and 

genotype distribution were identified and presented by gender and by region. HPV 

genotyping was performed using PapilloCheck (Greiner Bio-One), which evaluates 

24 different HPV genotypes (18 high-risk and 6 low risk). PUC-RS ethic committee 

approved this study. 

Results: The ARs included in the study were: Aguas Claras, Asa Norte, Asa Sul, 

Guara, Lago Norte, Lago Sul, Sobradinho, Sudoeste, and Taguatinga. Positivity was 

different among ARs considering all samples (P=0.0068) and in men (P=0.025), but 

not in women (P=0.14). Multiple and single infection were similar among all ARs 

considering all samples (P=0.68), men (P=0.72) and women (P=0.33). Genotypes 

distributions are shown in Figure 1 and, in the majority of ARs, the genotype more 

prevalent in men was HPV-6 and in women was HPV-16. 

Conclusion: There are geographical differences in HPV genotype distribution and in 

positivity among men and women in the studied ARs of Brazil’s Federal District. In 

all ARs, multiple infection has high prevalence and HPV-6 is more prevalent in men 

and HPV-16 in women. 


A205



B-119 

Seroprevalence of HTLV-1/2 infection and its association with HCV 

and HIV infection among population attended in a commercial 

laboratory in Rio de Janeiro, Brazil. 

I. Bendet 1 , T. S. P. Souza 1 , L. Zanella 2 , A. C. P. Vicente 2 , O. Fernandes 1 . 

1 

Immunology Division - DASA, Rio de Janeiro, Brazil, 2 Instituto Oswaldo 

Cruz, Rio de Janeiro, Brazil 

Background: Human T-lymphotropic virus (HTLV) infects around 20 million 

people worldwide, with endemic areas in South America, Caribbean and Africa. This 

virus infection is endemic in Brazil, where around 2 million people can be infected. 

Screening potential blood donors for HTLV is mandatory in Brazil. The mean 

prevalence rate of HTLV infection in this group, in the Brazilian geographic regions, 

is quite distinct from 0.04% in Florianópolis, South region, to 1.0% in São Luis, 

Northeast region. In Rio de Janeiro, Southeast region, the seroprevalence is 0.47%. 

However, the prevalence of this infection in general population is largely unknown. 

The aim of this study was to evaluate the seroprevalence of HTLV-1/2 infection in Rio 

de Janeiro population and the association with the presence of antibodies to HCV and 

HIV virus, all of them transmitted by sexual or blood contact. 

Methods: We analyzed 27.308 samples from the laboratory routine with medical 

request for HTLV serology from Jun 2010 to Jun 2012. It was also evaluated the 

presence of anti-HCV in 23.118 samples and anti-HIV antibodies in 23.939 samples. 

The mean age of individuals was 37 years (2-97 years).19.897 (72.90%) and 7.395 

(27.10%) of individuals were female and male respectively. The antibodies detections 

were performed using the immunoassays: Abbott Architect rHTLV-I/II, Abbott 

Architect anti-HCV, Johnson Vitros anti-HCV, Roche Modular anti-HCV, Abbott 

Architect HIV Ag/Ab Combo and Roche Modular anti-HIV Combi. 

Results: 243 (0.89%) individuals were positive for HTLV antibody, 174 (0.87%) 

female and 69 (0.93%). There was no significant difference related to gender (p=0.66) 

and the positivity increase according to age as has been pointed in the literature. 

Anti-HCV was positive in 163 (0.71%) samples and anti-HIV in 421 (1.75%) in 

this population. 11 (6.75%) samples were positive for both, anti-HTLV and anti- 

HCV (p250 IU/mL, a 1:2500 onboard 

dilution must be performed. In sample with high concentration of HBsAg, further 

off-line manual dilution of the prediluted sample may be needed to achieve results 

within the measuring range. 

In this study, the limit of blank (LOB; analytical sensitivity), limit of detection 

(LOD), and limit of quantitation (LOQ) were determined as described in the CLSI 

EP17-A guideline. Linearity was evaluated by diluting HBsAg-positive pool spiked 

samples into negative pool. Precision was determined according to the CLSI EP5-A2 

protocol: two runs/day for 20 days. The WHO 2 nd International Standard 00/588 was 

diluted from 66 IU/mL to 0.010 IU/mL and assayed to verify the standardization of 

the QHBsII assay. Expected values were established by testing 472 HBsAg patient 

samples on the ADVIA Centaur systems. Mutant HBsAg samples were diluted to low 

concentration and evaluated for quantitation. Samples from potential cross-reactive 

and therapeutic drug interference were evaluated. 

Results: The QHBsII assay gave LOB and LOD values of 0.008 IU/mL and 0.020 

IU/mL, respectively. The % total analytical error (TAE) was determined to be 27.7%, 

thereby allowing the test concentration of 0.050 IU/mL to be the LOQ. On the ADVIA 

Centaur system, the QHBsII assay is linear from 0.020-250 IU/mL, with R value of 

0.9995. In a 20-day precision study, the QHBsII assay had within-run and total % CVs 

of less than 9.1% and 14%, respectively, over the assay range. The QHBsII assay is 

standardized to WHO 2 nd International Standard 00/588. A comparison over the range 

of 0-66 IUI/mL gave the following correlation: 

ADVIA Centaur Quantitative HBsII = 1.0257 (WHO) + 0.0697 IU/mL; r = 1 

For the HBsAg-positive samples, the observed concentration ranged from 10 to



B-123 

First Report on identification of plasmid mediated quinolone resistance 

genes in E. coli and K. pneumoniae strains from Pakistan 

M. Faiz 1 , S. Rafique 2 , H. Batool 2 , A. Younis 2 , F. Anwar 3 , T. Bashir 1 , A. 

Shahid 1 . 1 Institute of Nuclear Medicine and Oncology, Lahore, Pakistan, 

2 

Kinnaird college for Women, Lahore, Pakistan, 3 University of Lahore, 

Lahore, Pakistan 

Background: Multidrug resistance in Enterobacteriaceae including resistance 

to quinolones is rising worldwide and complicating the treatment of serious 

nosocomial infections. Resistance to quinolones in Enterobacteriaceae is classically 

chromosomally mediated. However, most commonly it arises stepwise as a result 

of mutation usually accumulating in the genes encoding primarily DNA gyrase or 

changes in the expression of outer membrane and efflux pumps. Several recent studies 

have indicated that plasmid-mediated resistance mechanisms also play a significant 

role in fluoroquinolone resistance, and its prevalence is increasing worldwide . Now 

quinolone resistance determinants (qnrA, qnrB, qnrC and qnrS) have been identified 

in a series of enterobacterial species from the United States, Europe, Japan and 

Near and Far East. In Pakistan, the presence of the qnr gene in the clinical isolates 

of Enterobacteriaceae has not been reported. Objectives: This study, therefore aimed 

to investigate the presence of the qnr gene in clinical isolates of E. coli and K. 

pneumoniae from Pakistan. 

Methods: A total of one hundred fifty, non-repetitive, ciprofloxacin resistant E. coli 

(n=110) and K. pneumoniae strains (n=40) were isolated from urinary specimens 

of patients from January 2010 to October 2010 using standard microbiological 

techniques. Minimal inhibitory concentrations (MICs) of the antibiotics were 

determined according to the Clinical and Laboratory Standards Institute (CLSI). 

Screening of qnrA, qnrB, and qnrS by was performed by polymerase chain reaction 

(PCR) amplification. 

Results: PCR amplification of Qnr gene in 110 E. coli isolates and 40 K. pneumonia 

isolates was performed. qnr gene was detected in 11% (17 out of 150) strains tested. 

In E.coli, qnrB gene was detected in 6 out of 110 strains (6%). No qnrA, qnrS or 

both were identified in any of the strains. Similarly 11 out of 40 (28%) Klebsiella 

isolates had qnr genes where 7 (64%) samples showed qnrB, 3 (27%) qnrS and 1 

(9%) showed both qnrS and qnrB while none showed qnrA (Figure). In both E.coli 

and Klebsiella sp, none of the strains showed qnrA or qnrA and qnrB both. Plasmid 

transfer was achieved in Klebsiella K-1 strain. MICs of ciprofloxacin for qnrB 

positive transformants range from 8-16μg/ml than recipient strains. 

Conclusion: In conclusion, this study constitutes the first report on the identification 

of qnr-like determinants in Enterobacteriaceae from Pakistan. Further studies are 

needed to document the prevalence of qnr in larger number of samples as well as role 

of chromosomally-mediated or/ other mechanisms of resistance towards quinolone 

resistance. 

B-124 

Molecular characterization of clinical isolates of Carbapenemase 

producer Klebsiella pneumoniae (KPC) resistant to polimyxin in a 

Hospital in São Paulo, Brazil 

E. K. Gumpl 1 , R. C. M. Cabral 1 , J. Monteiro 2 , C. R. L. Fonsceca 3 , O. V. P. 

Denardin 3 , A. C. C. Pignatari 3 . 1 UNIFESP, SÃO PAULO, Brazil, 2 Unifesp, 

SÃO PAULO, Brazil, 3 DASA, SÃO PAULO, Brazil 

Background: Polimyxin is one of the few remaining options for treatment of KPC, 

a multiresistant opportunistic pathogen, responsible for nosocomial infections with 

high morbidity and mortality. Recently, isolates of KPC resistant to polimyxin have 

been described in the course of treatment with this antibiotic. The aim of the study 

was to molecular characterize isolates resistant to polimyxin from patients admitted to 

a hospital of São Paulo, Brazil. 

Methods: From July 2011 to March 2012, 21 clinical isolates of Klebsiella 

pneumoniae resistant to the carbapenem ertapenem , were identified by the automated 

system Vitek2 (BioMerieux) in the clinical microbiology laboratory of a 300-beds 

general private hospital. The isolates were tried for carbapenem resistance by the 

Hodge modified test and for the presence of the blaKPC gene by polimerase chain 

reaction (PCR). Resistance to polimixin was confirmed by broth microdilution. 

The isolates were molecular typed by Pulsed Field Gel Electrophoresis (PFGE) and 

Multilocus Sequence Typing (MLST). 

Results: All 21 ertapenem resistant isolates were positive by the modified Hodge Test 

and for blaKPC. Nine out of these 21 isolates were resistant to polimyxin (42%). The 

PFGE analysis revealed 6 different clonal profiles. The clone “A” was observed in 

76.2% (16) of the isolates, and the clones “B”, “C”, “D”, “E” e “F” were found in only 

one isolate each. Eight of the 9 isolates resistant to polimixin were classified in the 

clone “A”. The MLST was done only for clone “A” isolates showing sequence type 

11 e 437 (only one allele difference). 

Conclusion: The molecular techniques were useful to identify the persistence of the 

same clonal profile of KPC in a period of 9 months in clinical isolates obtained from 

patients admitted to the hospital, and also the emergence of polimixin resistant strains. 

These data are important to better understand and to control the dissemination of these 

multiresistant microorganism in hospitalized patients. 

B-125 

Metabolic Disorders Associated to HIV/AIDS Infection and Treatment 

in Ceará, Brazil 

C. M. M. PONTE 1 , M. G. CASTELO 1 , G. A. PONTE 2 , R. M. 

MONTENEGRO JR 3 , P. M. PONTE 3 , M. O. GOMES 4 , T. J. P. G. 

BANDEIRA 4 , I. V. ROCHA 4 , O. FERNANDES 5 . 1 

UFC; DASA, 

FORTALEZA, Brazil, 2 

HSJ-SESA, FORTALEZA, Brazil, 3 

UFC, 

FORTALEZA, Brazil, 4 DASA, FORTALEZA, Brazil, 5 DASA, SÃO PAULO, 

Brazil 

Background: After the advent of antiretroviral therapy (ART), HIV/AIDS patients 

have been observed to develop a chronic-degenerative profile characterized by the 

presence of several endocrine and metabolic disorders such as metabolic syndrome, 

type 2 diabetes mellitus (DM2), dyslipidemia and lipodystrophy, conditions known 

to be associated with increased cardiovascular risk. Moreover, it is recognized that 

HIV itself plays a significant role in the emergence of these changes. The aim of this 

study was to determine the prevalence of metabolic disorders in patients with HIV / 

AIDS followed at Hospital São José, considered a reference center for the treatment 

of this condition. 

Methods: We conducted a cross-sectional study which included 144 patients treated 

in outpatient program for HIV / AIDS among the months from January to May 2010, 

selected sequentially. For the control group were randomly selected 95 patients 

without HIV infection. Patients underwent medical evaluation, physical examination, 

meansurement of waist circumference (WC) and collection of blood samples fasting 

in the morning, for determination of glucose, insulin, total cholesterol, high density 

lipoprotein (HDL), triglycerides, lymphocyte count CD4 and viral load HIV. We 

calculated the HOMA-IR to infer the insulin resistance and cardiovascular risk was 

estimated by the Framingham Risk Score. Data were subjected to statistical analysis, 

being used for this purpose, the program StataTM, version 9.1. In data analysis, we 

used the Student t test, Mann-Whitney, Spearman’s linear correlation, chi-square test, 

Fisher exact test and Mantel-Haenszel X2, with statistical significance level of 5% 

(p



B-126 

Phenotypic (VITEK2 System) and genotypic characterization of 

Burkholderia pseudomallei strains isolated in Brazil. 

T. J. P. G. BANDEIRA 1 , M. G. CASTELO 2 , C. M. M. PONTE 2 , L. M. O. 

PONTE 1 , E. T. OLIVEIRA 1 , F. P. VENTURA 1 , L. G. A. VALENTE 1 , V. P. 

G. WIRTZBIKI 3 , F. B. SAMPAIO 3 , C. S. P. ARAUJO 3 , T. T. LEITE 4 , G. P. 

G. WIRTZBIKI 3 , O. FERNANDES 5 . 1 DASA, FORTALEZA, Brazil, 2 UFC; 

DASA, FORTALEZA, Brazil, 3 FACULDADE DE MEDICINA CHRISTUS, 

FORTALEZA, Brazil, 4 SESA, FORTALEZA, Brazil, 5 DASA, SAO PAULO, 

Brazil 

Melioidosis is a serious infectious disease caused by Burkholderia pseudomallei. The 

disease is endemic in Southeastern Asia and hyperendemic in Northern Australia. 

In Brazil, it is considered an emerging disease, since April 2003, when it was first 

diagnosed in Ceara, Northeastern Brazil. In the last eight years, thirteen cases were 

reported. Considering the occurrence of melioidosis in Ceara, this work aimed at 

studying these clinical and environmental strains of Burkholderia pseudomallei 

isolated from Ceara from 2003 to 2011, focusing on phenotypic and molecular 

identification. 

Genotyping was performed through Random Amplified Polymorphic DNA (RAPD). 

The primers used were: OPQ-16 (AGTGCAGCCA), OPQ-4(AGTGCGCTGA) and 

OPQ-2 (TCTGCTGGTC). RAPD-PCR showed a genetic relatedness of 63% among 

the B. pseudomallei strains from the State of Ceará, which were grouped in two 

different clusters. The environmental strains isolated in Tejuçuoca were grouped in 

a single cluster along with the clinical strains isolated from the same municipality. 

Six of our clinical strains were isolated from fatal cases of melioidosis, of which four 

were grouped in cluster II. Leelayuwat et al. (2000) observed a significant association 

of determined RAPD patterns of B. pseudomallei strains with the occurrence of 

septicemic melioidosis without an association with lethality. In the present study, we 

observed an association of determined RAPD patterns with the septicemic form of 

melioidosis (cases in cluster II) and with fatal outcomes [17]. All 20 strains from B. 

pseudomallei were accurately identified by both VITEK2 ® and sequencing of the 

16S DNA with 100% of agreement. The assimilation of L-arabinose was also used 

whose negative result had confirmed the identification of strains as B. pseudomallei. 

This study will contribute to the clinical-epidemiological characterization of 

melioidosis in the State of Ceara and to the awareness of the competent health 

departments to include the state as an endemic zone for the disease. 

B-127 

Respiratory virus frequency in Brazilian samples in 2012. 

M. Gimenez, C. Ceabra, A. Alfieri, L. Scarpelli, O. Denardin, N. Gaburo. 


Background: The Respiratory virus infection is one of the most important causes of 

childhood respiratory diseases. Data describing the most common agents among the 

Brazilian population using molecular biology techniques for a large variety of agents 

is scarce. 

Objective: The aim of this study was to determine the frequency of respiratory 

virus in Brazilian samples collected from January to December 2012 using CLART 

® Pneumovir (Genomica, Madri, Spain), method that simultaneously detects 18 

different respiratory viruses (RV) using microarray technology. 

Methods: We processed 510 samples of nasopharyngeal, secretions from children 

and adult population at DASA’s Department of Molecular Biology. Viral RNA and 

DNA was isolated and processed with CLART Pneumovir This test is based on RT- 

PCR reaction follow by detection through a low density microarray platform, and 

detects the following agents: Adenovirus, Bocavirus, Coronavirus, Enterovirus, 

Influenza virus A (human H3N2 and H1N1 2009), B, and C, Metapneumovirus A and 

B, Parainfluenza virus 1, 2, 3, and 4, Rhinovirus, Respiratory Syncitial Virus A and B. 

Results: Frequency of single or multiple infections are described on Table 1 according 

with age group). 

Age group 

(years) 

N. of 

patients 

Not 

detected 

(%) 

Single 

infection 

(%) 

Multiple 

infection 

(%) 

Virus more 

frequent 

Parainfluenza 

virus 3 

1) less than 1 169 29 54 17 

2) 1 to 14 251 26 43 31 Adenovirus 

3) older than 

14 

90 68 30 2 Rhinonvírus 

Total 510 34 45 21 

Conclusion: Using technologies that allows simultaneous detection of many agents 

lead to better understanding of the most common agents. Infection by two or more 

agents was quite common and represented 30% of all samples with detectable results. 

Multiple infections were more common among children. 

B-129 

Diagnostic value of procalcitonin and follow-up treatment in septic 

patients in Vietnam. 

L. X. Truong 1 , B. T. H. Chau 2 , N. T. B. Suong 2 . 1 Chief of Biochemistry 

Department, University of Medicine and Pharmacy, Hochiminh City, Viet 

Nam, 2 Biochemistry Department, University of Medicine and Pharmacy, 

Hochiminh City, Viet Nam 

Background: Sepsis is serious illness, and its prevalence is still increasing during 

30 years. 

Objective: To confirm diagnostic value of procalcitonin (PCT) and follow-up 

treatment in sepsis by the kinetic of PCT with white blood cell (WBC) and CRP test. 

Method: Estimate similarity of WBC and CRP with serum PCT concentration on four 

groups, group 1 include 30 healthy volunteers (n=30), group 2 have 40 dengue fever 

patients (n=40), group 3 have 70 patients have illness with is similar to infection but 

non sepsis (n=70), group 4 include 100 septic patients with positive blood cultures 

(n=100). 

Results: Mean value of serum PCT in group 1 was 0.08ng/ml (0.06-0.27), group 

2 was 0.19ng/ml (0.07-1.87), group 3 was 0.20ng/ml (0.11-6.34) and group 4 was 

7.94ng/ml (0.10-488.00). The best cut-off point to distinguish between septic patients 

(group 4) and patients had infection but not sepsis (group 3) for PCT was 1.91ng/ml, 

CRP was 33mg/L, WBC was 13475/mm 3 . At patients of group 4 who responded well 

to treatment, mean value of PCT before antibiotic treatment was 7.13ng/ml (0.20- 

122.50), after 2 days of antibiotic treatment was 1.23 ng/ml (0.12-50.00), and after 6 

days of antibiotic treatment was 0.35ng/ml (0.07-13.47). So, there are differences in 

PCT levels between groups (p



B-133 

Ideal flow suggestion on determination of anti - T. cruzi IgG class 

antibodies (Chagas disease) among CMIA and ELISA methods in 

laboratorial context 

M. F. Mantovani 1 , L. G. S. Carvalho 1 , E. A. Pante 2 , N. L. R. Junior 1 , C. F. A. 

Pereira 3 . 1 Álvaro Center for Analysis and Clinical Research – Diagnósticos 

da América (DASA), Cascavel, Brazil, 2 Faculdade Assis Gurgacz - FAG, 

Cascavel, Brazil, 3 Diagnósticos da América (DASA), São Paulo, Brazil 

Background: Chagas is an infecto-contagious disease that affects America from 

the southern United States to Chile and Argentina, this infection made by the 

haemoprotozoan Trypanosoma cruzi, in its chronic phase has essentially serological 

diagnosis and should be tested using a high sensitivity test, and, positives samples, 

confirmed by another methodology with high specificity for determining the diagnostic. 

Currently the methodologies used for this research are enzyme immunoassays 

(ELISA), indirect immunofluorescence (IIF), indirect hemagglutination (IHA) and 

chemiluminescence microparticle immunoassay (CMIA). 

Objective: In a random study CMIA and ELISA serological assay methods were 

applied, for determining, inside lab routine, which flow is the best between both 

methods on diagnostic determination of IgG antibodies on Chagas disease. 

Methods: During one month, 8,520 random samples from Laboratory Alvaro – 

Center of Analysis and Clinical Research were tested with CMIA (Chagas Architect 

®, Abbott) and ELISA (Gold ELISA Chagas® REM Industry and Trade LTDA). Tests 

were performed following the manufacturer’s instructions and evaluated together with 

internal control for each kit used. 

Results: When tested by CMIA the 8,520 samples showed 7,288 no reactive results, 

12 inconclusive and 1,220 reactive. In the same samples, when tested by ELISA, 

7,314 no reactive results were observed, 07 inconclusive and 1,199 reactive. 

In the result analysis from CMIA/ELISA methods 35 (0.41%) results were 

discrepant with, respectively, 01 result inconclusive/reactive, 11 results inconclusive/ 

nonreactive, 06 results reactive/inconclusive, 16 results reactive/nonreactive and 01 

result nonreactive/inconclusive. 

The flow CMIA as initial test and confirmatory screening by ELISA, for the nonreactive 

results, eliminates the need to retest because the flow showed a CMIA 

confirmation of 99.99%. We also observed 99.92% sensitivity for reactive samples, 

with this flow. Regarding the reverse flow, the ELISA assay showed 99.44% of 

assertiveness for non-reactive results and sensitivity of 97.81%. 

Conclusion: Thus, we conclude that using the CMIA test in the initial screening we 

have the best process flow, because if they get greater sensitivity in detecting reactive 

samples and reduced to 0.013% chance of releasing a false negative result when 

confirmed by ELISA. 

of SHP-1 and SHP-2 phosphatases, which attenuate tyrosine kinases activated by 

TCR-Ag recognition. Blockage of coinhibitory molecules BTLA/HVEM pathway 

seems to be new ideas in preventing worse progress of HBV infection. 

Expression of Cosignal Molecules in different stages of patients with hepatitis B infection 

n CD28 ICOS LIGHT HVEM BTLA CD160 PD-1 

control 34 14(8,17) 10(7,17) 52(41,59) 40(18,74) 30(14,42) 6(3,9) 6(5,8) 

CHB 33 15(9,18) 10(8,16) 48(30,59) 31(9,62) 22(11,32) 7(4,11) 4(2,6) 

LC 31 12(7,16) 12(5,18) 50(47,59) 94(46,99)* 57(18,66)* 3(2,6)* 9(4,9)* 

HCC 30 13(7,18) 11(6,18) 54(41,62) 75(30,87)# 52(16,63)# 6(3,9) 8(5,10)# 

* LC vs CHB: P



B-137 

Frequency of Mycoplasma pneumoniae Complement Fixation IgM in 

a Healthy, Adult Population 

B. Kiehl 1 , S. Jeansson 2 . 1 GenBio, San Diego, CA, 2 Oslo University Hospital, 

Oslo, Norway 

Mycoplasma pneumoniae is the causative agent of atypical pneumonia. Serological 

diagnosis detecting antibodies to either an immunodominant membrane protein or 

the complement fixing lipid antigen is often used. These Mycoplasma antibodies are 

cross-reactive with other Mycoplasma species, so clinical interpretation is made using 

a clinical cutoff. The clinical cutoff of ImmunoWELL Mycoplasma Pneumoniae 

IgM Test, using a purified CF antigen, is evaluated using presumptively healthy U.S. 

blood donors. 

Materials and Methods: Fourteen hundred twenty-six (1426) sera collected from 

potential U.S. blood donors collected at centers located thirteen states is tested. Tests 

are performed using ImmunoWELL Mycoplasma Pneumoniae IgM Test following 

package insert instructions. 

Results: Figure 1 illustrates specific antibody distribution in a U.S. healthy, adult 

population. 

Summary: The 95 th percentile (736 to 917 units/mL) is consistent with 

ImmunoWELL’s 950 units/mL clinical cutoff. The 75 th percentile is 295-319 units/ 

mL. 

Figure 1 

Methods: This study used a response surface design (central composite - two-level 

full factorial) to optimize annealing temperature (55 to 65°C), denaturation time (3 

to 15s) and Reverse Transcription (RT) time (900 to 1800s) for a RT-PCR reaction 

used to detect RNA/DNA targets isolated from clinical specimens. A pool of negative 

nasopharyngeal (NP) swabs in UTM, spiked with all targets of the assay, was 

processed on the BD MAX System with the BD MAX ExK TNA-3* reagents. 

The model assay consisted of an RNA target (chimeric virus containing a Hepatitis 

C virus [HCV] sequence) and a DNA target (Adenovirus [AdV]). A Specimen 

Processing Control (SPC) consisting of an armored RNA sequence incorporated into 

the extraction reagents, was co-processed to control for extraction efficiency, reagent 

integrity and PCR inhibition by the sample. 

Results: Results indicated that the annealing temperature was the most critical factor 

for optimizing both the Cycle Threshold (Ct) and the End Point fluorescence (EP) 

of all targets in this particular assay. Its effect was the same on the SPC, AdV and 

HCV, so the selection of the temperature was based on a tradeoff between optimizing 

Ct and/or EP, and on the potential impact on the test sensitivity. RT time influenced 

DNA and RNA targets differently. With a longer RT, SPC and HCV showed earlier 

Ct values while the EP for HCV and AdV decreased. The optimizer tool suggested an 

optimum for all targets. Denaturation time appeared to be slightly influential on the 

SPC Ct values. 

Conclusions: This study demonstrates that it is possible to precisely optimize 

multiple factors at a time for at least 3 targets at once on the BD MAX System. This 

type of DOE analysis can allow users to determine optimal conditions for any specific 

user defined protocol on the BD MAX System, and for a variety of factors including 

primers and probes concentrations, lysis temperature and enzyme concentration, 

among others. 

*The BD MAX ExK TNA-3 and BD MAX TNA MMK are not available for 

sale or use. 

B-139 

Evaluation of the Risk of RNase Contamination During Total Nucleic 

Acid Extraction from Clinical Samples using the BD MAX System 

D. Dugourd 1 , D. Beaulieu 1 , J. Cormier 1 , P. Larouche 1 , B. Leclerc 1 , J. A. 

Price 2 , D. Fox 2 , V. Jean 1 , S. Champetier 1 , J. Pinard-Lachapelle 1 , C. Lippé 1 , 

C. Ménard 1 , C. Roger-Dalbert 1 . 1 BD Diagnostics, Quebec, QC, Canada, 

2 

BD Diagnostics, Baltimore, MD 

B-138 

Optimization Scheme of a Multiplex Reaction for RNA/DNA Targets 

on a Microfluidic-based Real-time PCR Platform 

C. Lippé, D. Dugourd, P. Larouche, B. Leclerc, V. Jean, S. Champetier, 

D. Beaulieu, J. Pinard-Lachapelle, J. Cormier, S. Morasse, C. Ménard, C. 

Roger-Dalbert. BD Diagnostics, Quebec, QC, Canada 


molecular testing platform. The new BD MAX TNA (for Total Nucleic Acid) suite, 

part of the Open System Reagent (OSR) series, combines specimen-specific extraction 

kits (ExK for swabs in Universal Transport Medium (UTM), stool or cerebrospinal 

fluid (CSF)) and universal PCR reagents (MMK*). The TNA suite allows users to 


specimen with their own user defined protocols. Users can select specimen volume, 

and individually program thermocycling and analysis parameters. The objective 

of this study was to demonstrate the process and possibilities of optimization for 

multiplex thermocycling conditions based on a Design of Experiment (DOE). 




extraction reagents (ExK) and universal PCR reagents (MMK) allowing users to 


specimen with their own user defined protocols. The objective of this study was to 

evaluate the risk of RNase carryover during major steps of TNA extraction, and also 

during the processing of the MMK reagents, where a RNase inhibitor is integrated. 

Methods: Sample processing of nasal or nasopharyngeal swabs in UTM was 

performed in the BD MAX system using BD MAX ExK TNA-2 or ExK 

TNA-3 and ExK DNase reagents*. RNase activity was measured at each major 

step of sample preparation (i.e. addition of sample to TNA sample buffer, lysis, wash, 

DNAse treatment and elution/neutralization) using the RNaseAlert ® QC Systems 

reagent. Solutions of RNase A at concentrations ranging from 0.1 ng to 1 ng per 

sample were included as positive controls. Endpoint fluorescence values (Tecan) were 

used to determine the presence of RNase in samples tested. 

Results: All clinical specimens tested, especially nasopharyngeal swabs in UTM, 

showed high levels of RNase prior to sample processing. When these samples were 

initially mixed with the BD MAX ExK TNA-3 and ExK TNA-2 sample 

buffers, no RNase activity was detected. Similarly, no RNase activity was detected 

at the lysis, DNase, or wash steps. Finally, minimal to no activity was detected in 

the eluted sample when mixed with the TNA primer and probe diluent. Data further 

demonstrate that the MMK reagents, containing a RNase inhibitor, can inactivate/ 

inhibit at least 0.5 ng of RNase A. 

Conclusion: The BD MAX ExK TNA-3 and ExK TNA-2 reagents enrich 

TNA while removing/neutralizing RNases found in clinical samples during lysis, 

DNase, wash, and elution steps as well as control for RNases that might reach the 

MMK reagents by the use of a RNase inhibitor. 

*The BD MAX ExK TNA-3, ExK TNA-2, ExK DNase, and TNA MMK are 

not available for sale or use. 




B-140 

Detection of rs12979860 polymorphism in the Interleukin-28B gene by 

a 5’Nuclease Real Time PCR assay 

C. G. Rasuck, F. S. Malta, V. C. Oliveira, F. d. Caxito. Hermes Pardini, 

Vespasinao, Brazil 

Background: The chronic Hepatitis C virus infection affects 170 million people all 

over the world and it is the main cause of cirrhosis and liver cancer. The treatment 

indicated for the genotype 1 (the most frequent) can last 48 weeks. The sustained 

virological response is achieved by 40 to 50% of the treated patients. Since the 

recommended treatment (interferon and ribavirin) presents potentially serious 

side effects, and the success rate is not high, researches are being conducted in 

predictors of drug response for a medical decision. The C/C genotype of rs12979860 

polymorphism has been associated to higher rates of sustained virological response 

and spontaneous viral clearance following acute infection caused by genotype 1. 

Therefore the knowledge of the polymorphism can help the decision to initiate or 

postpone the treatment. Our objective was to develop a real time PCR based method 

to identify rs12979860 polymorphism in the Interleukin-28B gene. 

Methods: A 5’Nuclease PCR assay (probes and primers) have been designed using 

the Primer Express 3.0 software. The assay was tested comparing 40 control samples 

with the sequencing method. All of the possible genotypes were tested and analyzed 

by the software clustering algorithm. 

Results: The 5’Nuclease PCR assay was 100% concordant with the sequencing 

method. All of the genotypes presented a caracteristic pattern which could be 

recognized by the software clustering algorithm. 

Conclusion: The 5’Nuclease PCR assay is a fast and efficient method to identify the 

rs12979860 polymorphism on IL28B gene and can be used to help doctor’s decision 

regarding treatment of Hepatitis C virus infection. 

B-141 

Comparison between an in-house method and the commercial 

Entherpex® kit for herpes virus detection 

V. Niewiadonski, F. Oliveira, P. Macedo, P. Trojano, N. Gaburo. DASA, 

Sao Paulo, Brazil 

Background: The diagnosis of opportunistic infections is extremely important in 

immunosuppressed patients. The herpes virus infection can take a life threatening 

course in this group of individuals. In healthy population the herpes virus can cause 

meningitis, among other disorders. 

Objective: Compare the results agreement of two methods for herpes virus. 

Method: A total of 313 samples of DNA and RNA from blood, plasma, cerebrospinal 

fluid and bronchoalveolar washing fluid were tested in the in-house method and in the 

Entherpex commercial kit (Genomica, Madrid, Spain) for cytomegalovirus, Epstein- 

Barr virus, herpes simplex 1 and 2, herpes 6, varicella zoster and enterovirus. The real 

time PCR takes one reaction for each virus tested using Taqman as detection system. 

The tests were performed at ABI SDS 7500 Real Time PCR System platform. The 

Entherpex kit detects 8 viruses simultaneously by RT-PCR followed by low density 

microarray. The results of both methods were analyzed as qualitative results (detected/ 

not detected). 

Results: The results found are described in Table 1. 

Table 1. Results of herpes virus detection in Entherpex and in-house methodology 

Total of Positive Test (in Positive Test % concordant 

Virus 

sample tested house method) (commercial method) results 

Cytomegalovirus 136 27 32 92,65 

Enterovirus 23 1 0 95,65 

Herpes 1 and 2 72 6 4 97,22 

Epstein-Barr virus 56 19 22 85,71 

Herpes 6 17 3 3 100,00 

Varicella zoster 9 0 0 100,00 

The disagreements may occur due degraded DNA/RNA, differences between 

the detection limits of methods compared or, regarding to the commercial kit, due 

competition when more than one virus was present. 

Conclusion: The study showed a good agreement between both methods tested; 

whereas the in-house method detects the individual target and the commercial method 

simultaneously detects multiple targets. 

B-142 

Prevalence of Clostridium difficile by enzyme immunoassay for the 

detection of toxin A and B or by polymerase chain reaction in patients 

admitted to private hospitals in Brazil 

M. L. N. Figuieredo, C. Rodrigues, L. B. Faro, O. V. P. Denardin, A. C. C. 

Pignatari. DASA, SÃO PAULO, Brazil 

Background: Clostridium difficile infection is the most important cause of 

antimicrobial-associated diarrhea and is a common health care-associated 

pathogen. Clinical symptoms vary widely, from asymptomatic colonization to 

pseudomembranous colitis with bloody diarrhea, fever, and severe abdominal pain. 

Patients who have been treated with broad spectrum antibiotics, the elderly and those 

with serious underlying disease are at major risk to develop the infection by this 

anaerobic bacterium. The laboratory diagnosis is usually provided by the detection of 

Clostridium difficile toxin A and B in stool. 

Methods: 5119 samples of anal swabs were collected at 38 private Brazilian hospitals 

and submitted to enzyme immunoassay (EIA- Prospect- Remel®) for the detection of 

toxin A and B or polymerase chain reaction (Xpert-Cepheid®) to investigate infection 

by Clostridium diffi cile. The epidemiological data were collected by the laboratory 

system Motion ®. 

Results: EIA and PCR for Clostridium diffi cile were positive on 249 samples (4.86%). 

Among the positive anal swabs, 154 (61.84%) were obtained from female and 95 

(38.15%) from male patients. The majority of positive samples (n=117) were from 

patients over 70 years old (46.98%). From the pediatric population, 1-4 years old 

infants showed the largest positivity, 7 samples (2.81%). 302 samples were tested by 

PCR, 29 (9.6%) were positive and 4 (1.32%) were inconclusive. 4817 samples were 

tested by EIA and only 220 (4.56%) were positive for toxin A and B. 

Conclusion: Our data show that Clostridium diffi cile infection was present in 4.86% 

of all patients admitted to private Brazilian hospitals. PCR methodology present 

a higher sensitivity comparing with EIA test (9.6% and 4.56%, respectively), as 

described in literature. This data is important for encouraging physicians to use PCR 

instead of EIA although its cost difference. Cost/ benefit studies utilizing the PCR test 

are warranted. 

B-143 

Prevalence of Respiratory Viral Infection Detected by Molecular Test 

in a Children’s Hospital in São Paulo, Brazil 

L. Almeida, L. B. Faro, A. C. C. Pignatari, O. Fernandes, H. Ionemoto, 

A. Lopes, A. Bousso, R. B. Ruivo, M. L. Garcia, N. Gaburo. DASA, SÃO 

PAULO, Brazil 

Background: Respiratory tract infection is the leading cause of hospitalization 

of infants and young children. Viruses are recognized as the major cause of these 

infections and are usually suspected in clinical practice. However, the etiologic 

diagnosis depends on the laboratory tests to detect a specific virus. Respiratory 

diseases due virus are traditionally diagnosed by Direct Immunofluorescense (DIF) 

and cell culture, that are time consuming and are routinely available only for the more 

prevalent virus. Emerging pathogens are not detected by these techniques. Molecular 

biology techniques for diagnosis of respiratory viral infection have been recently 

applied with high sensitivity and specificity allowing the detection of a panel of virus 

simultaneously, including genetic diversity of the same virus. 

Methods: From october to december 2012 a new molecular virus respiratory panel 

(RT-PCR Microarray: CLART® Pneumovir), that simultaneously detect different 

respiratory virus, was introduced in the diagnosis routine at a Children´s Hospital 

in the city of São Paulo, Brazil. The molecular biology panel detects Influenza A, 

Influenza A H1N1 strain 2009, Influenza B, Parainfluenza1, 2 and 3, Syncytial 

Respiratory Virus (RSV), Adenovirus, Bocavirus, Metapneumovirus, Coronavirus, 

Enterovirus and Rhinovirus. We evaluated the virus prevalence in 282 tests performed. 

Results: 282 respiratory samples, only one for each patient, were submitted to virus 

detection by the molecular panel. The prevalence observed was 18% for Parainfluenza 

3, 17% Adenovirus, 16% Bocavirus, 15% Rhinovirus, 8% Enterovirus, 1,4% Influenza 

C, 1,4% Parainfluenza 1, 1% RSV, 0,7% Influenza A, and 0,30% for Coronavirus 

Conclusion: The molecular panel detected a wide range of respiratory virus, including 

Bocavirus, Metapneumovirus, Enterovirus and Coronavirus that are not included 

in the DIF test . The early and precise identification of these virus is of paramount 

relevance on clinical practice and on nosocomial infection control measures at the 

hospital. This prevalence should be reevaluated at different seasons and in occasional 

outbreaks. 


A211



B-144 

Frequency of mycobacterial species in Brazilian samples 

P. Trojano, F. Oliveira, F. Gandufe, O. Denardin, N. Gaburo. DASA, Sao 

Paulo Brasil, Brazil 

Background: Many mycobacterial species are pathogenic to humans, with infections 

occurring worldwide, such as Mycobacterium tuberculosis, the main specie responsible 

for causing tuberculosis. Other mycobacterial species are increasingly shown to be the 

cause of pulmonary and extra-pulmonary infection and are managed differently from 

M. tuberculosis infection. Rapid and accurate differentiation of mycobacterial species 

is, therefore, critical to guide timely and appropriate therapeutic and public health 

management. 

Objective: The aim of this study is to describe the frequency of mycobacterial species 

in Brazilian samples from January 2011 to December 2012. 

Methods: We evaluated 89 samples from patients with clinical suspect of 

mycobacterium infection. The samples had mycobacteria isolated by culture. The 

DNA was isolated by heating the sample at 100ºC for 30 minutes in order to break the 

cell wall and release the genetic material. A polymerase chain reaction was performed 

and followed by a direct sequencing reaction. The result sequence was submitted to 

an internal database and a comparison with reference sequences was made through an 

alignment searching tool online (blast.ncbi.nlm.nih.gov/Em cache) in order to confirm 

the result found. 

Results: We found that M. tuberculosis was present in 36 (40,5%) samples and M. 

fortuitum in 11 samples (12,4%). Other Mycobacterium species were identified in 

minor frequency such as M. massiliense - 7 samples (7,9%); M. kansasii - 6 samples 

(6,8%); M .intracellulare - 4 samples (4,5%); M. mucogenicum, M. chelonae, 

M. gordonae, - 3 samples (3,4%); M. neoaurum, Nocardia sp - 2 samples (2,3%) 

and Kitasatospora setae, M. avium, M. colombiense, M. senegalense, M.marinum, 

M.smegmatis, Propionibacterium acnes, Tsukamurella tyrosinosolvens - 1 sample 

(1,12%). Two samples showed co infection with different species: M. fortuitum/ 

M.smegmatis - 1 sample (1,12%) and M. lentifl avum/M. genavense - 1 sample 

(1,12%). Two samples had undetermined results due PCR inhibition. 

Conclusion: The most frequent mycobacterium specie found was M. tuberculosis in 

36 (40,5%) of the samples followed by M. fortuitum in 11 samples (12,4%). 

B-146 

Microbiological aspects of confirmed cases of peritonitis: improving 

culture results in peritoneal dialysis associated peritonitis along 3 

years. 

M. P. Campagnoli 1 , F. F. Tuon 2 , M. D. C. Freire 1 , J. L. Rocha 1 . 1 DASA, 

CURITIBA, Brazil, 2 Infectious and Parasitic Diseases, Hosp. Universitário 

Evangélico, CURITIBA, Brazil 

Background: Peritonitis is one of the most serious complications of peritoneal 

dialysis. Pathogenic bacteria cause the majority of cases of peritonitis. A broad 

spectrum of gram-positive, gram-negative microorganisms and fungi, are involved 

in this complication. In addition, a significant percentage of episodes involve 

polymicrobial and culture-negative infection. Fungal infection is rare but it is 

associated with high morbidity, the inability to continue on the dialysis program and 

important mortality. Despite improvements in connectology, peritoneal dialysis (PD)- 

associated peritonitis contributes significantly to failure in patients maintained on PD. 

Methods: The aim of this research is to evaluate the microbiological aspects of 

confirmed cases of peritonitis in a large central reference laboratory responsible to 

perform culture for 4 different PD centers. All positive results in the last 3 years where 

included for analysis. 

Results: From January 2010 to March 2012, the total number of samples submitted 

for laboratorial analysis was 197 and 60 showed to be positive cultures (30.5%). A 

large volume culture and precisely sediment culturing of 50 mL effluent was the 

current technique at the beginning of the study and we found 25.5% of positivity 

(n=37 of 145). Such technique was replaced after April 2012 to bedside inoculation 

of 5-10 mL effluent in two blood culture bottles, presenting 44% of positivity (n=23 

of 52). In both scenarios, the specimens should arrive within 6 h at the laboratory. 

There was a significant improvent in culture positivivity (p=0,019) Comparison of 

these 2 particular momments is presented on figure 1. Candida non-albicans was the 

microorganism with the highest prevalence if considering all Coagulase-negative 

Staphycocci as contaminants. In such scenario, false positives rates were 18,9% and 

21,7% in the different periods respectively. 

Conclusion: Specimen collection and culture techniques remain important issues 

that PD centers have to face. We identified better positivity results with bedside 

inoculation into blood culture bottles. 

B-145 

Epidemiologic study of patients with confirmed positive result for HIV 

between the years of 2008 to 2012 

P. S. Osorio 1 , M. F. Mantovani 1 , L. G. S. Carvalho 1 , M. Freire 2 , F. Sandrini 1 . 

1 

DASA, CASCAVEL, Brazil, 2 DASA, Rio de Janeiro, Brazil 

Background:AIDS (acquired immunodeficiency syndrome) is a relatively new 

disease, caused by HIV, a virus that attacks the immune system, incurable, and that 

induce to prejudice, stigma and discrimination. In Brazil, since 1980, we have recorded 

608,320 cases of AIDS. The number of patients with HIV remained at average of 

30,000 new cases per year between 2008 and 2011, with a considerable decrease in 

2012 to 17,819 cases.Our objective was to assess the population characteristics and 

the results of patients in a large database of a clinical laboratory to which tests of 

detection of HIV were requested. 

Methods:Using the laboratory database we accessed the epidemiological 

characteristics of patients with confirmed positive result for HIV from 2008 to 2012. 

For the analysis we considered as a child (0-10 years), young (11-20 years), adult 

(21-50 years) and elderly (51-90 years). Results:We had a total of 52,920 registered 

exams, from all regions of the country, where 19,370 were positive for HIV. Through 

data analysis we can see an increased time trend to the number of test ordering, 

but there was a sudden decrease in the rate of positivity of these requests, and an 

increasing of cases of HIV disease in males, compared to females between 2011 and 

2012. We also noted a decrease of HIV positive cases in children, and in turn, an 

increase of positive cases in young and adults (Table 1). 

Conclusion:Our data are consistent with national data, showing that the prevention 

program is being done properly, with a large investment in prevention and awareness 

about this disease in Brazilian population. 




B-147 

Increased antimicrobial resistance with time in uropathogens from 

over 5,000 samples from the pediatric community of a large city as a 

function of age and sex. 

J. L. Rocha 1 , F. F. Tuon 2 , M. P. Campagnoli 1 , O. Fernandes 1 . 1 DASA, 

CURITIBA, Brazil, 2 Infectious and Parasitic Diseases, Hosp. Universitário 

Evangélico, CURITIBA, Brazil 

Background: Empirical therapy of urinary tract infection requires accurate 

knowledge of susceptibility. There is a hypothesis that increasing bacterial resistance 

to most commonly used drugs in the pediatric population is ongoing. 

Methods:Along 5 years, all samples from 35 collecting units, processed by single 

central laboratory were analysed. Exclusion criteria: fungus, mixed cultures, age 

below 12 years old, coagulase-negative Staphylococcus, hospital and urine cultures 

with counts lower than 105 CFU/mL. For ESBL-positive germs, manual confirmation 

with disk approximation in addition Vitek 2® was performed. 

Results: 371,972 urocultures were processed by the laboratory. 72,949 were positive 

(19.6%). 6,347 (8.7%) were included for analysis, 76.5% of them from girls. Girls 

were older than boys (4,3 versus 3,0 years old) (p 1% of the total sample. The data 

collected reveal E. coli with critically low but stable percentages of sensitivity to 

first generation cephalosporins and trimethoprim-sulfamethoxazole. Although the 

total resistance against quinolones is lower than 5%, there is a significant increment 

along the period (97,0% sensitivity in 2005 and 94,2% in 2010, p=0.02). There are 

better resistance profiles in children under 2 years old when compared with older 

children (p



B-150 

Comparison between Indirect Immunofluorescence Antibody (IFA) 

and dotblot enzyme immunoassay (EIA) methods to detect Coxiella 

burnetii (Q Fever) Phase I and II antibodies. 

C. M. Farris 1 , B. Kiehl 2 , J. Samuel 3 . 1 Viral and Rickettsial Diseases 

Department, Naval Medical Research Center, Silver Spring, MD, 2 GenBio, 

San Diego, CA, 3 Department of Microbial and Molecular Pathogenesis, 

College of Medicine, Texas A&M, Bryan, TX 

Coxiella burnetii is the causative agent of Q Fever, a world-wide zoonotic disease. 

Diagnosis of human disease is typically made using serology. Comparison between 

the indirect immunofluorescence antibody (IFA) and dot blot enzyme immunoassay 

(EIA) methods is reported. 

Materials and Methods: A commercial dotblot immunoassay, ImmunoDOT 

Coxiella Burnetii, was developed using a cell-free culture method to prepare purified 

phase I and II Coxiella burnetii antigens. IgG and IgM commercial IFA kits (Focus 

Diagnostics) and in-house prepared IFA tests are compared to the dotblot kit. Paired 

sera collected from thirty-eight (38) patients with symptomatology and laboratory 

results consistent with C. burnetii are tested. These serum pairs are part of a C. 

burnetii reference serum panel maintained by the university laboratory. Each of the 76 

specimens (38 serum pairs) is tested using the IFA tests detecting Phase I and II IgG or 

IgM. The 76 specimens are also tested using the ImmunoDOT Coxiella Burnetii test. 

Results: Sensitivity, based on paired serum interpretation is shown in Table 1. There 

is no significant difference (p=0.05, Chi-square, confidence limits based on Gart and 

Nam’s score method with skewness correction) between assay methods. 

Table 1: Sensitivity 

Method Phase 1 Phase 2 Combined 

EIA 67-91% 67-91% 67-91% 

Commercial IFA 61-87% 67-91% 70-93% 

In-house IFA 55-83% 55-83% 67-91% 

Summary: No significant difference between IFA and the dotblot is detected. In 

several cases, a second convalescent specimen is required for IFA sero-diagnosis 

while EIA reports a positive result using only a single, acute specimen. Presumably, 

phase I antigen purity improvement contributes to the added diagnostic utility. 


Proteins/Enzymes 


B-151 




Identification of Novel Inflammatory Biomarkers in the Early 

Diagnosis of Chronic Kidney Disease 

M. Summers, M. Browne, C. Ledgerwood, C. Richardson, R. I. McConnell, 

S. P. Fitzgerald. Randox Laboratories Limited, Crumlin, United Kingdom 

Introduction: Chronic Kidney Disease (CKD) can go undiagnosed due to its 

asymptomatic nature and is described as a progressive loss in renal function leading to 

end-stage renal failure and death. In order to classify patients with early CKD (Stage 

1), Modification of Diet in Renal Disease (MDRD) guidelines suggest an eGFR ≥ 90 

ml/min/1.73m2 (based on the measurement of serum creatinine), with other evidence 

of kidney disease (proteinuria, haematuria, kidney inflammation). The complexity in 

diagnosing a patient with CKD at an early stage of disease has led to most patients not 

receiving a diagnosis until the disease has progressed to an advanced stage. 

Relevance: There currently are no accepted methods for easily determining kidney 

disease at early stages. Inflammation plays a key role in the development and 

progression of CKD and identification of inflammatory markers in patients suspected 

of having CKD may play a useful role in the diagnosis of disease. Inflammation can be 

monitored through the presence of signalling molecules, such as cytokines, and their 

soluble receptors. This study aimed to identify soluble cytokine receptors; soluble 

tumor necrosis factor 1 (sTNFRI) and 2 (sTNFRII) as potential novel markers to aid 

diagnosis of CKD at early stages following a multi-analytical approach. 

Methodology: Serum samples were taken from 327 patients with CKD (137 Stage 

1, 109 Stage 2 and 81 Stage 3) and 139 healthy controls. Concentrations of sTNFRI 

and sTNFRII in samples were determined using a cytokine biochip array applied to 

the Evidence Investigator analyser. Serum creatinine was also measured to determine 

eGFR using the MDRD method. Statistical analysis was performed using SPSS v20 

(IBM), all data represented as Median [Range]. 

Results: Differences in concentration of each analyte across the disease groups were 

initially assessed using the non-parametric Krukal-Wallis testing: both analytes were 

shown to have significantly different levels across the different stages of disease 

(significance determined as p



(Skyline software), 2) co-elution of at least 6 transitions per peptide, 3) comparison 

of the observed fragmentation pattern with the fragmentation pattern displayed in 

publicly available databases (SRM atlas and GPM database). Based on SRM collider 

(www.srmcollider.org), three transitions per peptide were selected to generate unique 

ion signatures (127 peptides corresponding to 68 out of 76 candidate proteins). An 

EASY-nLC 1000 pump coupled to a TSQ Vantage (Thermo Fisher) were utilized 

for analysis. For protein quantification, twenty-one age-matched CSF samples were 

selected, including patients with HS (n=7), IS (n=7) and healthy controls (n=7). 

Samples were collected within 96 hours of symptoms onset and S100B protein was 

measured using a fully-automated electrochemoluminometric immunoassay (Roche 

Diagnostics). 

Results: S100B was significantly elevated (p



and then the 50 uL dried blood samples were punched and rehydrated with a buffer/ 

deionized water solution. Ten uL of each extracted DBS sample was applied to the 

IEF comb. Eighteen serum samples of the corresponding DBS phenotypes were also 

placed on a comb for comparison. IEF was performed on the Sebia Hydrasys using 

standard protocol and the resultant gel was stained, washed, and digitally scanned. 

Results: In Figure 1, phenotype MM is on the left, phenotype MS is in the center, 

and phenotype MZ is on the right. For each phenotype, the DBS sample is on the left 

and the corresponding serum sample is on the right. All 18 DBS phenotype samples 

displayed the unique identifiable banding patterns present in the serum samples. 

Conclusion: IEF of DBS samples adequately reveal the M, S, and Z alleles on the 

Sebia Hydrasys. Work is underway to validate the 100+ additional rare alleles and to 

establish AAT protein stability on the filter paper. 

P = 0.01. The mean serum h-sCRP on the third day for patients with fractures(but 

without surgery) was higher (381.6 ± 122.7mg/L) than for those with soft tissue 

injuries 376.1 ± 143.3mg/ L, and for controls 69.4 ± 68.1mg/L, P = 0.01. 

Conclusion: C - reactive protein levels increase in the blood of trauma patients as a 

result of tissue damage but decreases after the third day following trauma. However, 

in the presence of infection, the increase was sustained. We therefore recommend that 

serial quantitative c - reactive protein measurements be done as an adjunct to surgical 

care in patients with acute injuries. 

B-158 

A Novel Immunoassay for the Determination of the Chemokine 

RANTES 

M. F. Kelly, V. Toner, I. Vintila, C. Ledgerwood, R. I. McConnell, S. P. 

Fitzgerald. Randox Laboratories Limited, Crumlin, United Kingdom 

B-157 

High Sensitive C-reactive Protein in Patients With Acute injuries 

S. E. Idogun, E. Ayinbuomwan, P. E. Irhibhogbe, S. Ayinbuomwan. 

University of Benin Teaching Hospital, BENIN, Nigeria 

Background: For many years, C - reactive protein is known as a highly sensitive but 

non-specific marker for acute inflammation. 

Aim and Objectives: The aim of the study was to determine the serial serum level of 

high sensitive C-reactive protein (h-sCRP) in patients with trauma. 

Subjects and Methods: Subjects were patients who were involved in vehicle crashes, 

burns, falls or other traumatic cases. A structured questionnaire was administered to 

all subjects to document their ages, sex, occupation, date and time of trauma, date of 

admission, duration of hospital stay and complications. Samples were collected from 

participants for estimation of h-sCRP on days 1, 3, and 8. Samples were taken from 

control subjects for one time estimation of CRP by photometric method. 

Results: A total of 120 patients were studied, males were 98 (81.7%) and 22(18.3%) 

females. The most frequent cause of trauma amongst the patients was vehicular 

crashes 82(68.3%) followed by gunshot injuries 21(17.5%). The mean serum h-sCRP 

of the patients on the first day was (165.8 ± 104.2mg/L) but it peaked on the third day 

post trauma (378.8 ± 133.0mg/L) and declined on the eight day to 300.0 ± 156.5mg/L, 

Introduction: RANTES (CCL5/regulated on activation, normal T cell expressed and 

secreted) is a member of the CC subfamily of chemokines. RANTES mediates the 

trafficking and homing of classical lymphoid cells such as T cells and monocytes, 

but also acts on a range of other cells, including basophils, eosinophils, natural killer 

cells, dendritic cells and mast cells. A wide range of inflammatory disorders and 

pathologies have been associated with increased RANTES expression, including: 

asthma, allogeneic transplant rejection, atherosclerosis, arthritis, atopic dermatitis, 

delayed-type hypersensitivity reactions, glomerulonephritis, endometriosis, some 

neurological disorders such as Alzheimer’s disease and certain malignancies. It also 

plays a key role in the immune response to viral infection. Current available immunoanalytical 

methods for the determination of this chemokine require sample dilution 

prior to assessment, which could lead to inaccuracy in the pre-analytical steps as high 

dilutions and small sample volumes are involved. This would be detrimental for the 

final outcome of the analysis. 

Relevance: This study reports the development of a biochip based immunoassay 

for the determination of RANTES in neat samples, thereby eliminating the need of 

sample dilution, which not only simplifies the analytical process but also contributes 

to a more accurate determination. 

Methodology: A chemiluminescent biochip based immunoassay was employed: a 

TAG -specific monoclonal antibody was immobilised and stabilised on the biochip 

surface. Reagent containing the RANTES specific antibody coupled to the TAG 

and calibrator/sample were added to the biochip, which is also the vessel of the 

immunoreaction. After incubation of 1 hour at 37°C and a washing step, a detector 

antibody was added. After incubation of 1 hour at 37°C and a washing step, the signal 

substrate was added. The chemiluminescent signal was detected by digital imaging 

technology in the Evidence Investigator analyser. The system incorporates dedicated 

software for data processing and archiving. The signal is directly proportional to 

the concentration of the analyte in the calibrator/sample. Six matched serum, EDTA 

plasma and platelet poor plasma samples from apparent healthy subjects were 

analysed. 

Results: Initial evaluation showed that the immunoassay generated a calibration 

curve for RANTES spanning the range of 0-2000ng/ml. The functional sensitivity of 

the assay was determined to be 9.2ng/ml with intra-assay (n=20) precision < 6%. The 

average RANTES concentration in serum was 332ng/ml while the concentrations in 

EDTA and platelet poor plasma samples were 104 and 124ng/ml respectively. 


A217



Conclusions: These results demonstrate a new immunoassay method for the 

quantification of RANTES in serum, EDTA plasma and platelet poor plasma without 

sample dilution. This will improve the performance of the assay and increase the ease 

of use by the end user. In addition, the assay is suitable for multiplexing technology 

for which most immunoassays do not require sample dilution. 

B-159 

Development of Highly Specific Monoclonal Antibodies to FABP1 

A. Gribben, P. Ratcliffe, P. Stewart, S. Savage, P. Lowry, R. I. McConnell, 

S. P. Fitzgerald. Randox Laboratories Limited, Crumlin, United Kingdom 

Introduction: Fatty acid binding proteins (FABP) are small cytoplasmic lipid binding 

proteins that are expressed in a tissue specific manner. FABPs bind free fatty acids, 

cholesterol, and retinoids; and are involved in intracellular lipid transport. Circulating 

FABP levels are used as indicators of tissue damage. Some FABP polymorphisms 

have been associated with disorders of lipid metabolism and the development of 

atherosclerosis. Liver-type FABP (L-FABP/FABP1) was one of the first FABPs to be 

identified. FABP1 is a ~14kDa member of the fatty acid binding family of proteins 

and it is mainly expressed in hepatocytes of the liver, but is also found in proximal 

tubular cells of the kidney and in colonocytes and enterocytes (jejunal and ileal) of the 

gastrointestinal tract. FABP1 is a sensitive biomarker for abdominal disease/injury, 

kidney disease and liver disease due to its high tissue concentration and low plasma 

concentration along with its relatively small size that results in its early release after 

tissue damage. 

Relevance: The aim of this work was to develop two highly specific monoclonal 

antibodies to work as a sandwich pair for FABP1, which will be used as a tool in the 

development of efficient immunoassays for application in clinical settings. 

Methodology: The nine members of the FABP family were expressed as full length 

recombinant proteins in E. coli. Sheep were immunized with the sequence for FABP1. 

Lymphocytes were collected and fused with heteromyeloma cells. Supernatants from 

the resulting hybridomas were screened for the presence of FABP1 specific antibodies 

using the other eight members of the FABP family in negative selection ELISA based 

assays. Positive hybridomas were cloned to produce stable monoclonal hybridomas. 

The antibodies were purified and evaluated by direct binding ELISA to determine 

their specificity for FABP1. 

Epitope mapping of capture and detector/tracer antibodies was also completed using 

overlapping peptides derived from FABP1. Biochip based immunoassays were 

employed to evaluate the analytical performance of the antibody pair, the assay was 

applied to the Evidence Investigator analyser. 

Results: Analytical evaluation indicated that the monoclonal antibodies generated 

were specific for FABP1, exhibiting



B-162 

Can CSF indices predict the presence of oligoclonal bands in isoelectric 

focusing gels ? 

I. A. Hashim 1 , S. Hirany 2 , P. Kutscher 2 , J. Balko 1 . 1 University of Texas 

Southwestern Medical Center, Dallas, TX, 2 Parkland Memorial Hospital, 

Dallas, TX 

Introduction: Analysis of cerebrospinal fluid Immunoglobulin G (IgG) indices and 

oligoclonal bands (OCBs) is essential in the investigation of multiple sclerosis and 

other central nervous system disorders. We examined the utility of CSF indices in 

predicting the presence of oligoclonal bands. CSF indices predictive of and associated 

with positive OCBs in gels are not known. Knowing the indices values associated with 

presence of OCBs may be helpful when examining isoelectric focusing gels. 

Method: Paired CSF and serum IgG and albumin levels as well as associated 

oligoclonal bands results were collected over a two-year period. CSF IgG index, 

synthesis rate, as well as localized synthesis were calculated. Values obtained were 

correlated with findings of OCBs by isoelectric focusing electrophoresis. IgG and 

albumin levels were measured using BN-II-Nephelometer (Siemens, USA) and 

OCBs by isoelectric focusing (Sebia, USA). Analysis was performed according to 

manufacturers’ instructions. 

Results: 376-matched sets of results were obtained. IgG index ranged from 0.26 to 

3.48 (median 0.53), IgG local synthesis ranged from -14.67 to 38.02 (median -0.72), 

IgG synthesis rate ranged from -24.61 to 223.96 (median -1.99), and albumin index 

ranged from 1.5 to 54.3 (median 5.0). 79 samples exhibited blood brain barrier 

impairment as indicated by an albumin index > 9 and were excluded from the 

analysis. 26.3 % of patients were positive for the presence of OCBs by isoelectric 

focusing. There was good correlation between IgG index and IgG local synthesis, 

and IgG synthesis rate (r= 0.71 and 0.68), respectively. In patients with intact blood 

brain barrier, an IgG index greater than 0.7 predicted the presence of OCBs at 91 %, 

whereas, IgG index levels below 0.7 predicted absence of OCBs at 92.7%. In patients 

with blood brain barrier impairment, IgG local synthesis had a better correlation with 

the presence of OCBs. 

Conclusion: This study suggests that CSF Indices can be used to predict the presence 

of oligoclonal bands in isoelectric focusing gels. In patients with an intact blood brain 

barrier, IgG index >0.7 is predictive of a positive OCB in gels. Those with impaired 

blood brain barrier, IgG local synthesis is a better predictor than IgG index. 

B-163 

Optimization of gradient chromatofocusing HPLC and comparison 

with reversed-phase HPLC in the chromatography of proteins 

D. J. Anderson, H. Jogiraju, K. K. Pedada. Cleveland State University, 

Cleveland, OH 

Background and Objective: Gradient chromatofocusing (GCf) is a HPLC technique 

that generates linear pH gradients on weak anion-exchange columns (in the present 

study) with low-molecular weight buffer components. The advantages of GCf are its 

flexibility in generating pH gradients compared to conventional chromatofocusing, 

higher resolution and narrower peaks compared to ion-exchange HPLC, and 

separation based on the protein’s pI. The objective of the present study is optimizing 

and evaluating GCf in protein analysis by: 1) developing a new approach in generating 

smooth linear pH gradients (problematic in GCf techniques); 2) studying the effect of 

the number of buffer components on peak width and resolution; and 3) comparing 

performance of GCf with reversed-phase HPLC. 

Methods: The innovation in linear pH gradient generation (pH 6.50 to 3.50 in 40 min, 

1 ml/min on Waters DEAE 8HR, 1000Å, 4.6 x 100mm, 8μ) was accomplished by 

adding a “bridging buffer” into both the aqueous basic application buffer [consisting 

of 10 mM each of bis-tris methane (6.46) and 3-methyl pyridine (5.68), and 5 mM 

acetic acid (4.76), in 5% methanol adjusted to pH 6.50 with ammonium hydroxide] 

and the aqueous acidic elution buffer [consisting of 5 mM 3-methyl pyridine (5.68), 

10 mM acetic acid (4.76) and 10 mM lactic acid (3.81)] (buffer component pKa given 

in the parentheses). The bridging buffers were acetic acid (a normal component of the 

elution buffer) in the application buffer and 3-methyl pyridine (a normal component 

of the application buffer) in the elution buffer Proteins were separated according to pI 

with this four-component buffer system and the results compared with that obtained 

by a seven-component buffer system, which had more narrowly spaced pKa buffer 

components. Additional components in the seven-component buffer system were 10 

mM 4-methyl pyridine (6.02) and 10 mM pyridine (5.25) in the application buffer and 

10 mM 4-chlorophenyl acetic acid (4.19) in the elution buffer. Bridging buffers were 

5 mM acetic acid and 5 mM pyridine. Reversed-phase HPLC used a C4, Nest Group, 

250mm × 0.3mm, 5u, 300Ǻ column, employing a 50 min linear gradient from 2% to 

81% acetonitrile in 50 min at a flow rate of 7 uL/min. 

Results: Addition of the bridging buffer components smoothed the irregularity that 

usually occurs in the middle portion of the pH gradient. Half-height peak widths in 

the seven-component buffer system were less for the proteins studied than the fourcomponent 

buffer system: β-lactoglobulin A (0.94 vs. 1.24 min), β-lactoglobulin B 

(0.5 vs. 1.11 min), bovine serum albumin (0.7 vs. 2.69 min), conalbumin (1.4 vs. 

1.78 min) and ovalbumin (0.46 vs. 0.71 min). Resolution increased by an average 

of 59% for the greater component buffer system. GCf performed better compared to 

reversed-phase HPLC, with an average decrease of peak width and average increase 

in resolution by factors of 2.7 and 6.9, respectively. 

Conclusion: The fundamental studies presented here advance the technique of ionexchange 

HPLC in protein analysis. Potential clinical applications of GCf include 

hemoglobin analysis and discovery of disease markers in 2D-HPLC proteomic 

techniques. 

B-164 

A new method for immuno-turbidimetric measurement of Calprotectin 

in feces, plasma and other body-fluids. 

L. A. Hansson 1 , A. M. Havelka 2 , C. B. Johansson 3 . 1 Department of 

Molecular Medicine and Surgery, Stockholm, Sweden, 2 Department of 

Molecular Medicine and Surgery Karolinska Institute, Stockholm, Sweden, 

3 

Department of Molecular Medicine and Surgery Karolinska Insitute, 

Stockholm, Sweden 

Background: The interest in calprotectin has been increasing during last few years 

due to its potential as a non-invasive, cheap and sensitive marker for inflammation, 

particularly for intestinal inflammation. Fecal Calprotectin might in the future be used 

as a screening tool to exclude unnecessary colon investigations. 

Currently, calprotectin is measured with commercially available enzyme-linked 

immunosorbent assays (ELISA) and EliA (Fluoroenzyme immunoassay), which are 

marketed by several manufacturers. At present, these methods are time-consuming 

and used only in clinical laboratories. Moreover, determination of calprotectin in feces 

requires often manual and long pre-analytical processing of the fecal samples, which 

may lead to very long turn-a-round time for the calprotectin results. 

We have validated a new immune-turbidimetric assay for determination of calprotectin 

in combination with a fully automatic system for pre-analytical processing of fecal 

samples in order to improve efficiency and generate shorter turn-a-round time for the 

Calprotectin results. 

Methods: A new particle-enhanced immune-turbidimetric assay (Gentian, Moss, 

Norway) for determination of Calprotectin was validated. Fecal Calprotectin was 

assayed on a Cobas c111 system (Roche AG, Basel Schweiz) . 

Pre-analytical processing of fecal samples was performed with a fully automated 

robotic system (SoniC, S2G Scandinavia) and turn-around time for reporting of 

results was well within a working-day. 

Results: Linearity was proven throughout the measuring range from 1 to 50 mg/L for 

plasma samples and 50 to 2500 mg/kg for fecal samples. Within-run CVs for fecal 

Calprotectin ranged from 2,2 - 9,6 %, for concentration range 50 - 700 mg/kg. Good 

agreement was achieved in the comparisons between the Gentian-Calprotectin assay 

and the commercially available ELISAs (Calpro AS and BÜHLMANN Laboratories 

AG: slope range 1,08 - 1,38, R 2 = 0,89-0,92). 

Conclusions: The immune-turbidimetric Calprotectin assay was shown to be precise 

and accurate with proven linearity over the measuring range. Good comparability 

was obtained with other commercially available ELISAs. The automatization of 

both pre-analytical processing of fecal samples and measurement of Calprotectin 

concentration resulted in improved efficiency and significantly shorter turn-aroundtime 

for reporting the Calprotectin results. 


A219



B-166 

Use of correlation equations with the reference method to harmonize 

Alkaline Phosphatase results of routine methods 

X. Qin 1 , C. Qian 1 , S. Xie 1 , Z. Qi 1 , X. Cheng 1 , L. Qiu 1 , J. Miller 2 . 1 Department 

of Laboratory Medicine, Peking Union Medical College Hospital, Beijing, 

China, 2 Department of Pathology and Laboratory Medicine,University of 

Louisville Hospital, louisville, KY 

Background: Some large health care systems have multiple instruments and methods 

for the same analyte. The results of these disparate methods often vary. Patients 

may have analyses performed by more than one method and it is desirable for those 

results to be comparable. Alkaline phosphatase (ALP) is an important enzyme for 

evaluating hepatic, biliary tract, and bone diseases. However, ALP results vary among 

the methods in our system. We hypothesized that we could adjust each routine method 

based on its correlation with the reference method to make all methods equivalent and 

comparable to the reference method. 

Methods: We set up the International Federation of Clinical Chemistry (IFCC) 

reference method for ALP at 37 o C (Clin Chem Lab Med. 2011;49:1439). The accuracy 

of this method was confirmed by acceptable results on samples from the 2011 

external quality assessment scheme for reference laboratories in laboratory medicine 

(RELA-IFCC) and imprecision was less than 1%. ALP was measured in duplicate 

on 10 patient specimens on each of 4 days (n=40) by the Roche Modular, Olympus 

AU5400, and Siemens Dimension methods, and compared with the reference method. 

ALP activities covered the analytical range (10-741 U/L). Correlation between 

methods was evaluated using the least squares regression analysis, and Pearson 

correlation coefficients were determined. Routine method results were adjusted using 

the correlation equation. The predicted bias and 95% confidence interval (CI) were 

calculated according to CLSI EP9-A2. 

Results: All three routine methods correlated well to the reference method (r 2 >0.99). 

The regression equations of the Roche, Olympus, and Dimension methods (y) vs. 

the reference method (x) were, respectively, y=0.923x+2.996; y=1.084x-2.806; and, 

y=1.084x+2.286. The extreme value of the 95% CI of the predicted bias at the 400 

U/L Medical Decision Level of ALP is -35.1 U/L (-8.8%), +34.3 (+8.6%), and +43.1 

U/L (+10.8%), for the Roche, Olympus, and Dimension methods, respectively. These 

all exceed the desirable bias of 6.4% based on biological variation. The corresponding 

adjustment equations (solving the equations for x) were, respectively, x=1.083y-3.246; 

x=0.9225y+1.919; and, x=0.922y-2.109. These adjustment equations were used to 

convert the routine method raw ALP activity (y) to the equivalent reference method 

result (x). After making these adjustments, the regression equations of the Roche, 

Olympus, and Dimension methods (y) vs. the reference method (x) were, respectively, 

y=0.9994x-0.008; y=0.9998x-0.666; and, y=0.99996x+0.005. The extreme value of 

the 95% CI of the predicted bias at the 400 U/L decision level, after adjustment, were 

-3.6 U/L (-0.9%), -7.3 U/L (-1.8%), and -2.8 U/L (-0.7%), respectively. The bias of 

all three methods was within the desirable bias of 6.4%. The adjusted routine method 

ALP results match the reference method results extremely well. 

Conclusion: By making these adjustments to the three routine ALP methods they 

all agree much more closely to the reference method results and to each other. This 

strategy for harmonizing the ALP results produced by our routine methods allows 

individual patient’s results to be more consistent when different methods are used at 

different times. 

B-167 

Development of a new homogeneous immunoassay for Ferritin with 

ultra-sensitivity 

M. Kano, R. Tachibana, Y. Sato, Y. Ito. Research and Development 

Department, Denka Seiken Co., Ltd., Niigata, Japan 

Background: Because of wide variety of clinical significances of Ferritin in both low 

such as iron deficiency anemia and high serum levels (a lower threshold is 12 μg/L 

or below and an upper threshold is 300 μg/L or greater), assays for serum Ferritin 

level are required to have a wide assay range with high sensitivity. In addition, serum 

Ferritin levels may increase very high in some disorders such as hemochromatosis, 

hemosiderosis, etc. Thus it is also important for assays for serum Ferritin to have good 

prozone (high dose hook effect) tolerance for accurate and reliable measurements. We 

developed a new latex particle-enhanced turbidimetric immunoassay for serum and 

plasma Ferritin with ultra-sensitivity and excellent prozone tolerance. We compared 

our new assay to other Ferritin assays already marketed including the one currently 

available from Denka Seiken. 

Methods: We carried out a performance verification study and a method comparison 

study against five other Ferritin reagents on a Hitachi 917 analyzer. 

Results: The new assay showed the correlation coefficient over 0.99 against the 

current assay from Denka Seiken even on the unique clinical samples such as EBV 

IgG positive samples, Rheumatoid factor high positive samples, etc. It showed 

prozone tolerance that is at least equivalent to the other reagents or even better. The 

new assay showed the best performance in terms of the sensitivity and showed the 

lowest detection limit and smallest CVs from within-run imprecision with samples 

around the lower threshold (5 - 15 μg/L). 

Conclusion: The new Ferritin assay from Denka Seiken showed the best performance 

compared to the other Ferritin assays already marketed. The new assay showed 

excellent precision, sensitivity and prozone for diagnosis of various disorders where 

Ferritin level is either abnormally low or high without nonspecific reaction. This new 

assay can give laboratories a more economical and flexible approach for Ferritin 

determination. 

B-168 

An Evaluation of Specific Protein Assays on Mindray’s BS-2000M1 

Clinical Chemistry System* 

Y. Li, J. Zhuang, C. Chen, X. Zhang, J. Liu. Department of Laboratory 

Medicine, Guangdong Provincial Hospital of Traditional Chinese 

Medicine, Guangzhou, China 

Background: Specific proteins are useful markers in the clinical laboratory for the 

diagnosis of immunologic disorders and monitoring changes in the normal polyclonal 

mixture of serum immunoglobulins. Mindray’s BS-2000M1 (Shenzhen Mindray Bio- 

Medical Electronics CO., LTD., P.R. China) is a high throughput clinical chemistry 

system of 2200 tests/hour with ISE, and has a broad test menu including specific 

proteins (Calibrators are traceable to ERM-DA470k). 

Objective: The purpose of this study was to evaluate the performance of specific 

protein immunoturbidimetric assays on the new Mindray’s BS-2000M1 clinical 

chemistry system in comparison to the Cobas® 8000 clinical chemistry system 

(Roche Diagnostics, Germany) using patient specimens received into the laboratory 

for routine testing. 

Methods: Five of the currently available BS-2000M1 serum protein 

immunoturbidimetric assays were evaluated as part of this study. Evaluation protocols 

for precision were based on CLSI EP-5A2 methods. Linearity protocol was based on 

CLSI guideline EP6-A. Method comparison was evaluated using samples spanning 

the dynamic range based on CLSI guideline EP9-A2. 

Results: Total precision targets were met for all specific proteins, as well as withinrun 

targets. Total %CV’s ranged from 1.34-3.15%. Linearity met the Mindray claimed 

dynamic range in all cases. Linear regression results from the method comparison 

studies between the BS-2000M1 and the Cobas 8000 are presented in the table. 

Method Comparison Results Between BS-2000M1 and Cobas 8000 

Assay Range (g/L) N Slope Intercept R 

C3 0.19-1.54 62 0.96 -0.07 0.998 

C4 0.010-0.480 62 0.96 0.00 0.997 

IG-A 0.18-6.26 64 1.03 -0.16 0.997 

IG-G 5.82-22.89 65 1.06 0.30 0.992 

IG-M 0.19-3.69 65 1.08 -0.02 0.998 




Conclusions: With respect to precision, linearity, and accuracy of serum protein 

assays tested, Mindray’s BS-2000M1 clinical chemistry system produces results that 

were consistent with Cobas 8000 clinical chemistry system. 

* not yet available for in vitro diagnostic use in the US. 

B-169 

Development of candidate reference material SRM 2924 C-reactive 

Protein Solution 

E. L. Kilpatrick. National Institute of Standards and Technology, 

Gaithersburg, MD 

The goal of the current research is to produce a pure compound certified reference 

material for C-reactive protein (CRP) to be used in the standardization of clinical 

laboratory assays. The Joint Committee for Traceability in Laboratory Medicine 

(JCTLM) maintains a database of higher-order reference materials for laboratory 

medicine and in vitro diagnostics. Currently, there is no JCTLM-approved material 

for pure CRP. The National Institute of Standards and Technology (NIST) has 

procured candidate material to generate SRM 2924, C-reactive Protein Solution. The 

material was prepared as a solution of approximately 0.5 mg of recombinant CRP in 

a volume of 1 mL aqueous buffer (concentration = 0.5 mg/mL) and will be analyzed 

for protein concentration as well as structural conformation and related attributes. 

Preliminary analysis of molar mass was performed using two methods: matrixassisted 

laser desorption ionization time of flight mass spectrometry (MALDI-MS) 

and electrospray ionization mass spectrometry (LC/MS) with deconvolution. The 

molar mass determined by each method was in close agreement (MALDI-MS (-313 

ppm, n=10); LC/MS - (21 ppm, n=8) with the sequence calculated mass of 23029 

Dalton including known post-translational modifications. Initial purity assessment 

was performed using sodium dodecyl sulfate polyacrylamide gel electrophoresis 

(SDS-PAGE, n=10) indicating that only a single band was evident upon Coomassie 

blue staining. Further analysis will include amino acid analysis by isotope-dilution 

mass spectrometry for concentration assignment and density measurements by the 

Lang-Levy method. Issuance of SRM 2924 will enable the generation of secondary 

reference materials using higher order methods leading to advances in standardization 

of CRP clinical measurements. 

B-170 

Alpha-defensin in synovial fluid as a new biomarker for the diagnosis 

of periprosthetic joint infection 

C. Deirmengian 1 , K. Kardos 1 , P. Kilmartin 1 , A. Cameron 1 , D. Chung 1 , K. 

Schiller 1 , K. Birkmeyer 1 , G. Kazarian 1 , J. Parvizi 2 . 1 CD Diagnostics, Inc, 

Wynnewood, PA, 2 Rothman Institute of Orthopedics, Thomas Jefferson 

University Hospital, Philadelphia, PA 

Background: Prosthetic joint infection (PJI) occurs after primary joint replacements 

at a rate of 1.0-2.5% and increases to 2.0-5.8% in revision surgeries. When treating 

a painful joint replacement, the ability to distinguish between septic and aseptic 

failure of the prosthesis is critical, as the treatment for PJI necessitates unique 

surgical strategies that aim to eradicate the organism. Currently, surgeons utilize a 

wide spectrum of tests in the attempt to diagnose PJI, including local measures of 

synovial inflammation (synovial fluid white blood cell count and differential, synovial 

tissue white blood cell count), systemic measures of inflammation (serum C-reactive 

protein level, erythrocyte sedimentation rate), radiologic tests (radiographs, bone 

scan), and bacterial isolation techniques (Gram stain, culture). Each of these methods 

individually has limitations for either sensitivity or specificity. It has been reported 

that 10-20% of all confirmed infections cannot be confirmed via culture methods. 

The failure of these tools to reliably diagnose infection, and the resulting clinician 

disparity in practice, recently led the Musculoskeletal Infection Society (MSIS) to 

publish a consensus definition of PJI, utilizing a combination of clinical data and six 

of the above tests. 

Methods: We assessed the ability of alpha-defensin to distinguish prosthetic joint 

infection from aseptic inflammation utilizing a series of well-characterized samples 

that were clearly defined by the MSIS criteria utilizing an alpha-defensin ELISA 

(Hycult) modified for use with synovial fluid. The study included 23 aseptic samples 

and 22 septic samples that were provided by the Rothman Institute. Receiver 

Operating Characteristics (ROC) analysis was conducted to select the optimal 

cutoff for the assay and its performance was established verses the MSIS criteria. 

Additionally, the performance of each of the individual methods utilized in the MSIS 

criteria was evaluated utilizing the recommended criteria. 

Results: A total of 45 well-defined samples were used to establish the optimal cutoff 

(7.7μg/mL) for the alpha-defensins using a ROC analysis that yielded an area under the 

curve (AUC) of 1.0. The sensitivity (and 95% confidence interval) for alpha-defensin, 

ESR, CRP, WBC count, PMN% and culture were 100% (84.6-100%), 95.5% (77.2- 

99.9%), 95.5% (77.2-99.9%), 95.5% (77.2-99.9%), 95.5% (77.2-99.9%) and 90.9% 

(70.8-98.9%) respectively. The specificity performances were 100% (85.2-100.0), 

78.3% (56.3-92.5%), 87.0% (66.4-97.2%), 95.7% (78.1-99.9%), 95.7% (78.1-99.9%) 

and 95.7% (78.1-99.9%) respectively. There was significant separation between the 

positive and negative populations for alpha defensin where the concentration of the 

lowest positive sample was 2.44 fold higher than the highest negative sample. 

Conclusion: The measurement of alpha-defensin levels provides a highly sensitive 

and specific method to aid the diagnosis of PJI with improved performance compared 

to the traditional methods utilized for the analysis of synovial fluid. 

B-171 

Performance characteristics of The NGAL Test using the Roche 

cobas c501 analyzer 

S. L. La’ulu 1 , B. B. Suh-Lailam 2 , K. W. Davis 3 , A. E. Tebo 2 , J. A. Straseski 2 . 

1 

ARUP Institute for Clinical and Experimental Pathology, Salt Lake City, 

UT, 2 Department of Pathology, University of Utah, Salt Lake City, UT, 

3 

ARUP Laboratories, Salt Lake City, UT 

Background: Neutrophil gelatinase-associated lipocalin (NGAL) is a biomarker that 

may aid in diagnosis of acute kidney injury and shows promise as a biomarker for 

lupus nephritis. The objective of this study was to evaluate the analytical performance 

of The NGAL Test (BioPorto Diagnostics) clinical chemistry application using the 

Roche cobas c501. 

Methods: Imprecision was tested using manufacturer’s quality control material, 3 

serum pools, and 2 urine pools. Two runs of duplicate testing were conducted daily 

for 5 days. Interference studies and limit of detection were performed for both serum 

and urine matrices. Dilution linearity was assessed using manufacturer’s high and 

blank calibrators. Method comparison testing was performed using the NGAL ELISA 

kit as the comparator method. Samples used for testing were paired urine and serum 

specimens from patients suspected of systemic lupus erythematosus. 

Results: Imprecision studies had total CV’s ≤ 5.2%. Hemoglobin concentrations 

up to 1335 mg/dL, bilirubin concentrations up to 7.25 mg/dL, and triglyceride 

concentrations (serum only) up to 2350 mg/dL had no effect on results within the 

precision of the assay for both serum and urine samples. The limit of detection was 

10.7 ng/mL for serum and 4.6 ng/mL for urine. The assay was linear over a measured 

range of 2.3 to 4934 ng/mL with maximum deviations from target recovery ≤ 8.4% 

and slope of 1.02. Method comparison of the c501 to the ELISA by Deming regression 

and Bland-Altman plots are summarized (Table 1). 

Conclusions: The NGAL Test, performed with the Roche c501, had favorable 

precision and linearity. No interferences were observed for hemolysis, icterus, or 

lipemia. A negative bias was observed between the 2 methodologies with the bias 

being more prominent in urine samples. Overall, The NGAL Test performed well 

on the Roche c501 and provides an alternative to the laborious ELISA method. 

Sample Type N Equation r Bias 

Serum 110 c501 = 0.89 x ELISA + 5.94 0.682 -33.6 

Urine 109 c501 = 0.75 x ELISA - 27.16 0.745 -107.8 

B-172 

Development and evaluation of the performance characteristics of a 

new microfluidic immunoassay for Haptoglobin on FRENDTM System 

S. Lee, E. Choi, C. Lee, J. K. Chang, S. Han. NanoEnTek, Seoul, Korea, 


Background: The FREND TM System is a portable, automated FREND TM cartridge 

reader which is based on quantitative immunoassay technology capable of quantifying 

single or multiple analytes in 6 minutes by measuring laser-induced fluorescence in 

a single-use disposable reagent cartridge. Haptoglobin (HP) is an acute phase protein 

whose serum concentration rises significantly during acute inflammation due to 

causes including surgery, myocardial infarction, infections and tumors. 

Objective: The objective performance of this study was to evaluate a Haptoglobin 

immunoassay on a micro-fluidic platform (FREND TM cartridge-system). 

Method: Human serum samples were diluted off-line with provided kit 10,000 

fold prior to analysis. Serum HP concentration was determined by immuno- 


A221



fluorescence assay of HP on FREND TM system. The assay was standardized to the 

IFCC International Reference Preparation CRM470 (RPPHS) and the result was 

converted to mg/dL with consideration of dilution fold. We studied the precision and 

linearity of the FREND TM Haptoglobin assay (NanoEnTek, South Korea), compared 

it with another test. Limit of detection establishment and interference testing were 

also performed. Three samples were measured with 4 replicates and 5 runs for the 

precision test. The linearity range experiment was performed using 7 equally spaced 

concentrations including blank was prepared by Clinical and Laboratory Standards 

Institute EP-6 dilution methods. Thirty eight samples were tested for comparing the 

NanoEnTek’s assay with the Cobas Integra 800 Haptoglobin assay (Roche, Swiss). 

Limit of detection was established by 48 measurements of both blank and low level 

samples (CLSI EP-17 guideline) and three endogenous interferents were tested as per 

CLSI guideline EP-7. 

Results: The FREND TM - HP assay demonstrated acceptable imprecision of %CV 

(

Cardiac Markers 


B-175 




Determination of Cardiac Troponin with a Single-Molecule High- 

Sensitivity Assay and Outcomes in Patients with Stable Coronary 

Artery Disease: Analysis from PROVE IT-TIMI 22 

P. Jarolim, D. A. Morrow, R. G. O’Malley, M. P. Bonaca, B. M. Scirica, 

S. A. Murphy, M. J. Conrad, C. P. Cannon, E. Braunwald, M. S. Sabatine. 

Brigham and Women’s Hospital, Harvard Medical School, Boston, MA 

Background: Cardiac troponin (cTn), an established biomarker in acute coronary 

syndromes (ACS), is also an emerging risk predictor in patients with stable ischemic 

heart disease (SIHD). We assessed the prognostic performance of cTn and the 

interaction with intensive vs. moderate statin therapy in a large cohort of wellcharacterized 

patients with SIHD using an investigational high-sensitivity cTn assay. 

Methods: We measured cTnI using the Erenna analyzer (Singulex, 99th percentile 

9 pg/mL,‘S-TnI’) in 3,209 patients who had been stable without recurrent events 

through 30 days after an ACS and had been randomized to intensive or moderate 

statin therapy in PROVE IT-TIMI 22. Based on prior work, our primary event of 

interest was cardiovascular death (CVD) or heart failure (HF). Patients were followed 

for an average of 2 years. 

Results: All 3,209 patients had detectable S-TnI and 970 (30.2%) patients had S-TnI 

above 99th percentile. Patients with elevated S-TnI were at higher risk of CVD/HF 

(6.2% v. 2.9%, p50 ng/L) and 

72.5% (at HS-cTnT>100 ng/L) respectively. At HS-cTnT>100 ng/L, 280/1555(18%) 

and 1045/1555(67.2%) of the cases had normal CKmb and CKmbF respectively. 

Analysis of result changes over consecutive time points revealed 56% agreements in 

the direction of change between HS-cTnT and CKmb, and only 37% with CKmbF. 

Conclusion: The high number of simultaneous requests for HS-cTnT and CKmb 

reflects a lack of confidence in, and/or understanding of, the role of HS-cTnT in 

the investigation of acute coronary syndrome. The low concordance rate in patient 

classification between HS-cTnT and CKmb/CKmbF suggests that the two cardiac 

biomarkers have very different diagnostic performance characteristics, and adding 

CKmb/CKmbF is not likely to provide further clarification in the interpretation of 

HS-cTnT. 

Table 1. Breakdown of CKmb and different levels of HS-cTnT 

HS-cTnT, ng/L CKmb, ug/L CKmbF, ug/IU Total 

≤6 >6 ≤0.05 >0.05 

≤14 881 256 1129 8 1137 

>14 986 1816 2263 539 2802 

Total 1867 2072 3392 547 3939 

≤50 1415 572 1969 18 1987 

>50 452 1500 1423 529 1952 

Total 1867 2072 3392 547 3939 

≤100 1587 797 2347 37 2384 

>100 280 1275 1045 510 1555 

Total 1867 2072 3392 547 3939 

B-177 

Measurement of Galectin-3 levels with the Architect assay in patients 

with systolic heart failure. 

d. GRUSON, A. Pouleur, T. Lepoutre, S. Ahn, M. Rousseau. Cliniques 

Universitaires St Luc, Bruxelles, Belgium 

Background: Galectins are carbohydrate binding proteins involved in several 

biological functions such as intracellular signalling, cell to cell interaction and 

exchanges between cells and the extracellular matrix. Galectin-3 (Gal-3) is upregulated 

in hypertrophied hearts and is suggested as an important mediator for the 

development of fibrosis and cardiac remodeling. The evaluation of the circulating 

Gal-3 levels through enzyme linked immunosorbent (ELISA) has demonstrated its 

potential reliability for the risk stratification and management of HF patients. The 

emergence of automated assay for Gal-3 measurement might facilitate its accessibility 

for physicians. The aim of our study was to determine Gal-3 levels with the automated 

Architect immunoassay in patients with systolic HF as well as their relations with 

established biomarkers of HF severity. 

Methods: Gal-3 levels were measured in 100 patients with systolic HF (females 

n=23; males n=77; NYHA II-IV; mean age: 68 years; mean left ventricular ejection 

fraction (EF): 23 %; etiology: ischemic n=65, non ischemic n=35) with the Architect 

automated assay (Abbott diagnostics) as well as with the reference ELISA assay (BG 

Medicine). Circulating levels of B-type Natriuretic Peptide (BNP) and its precursor, 

the proBNP 1-108 (proBNP), were also determined using automated immunoassays. 

Results: Median of Gal-3 was 22.7 ng/ml with the Architect assay and 20.2 ng/mL with 

the ELISA assay. Gal-3 levels measured with the Architect assay were significantly 

correlated with to those measured with the ELISA assay, with a concordance 

correlation coefficient of 0.86, a pearson coefficient (precision) of 0.92 and Cb bias 

coefficient factor (accuracy) of 0.93. Levels of Gal-3 measured with the Architect 

assay were related to NYHA functional classes (p



Conclusions: Our results show that Gal-3 levels measured with the recently developed 

Architect automated immunoassay are related to the severity of systolic heart failure 

and are associated to established biomarkers of HF worsening. Measurement of Gal-3 

with such automated assay might therefore be relevant for the risk stratification and 

treatment selection of patients with systolic HF. 

B-178 

Performance of a high sensitivity cardiac troponin I assay in patients 

with non-ST elevation acute coronary syndrome 

P. Jarolim, M. P. Bonaca, M. J. Conrad, S. A. Murphy, D. A. Morrow. 

Brigham and Women’s Hospital, Harvard Medical School, Boston, MA 

Background: Newer high-sensitivity assays for cardiac troponin (hsTn) enable more 

precise measurement of very low troponin concentrations and improved diagnostic 

accuracy. However, their prognostic value, particularly at low concentrations, is 

less well defined. We asked whether newly detectable troponin concentrations are 

associated with increased risk of recurrent cardiovascular events. 

Methods: We compared the prognostic performance of a new hsTnI assay (Abbott 

ARCHITECT) with performance of the commercial 4th generation troponin T assay 

(TnT, Roche) in 4,695 patients with non-ST elevation acute coronary syndromes 

(NSTE-ACS) from the TIMI Clinical Trials Database. The primary endpoint was 

cardiovascular death (CVD) or new or recurrent myocardial infarction (MI) at 30 

days. Baseline troponin was categorized at the published 99th percentile reference 

limit (26 pg/mL for hsTnI; 10 pg/mL for TnT), and at gender-specific 99th percentiles 

for hsTnI. 

Results: 100% of patients had detectable hsTnI concentrations compared with 94.5% 

patients using TnT. Patients with hsTnI ≥99th percentile (85%) had a 3.7-fold higher 

adjusted risk of cardovascular death or MI at 30 days relative to patients with hsTnI 

0.03 ug/L ≥ 14 ng/L ≥ 26 ng/L 

Sensitivity(95%CI) 

89% (52-100) 89% (52-100) 89% (52-100) 

Specificity(95%CI) 

86% (79-91) 73% (65-80) 89% (83-94) 

Likelihood ratio (+) 

6.18 

3.27 

8.30 

Likelihood ratio (-) 

0.13 

0.15 

0.12 

AUC (95%CI) 0.91 (0.77-1.00) 0.94 (0.88-1.00) 0.96 (0.91-1.00) 

90 min >99 th >0.03 ug/L ≥ 14 ng/L ≥ 26 ng/L 


100% (66-100) 100% (66-100) 100% (66-100) 


78% (70-84) 73% (65-80) 89% (83-94) 


4.48 

3.66 

9.27 


0.00 

0.00 

0.00 

AUC (95%CI) 0.99 (0.97-1.00) 0.98 (0.95-1.00) 0.98 (0.95-1.00) 

Delta > 0.02 ug/L change > 7 ng/L > 15 ng/L 

change change 


89% (52-100) 89% (52-100) 89% (52-100) 


92% (86-96) 96% (91-98) 95% (90-98) 


11.15 

20.59 17.78 


0.12 

0.12 

0.12 

AUC (95%CI) 0.97 (0.92-1.00) 0.89 (0.68-1.00) 0.97 (0.93-1.00) 

CONCLUSIONS: Larger studies assessing the earlier timeframe performance vs. the 

recommended 3-6 hours are required. 

B-180 

Evaluation of the method of measurement of platelet catecholamines in 

patients with OSA with and without treatment for one year of CPAP. 

M. C. fFeres, L. Mello-Fujita, C. F. Rizzi, F. D. Cintra, S. Tufik, D. Poyares. 

Universidade Federal de Sao Paulo- Brasil- UNIFESP, Sao Paulo, Brazil 

Background: Many published studies showed that the assay method of platelet 

catecholamines are more stable because they do not suffer interference from abrupt 

changes. The platelets accumulate catecholamine concentration dependent of 

plasmatic and there is evidence to be more efficient evaluation of the sympathetic 

nervous system (SNS) as compared with methods of evaluation plasmatic and urinary 

catecholamines. Thus we use this methodology to evaluate the SNS in obstructive 




sleep apnea (OSA) with or without arterial hypertension (HYP) and in this study we 

tested the performance of platelet catecholamines method in patients with OSA before 

and after one year of effective continuos positive air pression (CPAP) treatment. 

Methods: One-hundred and fifty-four OSA patients were selected from the clinic 

of Sleep Institute of São Paulo city, Brazil. Patients were randomly allocated into 4 

groups: G1 (OSA + HYP, n=64), G2 (OSA, n=50), G3 (HYP, n=16) and G4 (non-OSA 

controls, n= 24). Nine patients were treated with CPAP in one-year period. These 

patients underwent to 24-h urine (U), plasmatic (PL) and platelets (PT) catecholamines 

(adrenaline-ADR and noradrenalin-NOR) dosages (radioimmunoassay method). The 

descriptive analysis was based on the comparison between the four groups performed 

by ANCOVA with age, abdominal circumference and BMI as covariates. Spearman 

correlation test was used. We also tested whether the standardized cutoff values of 

the tests were associated with clinical diagnoses of HYP, moderate or severe OSA 

(with or without HYP) using ROC curves. Based on the new cutoff points found for 

each diagnostic category, binary logistic regressions were carried out to test these 

new measurements. To compare patients before and after treatment, Wilcoxon test 

was used. 

Results: Urinary, plasma and platelet catecholamines concentrations were higher 

in OSA+HYP, OSA and HYP groups compared with controls but presented high 

variability. Significant correlation (r=0.64 p=0.02) was found between urinary 

(UAD) and platelet adrenaline (PTAD) and between urinary (UNA) and platelet 

noradrenaline (PTNA) (r = 0.60, p=0.01). A Logistic regression model, controlled 

for age and BMI, showed that UAD (OR=1.55[1.35-1.85]) and UNA (OR=1.00[1.00- 

1.04]) as risk factors for OSA+HYP group; Higher levels of UAD (OR=1.63[1.43- 

1.92]) and UNA (OR=1.00[1.03-1.07]) were risk factors for HYP and Higher levels 

of UNA (OR=1.00[1.01-1.04]). After 1-year CPAP treatment, a smaller sample (N=9) 

showed smaller levels of UNA (p=0.04) and PTNA (p=0.05). 

Conclusion: In conclusion, we found that urinary noradrenaline levels were able 

to detect the condition of hypertension with and without OSA, whereas platelet 

noradrenaline was superior in detecting OSA without comorbidity. This finding is 

consistent with our hypothesis that in OSA, nocturnal sympathetic activation may 

be reliably detected by a technique that increases catecholamines availability, 

such as platelet dosage. Despite being small (n) data showed a decrease in urinary 

norepinephrine and platelet noradrenaline after effective treatment with CPAP 

B-182 

Clinical Diagnostic and Prognostic Results for the ARCHITECT® 

STAT High Sensitive Immunoassay for Troponin-I 

K. B. Grasso 1 , K. A. Galvani 1 , S. Du 1 , J. L. Rogers 1 , J. L. Yen 1 , J. Huang 1 , F. 

S. Apple 2 , W. J. Castellani 3 , M. T. Petruso 4 , D. Wiesner 1 , R. F. Workman 1 . 

1 

Abbott Laboratories, Abbott Park, IL, 2 Hennepin County Medical Center 

and Minneapolis Medical Research Foundation, Minneapolis, MN, 

3 

Hershey Medical Center, Hershey, PA, 4 Nationwide Laboratory Services, 

Fort Lauderdale, FL 

Background: The ARCHITECT STAT High Sensitive Troponin-I assay* is 

a chemiluminescent microparticle immunoassay (CMIA) for the quantitative 

determination of cardiac troponin I (cTnI) in human plasma and serum. The cTnI 

values are used as an aid in the diagnosis of myocardial infarction (MI) and to aid in 

the assessment of 30-day and 90-day prognosis relative to all-cause mortality (ACM) 

and major adverse cardiac events (MACE) consisting of myocardial infarction, 

revascularization, and cardiac death in patients who present with symptoms suggestive 

of acute coronary syndrome (ACS). The purpose of the study was to evaluate withinlaboratory 

imprecision, diagnostic and prognostic performance. 

Methods: Within-laboratory imprecision (%CV, five day precision across three sites 

using three reagent lots) was assessed using 9 panel/control members with cTnI 

target concentrations ranging from 10 to 45,000 pg/mL (ng/L). The receiver operator 

characteristic area under the curve (AUC) was utilized to evaluate the combined 

clinical utility of sensitivity and specificity for an intended use population (n=1,101 

subjects, including 130 adjudicated MIs per universal MI guidelines; prevalence of MI 

11.8%). Three serial collections (0-2, 2-4, and 4-9 hours post Emergency Department 

presentation) were made in serum separator, lithium heparin plasma separator, and K 2 

EDTA tubes and analyzed. The 99 th percentile cutoffs previously determined and used 

in this study were: overall, 26.2 pg/mL; gender specific, 15.6 pg/mL (female), 34.2 pg/ 

mL (male). The sensitivity, specificity, positive predictive value (PPV), and negative 

predictive value (NPV) were calculated. The absolute percent change (|δ|) in cTnI 

concentration was evaluated at various cutpoints (20%-250%). Kaplan-Meier and 

Cox regression analyses were performed between the elevated cTnI and non-elevated 

cTnI groups (defined by 99 th percentile) at 30-day and 90-day follow-up timepoints of 

MACE and ACM using overall and gender specific cutoffs. 

Results: Imprecision (%CV) ranged from 2.7% (for the panel targeted to 45,000 

pg/mL) to 5.6% (for the panel targeted to 10 pg/mL). The AUC results [95% 

confidence interval] ranged from 0.9197 [0.8914, 0.9480] to 0.9503 [0.9149, 0.9857]. 

The sensitivity, specificity, PPV and NPV with overall and gender specific 99 th 

percentile cutoffs, respectively, ranged, for sensitivity: 84.44% to 94.95%, 81.05% 

to 93.94%; for specificity: 80.72% to 86.35%, 79.98% to 85.85%; for PPV: 35.05% 

to 38.78%, 32.38% to 38.38%; for NPV: 98.08% to 99.25%, 97.53% to 99.24%. A 

|δ| cutoff of 250% with at least one timepoint greater than the 99 th percentile resulted 

in a specificity up to 98.83%. All log-rank p-values were significant at 0.05 level 

for each tube type at each follow-up time point between elevated and non-elevated 

cTnI groups. The unadjusted hazard ratios (Cox regression) with overall and gender 

specific 99 th percentile cutoffs, respectively, ranged, for 30 day: 2.95 to 3.54 and 3.28 

to 3.53; for 90 day: 3.55 to 3.68 and 3.91 to 4.17; for the elevated relative to nonelevated 

cTnI group. 

Conclusion: The results demonstrate the ARCHITECT STAT High Sensitive 

Troponin-I assay offers precise results as a diagnostic tool for the detection of cTnI, 

and as an aid in the assessment of 30-day and 90-day prognosis. 

* under development in U.S. 

The study was funded by Abbott Laboratories. 

B-183 

Determination of a 99th Percentile for the ARCHITECT® STAT High 

Sensitive Troponin-I Immunoassay using a Robust Statistical Method 

J. L. Rogers, S. Du, J. L. Yen, D. Wiesner, R. F. Workman, J. C. Badciong. 

Abbott Laboratories, Abbott Park, IL 

Background: Clinical and Laboratory Standards Institute (CLSI) document C28- 

A3c focuses on three different statistical methods for calculating a reference interval. 

When the data are not normally distributed or cannot easily be made to be normally 

distributed, a nonparametric method or a robust method should be used. The guideline 

promotes the use of the nonparametric method due to its simple and straightforward 

calculations, while recommending the more complex robust method for situations 

where the larger sample size requirement of the nonparametric method cannot be met. 

Regardless of sample size, the robust method exhibits some desirable characteristics 

relative to the nonparametric method. As software capable of performing the robust 

method becomes more readily available to clinicians, the method could become more 

widely used. 

Methods: A reference range study was conducted based on guidance from CLSI 

document C28-A3c. Specimens were collected in 3 tube types (serum separator, 

lithium heparin separator, K 2 

EDTA) from 1,531 apparently healthy individuals in 

a US population with normal levels of BNP, HbA1c, and estimated GFR values. 

Each specimen was evaluated using the ARCHITECT STAT High Sensitive 

Troponin-I assay * on two ARCHITECT instrument systems (i 2000 SR 

and i 1000 ). SR 

The 4,593 specimen results were used to establish the appropriate 99th percentiles 

and their respective 90% confidence intervals (CI). The robust and nonparametric 

methods were used with Dixon and Tukey outlier methods being applied to the data. 

Partitioning analysis was performed to determine if separate 99th percentiles were 

necessary for subgroups. 

Results: The overall robust and nonparametric 99th percentiles for the ARCHITECT 

i 2000 SR 

were 26.2 pg/mL (ng/L) (with 90% CI of 23.3 - 29.7) and 39.1 pg/mL (with 

90% CI of 33.1 - 47.9), respectively. The overall robust and nonparametric 99th 

percentiles for the ARCHITECT i 1000 SR 

were 26.3 pg/mL (with 90% CI of 23.0 - 

29.2) and 37.0 pg/mL (with 90% CI of 32.1 - 44.5), respectively. The gender-specific 

robust and nonparametric 99th percentiles for the ARCHITECT i 2000 SR 

were 34.2 

pg/mL (with 90% CI of 28.9 - 39.2) and 54.4 pg/mL (with 90% CI of 44.1 - 69.7), 

respectively, for males and 15.6 pg/mL (with 90% CI of 13.8 - 17.5) and 26.0 pg/ 

mL (with 90% CI of 21.0 - 32.8), respectively for females. Partitioning analysis was 

performed and concluded that it is not necessary to establish different 99th percentiles 

between the ARCHITECT i 2000 SR 

and ARCHITECT i 1000 SR 

systems, and it is not 

necessary to establish different 99th percentiles for the individual tube types (serum 

separator, lithium heparin separator, and K 2 

EDTA). 

Conclusion: The robust method is a valid method for determining reference intervals. 

Compared to the nonparametric method, it allows for smaller sample sizes, provides 

smaller confidence intervals around reference values, and provides stable estimates of 

the reference values. 

* 

under development in U.S. 


A225



B-184 

Prognostic Utility of Combination of High-Sensitivity Troponin T and 

N-Terminal Pro-B-Type Natriuretic Peptide in Patients with Unstable 

Angina and Non-ST-Segment Elevation Myocardial Infarction 

F. Kitagawa, A. Kuno, J. Takeda, M. Saito, T. Hashimoto, S. Matsui, T. 

Ishikawa, H. Naruse, Y. Ozaki, J. Ishii. Fujita Health University, Toyoake, 

Japan 

We prospectively evaluated the prognostic value of a combined use of high-sensitivity 

troponin T (hsTnT) and N-terminal pro-B-type natriuretic peptide (NT-proBNP) in 

patients with unstable angina and non-ST-segment elevation myocardial infarction 

(UA/NSTEMI). We measured serum concentrations of hsTnT, heart-type fatty-acid 

binding protein (H-FABP) and NT-proBNP in 248 patients admitted to our coronary 

care unit for UA/NSTEMI within 6 hours after the onset of chest symptom, and 

followed for 12months after admission. Result: There was a higher positive rate for 

hsTnT (>14 pg/mL) than that for H-FABP (≥6.2 ng/mL) in 69 NSTEMI patients (82.9% 

and 54.3%, P =0.0005). During a 12-month follow-up period, there were 20 (8.1%) 

cardiac events (4 cardiac deaths, 6 readmissions for acute coronary syndrome and 

10 readmissions for worsening heart failure). In a stepwise Cox proportional hazard 

analysis including 15 clinical and biochemical variables, both hsTnT (relative risk per 

10-fold increment = 1.98, P = 0.04) and NT-proBNP (4.00 per 10-fold increment, P = 

0.001), but not H-FABP, were independently associated with cardiac events. HsTnT 

> median value of 13 pg/mL and/or NT-proBNP > median value of 192 pg/mL were 

associated with increased cardiac mortality and morbidity rates (Table). Conclusions: 

HsTnT may have a higher sensitivity than H-FABP for diagnosing NSEMI within 6 

hours after the onset. The combination of hsTnT and NT-proBNP measurements may 

effectively stratify patients with UA/NSTEMI with 6 hours after the onset. 

Cardiac mortality and morbidity rates according to hsTnT and/or NT-proBNP 

- - + + 

HsTnT >13pg/mL 

- + - + P value 

NT-proBNP >192pg/mL 

n = 86 n = 42 n = 38 n = 82 

Cardiac mortality rate (%) 0 0 0 4.9 0.02 

Cardiac event rate (%) 0 0 7.9 20.7



Conclusion: We conclude that hscTnT assay had increased sensitivity to detect small 

amounts of circulating cTnT in a substantial fraction of patients with exercise-induced 

cardiac ischemia. Further prospective studies using fresh patient samples are needed 

to determine whether hscTnT can be a useful diagnostic and/or prognostic biomarker 

for cardiac ischemia. 

B-190 

Survey of cardiac troponin concentrations in a hospital and community 

environment 

G. Koerbin, J. M. Potter, J. Kerrigan, E. Southcott, A. Simpson, P. E. 

Hickman. ACT Pathology, Canberra, Australia 

B-189 

Novel Insights and Reference Intervals of Cardiac Troponin I in a 

Healthy Neonatal and Pediatric Population 

S. R. Delaney 1 , J. A. Simpson 2 , M. Allwood 2 , A. H. Cohen 3 , D. A. 

Colantonio 1 , K. Adeli 1 . 1 Hospital for Sick Children, Toronto, ON, Canada, 

2 

University of Guelph, Guelph, ON, Canada, 3 University of Toronto, 

Toronto, ON, Canada 

Objectives: Cardiac Troponin I (cTnI) is routinely used to access cardiac injury, with 

the recommended use of a decision limit at the 99th percentile. As the sensitivity 

of cTnI assays increase, interpretation of marginally elevated levels becomes 

increasingly difficult. Establishing accurate baseline cTnI levels in a pediatric 

population is essential for appropriate clinical management. The aim of this study 

was to determine the 99th percentile using a healthy pediatric population, as well as to 

elucidate the forms of cTnI observed in the neonatal period. 

Methods: Blood samples, medical history and current health status measures were 

collected from 772 healthy and ethnically diverse children, ages birth to 18 years. cTnI 

was measured on the Abbott ARCHITECT i2000 system; the LoD was 10 ng/L. Nonparametric 

methods were used to establish the 99th percentile for the decision limit. 

Western blot analysis was performed to determine if high levels of cTnI observed in 

the neonatal period was intact cTnI, an interferant, a cross reaction against skeletal 

troponin, or cTnI complexes. 

Results: Three age partitions were determined and statistically verified; no difference 

in cTnI concentration between sexes was observed (Figure 1). The 99th percentile 

decision limits are: 968 ng/L (birth - 15 days); 59 (15 days - 3 months); 21 ng/L (3 

months - 19 years). Western blot analysis demonstrated that intact cTnI was present 

in neonatal samples; the presence of other forms of troponin were also determined. 

Conclusions: This study is the first to demonstrate cTnI trends in a healthy neonatal 

and pediatric population. We observed that cTnI levels are significantly higher 

from birth to < 15 days and gradually taper off to adult levels after 3 months of 

age. Biochemical explanations for high cTnI levels in the neonatal population were 

explored. These results have important clinical implications when assessing neonatal 

and pediatric patients with cardiac abnormalities. 

INTRODUCTION: Troponin is a core element of the diagnosis of MI. However, 

high-sensitivity assays have shown that most normal persons have detectable troponin 

present in their blood, indicating that troponin is not always an index of myocardial 

necrosis. Data is available on troponin concentrations in healthy persons, but none on 

troponin concentration in persons who are ill with non-cardiac illnesses. 

MATERIALS AND METHIODS: In an ethics approved study for a 24h period we 

collected all blood samples submitted to ACT Pathology from The Canberra Hospital 

and community collection centres and measured TnI using the pre commercial 

Abbott ARCHITECT STAT hs-cTnI assay and hsTnT using the Roche Elecsys 

e411 instrumentation. Of the 1076 patient samples (552 female, 524 male) deemed 

appropriate for testing, 844 (431 female, 413 male) were analysed for TnI and TnT. 

Of those 844, 818 hsTnI and 805 hsTnT results were obtained 

RESULTS: The range and median TnI concentrations were 0.6 - 2615 ng/L, 29.2 

ng/L ( 31 CCU patients); 1.5 - 29500 ng/L, 17.9 ng/L (39 ICU patients);



molecular weight and cytoplasmic location, H-FABP is released quickly into 

the circulation after myocardial injury. This protein is an early indicator of acute 

myocardial infarction in man. Cardiac Troponin I (cTnI), a late onset biomarker, is 

the current gold standard marker for myocardial infarction. It is released from cardiac 

myocytes during necrosis, causing an increase in circulating levels from 5-6 hours 

after the event. During release of cTnI from the sarcomere into the bloodstream, 

the protein undergoes proteolytic digestion; therefore antibodies developed to 

determine the circulating concentration of cTnI must bind to certain key epitopes. 

It has been reported that the assessment of H-FABP in combination with cTnI is a 

reliable diagnostic tool for the early diagnosis of myocardial infarction/acute coronary 

syndrome and also a valuable rule-out test for patients presenting at 3 to 6 hours after 

chest pain onset. 

Relevance: The aim of this study was to develop highly sensitive and specific 

monoclonal antibodies for H-FABP and relevant cTnI epitopes respectively. This is of 

value for the development of immunoassays applicable to the study of these cardiac 

biomarkers in clinical settings. 

Methodology: Sheep were immunized with the appropriate immunogen, either 

1) recombinant HFABP produced in E.Coli, or 2) native cTnI. Lymphocytes were 

collected and fused with heteromyeloma cells. Supernatants from the resulting anti- 

HFABP hybridomas were screened for the presence of H-FABP specific antibodies 

using the other eight members of the FABP family in negative selection ELISA based 

assays. Supernatants from the resulting anti-cTnI hybridomas were screened for 

the presence of cTnI specific antibody using whole molecule, native cTnI. Positive 

hybridomas were cloned to produce stable monoclonal hybridomas. Antibody was 

extracted from supernatants via Protein A purification. In addition, epitope mapping 

was carried out for all cTnI purified antibodies using non-overlapping 20-mer 

fragments of the cTnI primary amino acid sequence to elucidate the region accessed 

by each clone. 

Results: From the monoclonal antibodies developed for the detection of H-FABP, 

a sandwich pair has been identified which was H-FABP specific presenting cross 

reactivity



were >0.92 from a Receiver Operating Characteristic (ROC) curve for all 3 tube types 

at each time point tested. The mean interference with HAMA and RF samples was 

-2.8% and -3.4% respectively. 

Conclusion: These results demonstrate that the ARCHITECT STAT High Sensitive 

Troponin-I assay is a precise and highly sensitive method for measuring troponin I 

in human serum, lithium heparin plasma or K2 EDTA plasma on a high throughput 

analyzer. 

B-194 

Absolute and Relative Delta Values and their Impact on the Diagnostic 

Accuracy of ARCHITECT® STAT High Sensitive Immunoassay for 

Troponin-I 

J. C. Badciong 1 , M. A. Rosales 1 , J. M. Goldberg 1 , S. Du 1 , J. L. Rogers 1 , 

J. L. Yen 1 , K. Grasso 1 , D. Wiesner 1 , R. El Kouhen 1 , F. S. Apple 2 , W. J. 

Castellani 3 , M. Petruso 4 . 1 Abbott Laboratories, Abbott Park, IL, 2 Hennepin 

County Medical Center and Minneapolis Medical Research Foundation, 

Minneapolis, MN, 3 Hershey Medical Center, Hershey, PA, 4 Nationwide 

Laboratory Services, Fort Lauderdale, FL 

Introduction: The analytical sensitivity of the ARCHITECT STAT High Sensitive 

Troponin-I * assay allows reliable measurement of cardiac troponin (cTnI) in the 

majority of healthy individuals. The current universal definition of myocardial 

infarction (MI) supports the use of a change in cTnI concentration (delta [δ] value), 

in combination with the 99th percentile value, to improve the clinical specificity 

of troponin assays as an aid in the diagnosis of MI. Current literature suggests the 

optimal δ may be expressed as: percent change, absolute value of percent change, 

concentration change, and absolute value of concentration change, with or without 

consideration of 99th percentile value(s). The objective of this study was to evaluate 

differences in diagnostic accuracy resulting from the use of multiple methods for 

determining δ values for the ARCHITECT STAT High Sensitive Troponin-I assay. 

Methods: Our clinical study was conducted using an intended use population 

(n=1,101 subjects, including 130 adjudicated MIs. Three serial collections (0-2, 

2-4, and 4-9 hours post Emergency Department presentation) were made in serum 

separator, lithium heparin plasma separator, and K2 EDTA tubes. The δ value was 

calculated between admission draw and 2-4 hours draw (T1δ) and between admission 

draw and 4-9 hours draw (T2δ). Receiver operator characteristic (ROC) curves were 

constructed for different δ definitions: percent change = (y-x)/x*100, absolute value 

of percent change = abs [(y-x)/x*100], concentration change = y-x, and absolute value 

of concentration change = abs (y-x). Specificity was calculated at various δ values and 

values which resulted in a balance between specificity and sensitivity are described 

in the results. 

Results: The results from different tube types were comparable. Results from lithium 

heparin specimens are summarized below. For the T1δ values the area under the 

curve (AUC) was 0.7751 and specificity was 91.18% using a 50% increase in cTnI 

concentration change criteria; AUC was 0.7503 and specificity was 88.46% using a 

50% absolute change criteria (increase or decrease); AUC was 0.8254 and specificity 

was 94.68% using a 12 pg/mL increase in cTnI concentration change criteria; and 

AUC was 0.9550 and specificity was 92.48% using a 12 pg/mL absolute change 

criteria (increase or decrease) to define clinical significant changes. For the T2δ 

values AUC was 0.8206 and specificity was 87.29% using a 50% increase in cTnI 

concentration change criteria; AUC was 0.8279 and specificity was 84.71% using a 

50% absolute change criteria (increase or decrease); AUC was 0.8564 and specificity 

was 92.14% using a 12 pg/mL increase in cTnI concentration change criteria, and 

AUC was 0.9636 and specificity was 89.86% using a 12 pg/mL absolute change 

criteria (increase or decrease) to define clinical significant changes.The specificity 

using the overall 99th percentile cutoff (26.2 pg/mL) was calculated to be 83.76% at 

admission draw, 83.72% at 2-4 hours and 80.72% at 4-9 hours. 

Conclusion: The use of delta values may be used as a tool to improve specificity. The 

use of an absolute concentration change resulted in the highest AUC value. 

*under development in U.S. 


B-195 

Cardiac biomarkers measurement in plasma for early detection of 

cardiotoxicity in patients undergoing chemotherapy 

O. Rodriguez Fraga, T. López Fernandez, M. Canales, J. Feliu, E. Ramirez, 

J. López-Sendon, A. Buño Soto. University Hospital La Paz, Madrid, Spain 

Background: Chemotherapy is frequently complicated by the development of 

cardiotoxicity. Image techniques can measure left ventricular ejection fraction (LVEF) 

and other parameters for early detection 

like global strain longitudinal (GSL) are also used in the assessment of potential 

cardiotoxicity from chemotherapy. Cardiac biomarkers can detect myocardial injury 

and left ventricular dysfunction and limited evidence suggests that may be important 

predictors of cardiotoxicity during chemotherapy. 

Methods: We included 73 adult patients from Oncology and Haematology Services 

undergoing chemotherapy with potential cardiotoxicity (trastuzumab, anthracyclines, 

ciclophosphamide, iphosphamide or sunitinib). Ethical approval was obtained. 

Cardiac biomarkers hs-cTnT, c-TnI and pro-BNP were measured additionally patient 

history, physical symptoms and cardiac events (heart failure, LVD, sudden death, or 

arrhythmia) were documented. These are preliminary results of a 2 years follow-up 

multicenter study. Transthoracic echocardiograms were performed at baseline and 6 

months to measure LVEF and GSL. Blood samples were obtained at baseline, 21d, 

3m and 6m. Chemioluminiscence assays were used for biomarkers: hs-cTnT (Roche 

Elecsys) and c-TnI and NT-proBNP (Siemens Vista) and 99 th percentile (P99) used 

as cut-off (hs-cTnT: 14 pg/mL CV=10% and c-TnI 27 pg/mL CV=7.7%). According 

to image techniques, cardiotoxicity was defined as: LVEF decrease >10% without or 

>5% with heart failure to a value 10% to a value < -18%. 

Results: 73 patients (female 78,1% , mean age 55.1 years) with lymphoma (n=28) 

or breast cancer (n=45) were enrolled. Anthracyclines were used in 96,6% of 

patients. The incidence of cardiotoxicity using LVEF criteria was 5,5% (decreased 

from baseline 64,1% to 6m 60,2%) and GSL 28% (-18.8% to -17.1%). Concordance 

between cardiotoxicity diagnosis by SGL and FEVI was 74%. Maximum value 

occurred at third month for both troponins (media value for hs-cTnT at baseline 8,52 

pg/mL, 21d 10,46 pg/mL, 3m 17,63 pg/mL and 6m 14,51 pg/mL and for c-TnI 18,4 

pg/mL, 19,5 pg/mL, 32,7 pg/mL and 25,6 pg/mL 

respectively); using P99 as cut-off, hs-cTnT always identified additional patients 

when compared to c-TnI although no significant differences were found. Percentage 

of positive troponin values (>P99) were higher in patients with cardiotoxicity in both 

groups (LVEF and GSL). Concordance at 6m between hs-cTnT and LVEF and SGL 

were 54,8% and 64%. In both cases hs-cTnT was positive in 42% and 36% without 

cardiotoxicity. For c-TnI we observed 75,3% concordance defined by LVEF and a 70% 

by GSL. No significant relation was observed with NT-proBNP and cardiotoxicity. 

Conclusions: Cardiotoxicity incidence at 6 month follow-up GSL image is higher 

than LVEF. Increased hs-cTnT and c-TnI concentrations occurred in the cardiotoxicity 

group with a maximum concentration at third month. Hs-cTnT identifies more patients 

with cardiac injury than conventional c-TnI. We couldn´t establish a relation between 

concentrations of NT-proBNP and cardiotoxicity Use of myocardial deformation 

imaging (SLG) and cardiac biomarkers (hs-cTnT) may enable an early detection of 

cardiotoxicity in subclinical patients. 

B-196 

Use Of Novel Plasma Biomarkers To Predict Hospitalization in 

Chronic Heart Failure Patients 

K. M. Harris 1 , S. S. Gottlieb 2 , D. S. Krantz 1 , J. Todd 3 , J. Estis 3 , V. Torres 3 , K. 

Whittaker 1 , H. Rebuck 2 , A. J. Wawrzyniak 4 , R. H. Christenson 2 . 1 USUHS, 

Bethesda, MD, 2 Univ of Maryland Sch of Med, Baltimore, MD, 3 Singulex, 

Alameda, CA, 4 University of Miami, Miami, FL 

Background: Prognosticating which heart failure (HF) patients (pts) will progress 

to adverse outcomes the fastest is clinically important and financially advantageous 

in the era of the Patient Protection and the Affordable Care Act. Many biomarkers 

are prognostic in HF pts, but it is unclear which ones (or combinations) are the most 

useful. We investigated the prognostic performance of novel & established biomarkers 

In a cohort of pts diagnosed with NYHA 2/3 systolic HF and EF



IL-17A, IL-1B, IL-10, MMP9) and VEGF. BNP and hs-CRP where measured with the 

Alere and Siemens Vista assays, respectively. The other biomarkers utilized the high 

sensitivity Erenna System (Singulex). 

Results: Over 2.4±1.0 yrs follow-up, 66 pts (51%) died or were hospitalized for any 

cause and 33 (26%) were hospitalized for HF. Using ROC area and OR calculations 

(by median), ET, hs-cTnI, BNP, TNF-α and VEGF predicted HF hospitalization 

(table); after adjusting for age, sex and other statistically significant biomarkers, ET, 

hsTnI and TNF-α remained significant (table *OR). Separate analysis showed that 

ET, BNP and TNF-α all predicted all cause hospitalization/death (ROC areas 0.63, 

0.62, 0.61, respectively [all p



the range 6.9-107ng/mL. Both the routine (n=225, bias -1.93, 95%CI -2.28 to -1.57ng/ 

mL) and STAT (n=225 bias -2.552, 95%CI -2.959 to -2.145ng/mL) assays correlated 

well with the Galectin-3 ELISA. 120 samples were obtained from apparently healthy 

individuals. The median age was 42 years, (interquartile range 18-69) years and no 

difference in age between gender groups (p=0.6163). The upper 97.5th percentile 

was 34.42ng/mL and 33.46ng/mL for the routine and STAT assays respectively. 

The 97.5 th percentile increased There was no significant difference in concentrations 

between males and females for either the routine (p=0.772) or STAT (p=0.835) assay. 

CONCLUSIONS: Both the Galectin-3 Routine and STAT assays determined on 

the Abbott Architect i2000 SR 

demonstrate excellent analytical performance for the 

determination of Galectin-3. Further clinical studies are required to demonstrate the 

prognostic potential of this novel marker in patients with accelerated fibrotic CHF. 

B-202 

The performance characteristics of the new high sensitivity Abbott 

cardiac troponin I assay. 

P. O. Collinson 1 , D. Gaze 1 , G. Wilson 2 . 1 St George’s Hospital, London, 

United Kingdom, 2 St Mary’s Hospital, London, United Kingdom 

Objectives. To determine the imprecision profile, 99th percentile and diagnostic 

efficiency of a new high sensitivity cardiac troponin I (cTnI) assay. 

Methods: Total imprecision was assessed by following CLSI protocol EP15-A.14 

serum pools prepared from sera of known high cardiac troponin concentrations were 

adjusted by dilution with serum considered to be troponin free. Determination of the 

99th-percentile reference value examined a fully characterized population that had 

undergone non-invasive cardiac imaging. Subjects >45 years old were randomly 

selected from seven representative local community practices. Details were collected 

by questionnaires plus blood pressure measurement, spirometry, electrocardiography 

(ECG) and echocardiography. They were venesected for fasting serum glucose, and 

creatinine. Diagnostic accuracy utilised samples from the point of care arm of the 

RATPAC trial (Randomised Assessment of Treatment using Panel Assay of Cardiac 

markers), set in the emergency departments of six hospitals. Prospective admissions 

with chest pain and a non-diagnostic electrocardiogram were randomised to point 

of care assessment or conventional management. Blood samples were taken on 

admission and 90 minutes from admission. An additional blood sample was taken 

at admission and 90 minutes from admission, separated and the serum stored frozen 

until subsequent analysis. Samples were analysed for cTnI by 4 methods, the Architect 

hsTnI (A) (Abbott Diagnostics), range 1.1-50,000 ng/L 10% CV 4.7ng/L; the Stratus 

CS (CS) (Siemens Healthcare Diagnostics), range 30-50,000 ng/L 10% CV 60ng/L; 

the Beckman AccuTnI enhanced (B) (Access 2 , Beckman-Coulter) range 1 - 100,000 

ng/L, 10% CV 30 ng/L, the Siemens Ultra (S) (ADVIA Centaur, Siemens Healthcare 

Diagnostics), range.6 - 50,000 ng/L, 10% CV 30 ng/L. and cardiac troponin T (cTnT) 

by the Roche high sensitivity cardiac troponin T assay hs-cTnT (Elecsys 2010, Roche 

diagnostics), range 3 - 10,000ng/L, 10% CV 13ng/L. Diagnosis was based on the 

universal definition of myocardial infarction utilising laboratory measurements of 

cardiac troponin performed at the participating sites together with measurements 

performed in a core laboratory. Diagnostic accuracy was compared by construction of 

receiver operator characteristic curves against the universal definition of myocardial 

infarction (MI) utilising laboratory measurements of cardiac troponin performed at 

the participating sites and measurements performed in a core laboratory. 

Results: Total imprecision was from 4% (1262 ng/L) to 12.1% (4.4 ng/L) with within 

run imprecision



Results: The mean amount (AUC 0-96h 

) of CK-MB and cTnT released for 96 h in the 

patients with valve operation were 2621.8 h·ng/mL and 119.2 h·pg/mL which were 

significantly larger than those in the patients with CABG or septal operation (P



B-208 

Diagnostic Accuracy of the Ortho-Clinical Diagnostics VITROS ES 

cTnI Assay 

M. M. Murakami 1 , S. E. Nelson 1 , Y. Sandoval 1 , S. W. Smith 1 , K. M. 

Schulz 1 , L. A. Pearce 2 , F. S. Apple 1 . 1 Hennepin County Medical Center, 

Minneapolis, MN, 2 Biostatistical Consulting, Minot, ND 

Background: The diagnosis of acute myocardial infarction (MI) is based on clinical 

factors and an increased cardiac troponin (cTn), with a rising and /or falling cTn 

pattern required. The use of a delta (change) value may play a role in optimizing 

diagnostic specificity. The goal of this study was to validate the diagnostic accuracy 

of the Ortho-Clinical Diagnostics (OCD) Vitros ES cTnI assay based on a) 99th 

percentile and b) the delta values (absolute concentration differences) between 0-3h 

and 0-6h serial blood draws. 

Methods: We reviewed 1271 patients presenting with symptoms suggestive of 

ischemia presenting to the emergency department with serial cTnI concentrations. 

Plasma (heparin) was obtained at presentation and 3 (n=628), 6 (n =958) and/or 9 

(n=951) h. cTnI was measured by the OCD assay (LoD, 12 ng/L; 99th percentile 34 

ng/L, 10%CV). Charts with any increased cTnI were adjudicated for MI, predicated 

on the Universal Definition of MI guidelines. 

Results: Type 1 MI was diagnosed in 8% (n=33 STEMI; n=69 NSTEMI) and type 2 

MI in 17% (total MI rate 25%). At 0h, similar proportions of type 1 STEMI (45%), 

NSTEMI (55%) and type 2 MI (42%) were increased above the 99 th percentile (p=0.2). 

The table demonstrates diagnostic accuracy findings. Clinical sensitivity improved 

over serial testing, from 46% at 0h to 96% at 6h. Specificity was 93% at presentation 

(0h), and the delta change values at 3 and 6h did not improve diagnostic accuracy 

(specificity 90-91%) compared to the individual timed cTnI finding at baseline. 

Conclusions: We confirm that the contemporary OCD Vitros ES cTnI assay is an 

important diagnostic aid in ruling in/out acute MI for both type 1 and 2 MIs using the 

99 th percentile. The delta change value did not improve diagnostic utility to the assay 

which already provided a high clinical specificity at baseline. 

Diagnostic Accuracy - VITROS ES cTnI 

%Sensitivity % Specificity LR+ LR- ROC AUC 

Time 

(95%CI) (95%CI) (95%CI) (95%CI) (95%CI) 

6.3 (4.9, 0.58 (0.5, 0.73 (0.70, 

0h (>34 ng/L) 46 (40, 52) 93 (91, 94) 

8.1 0.6) 0.75) 

6.5 (5.1, 0.13 0.08, 0.91 (0.89, 

3h (>34 ng/L) 89 (83, 93) 86 (83, 89) 

8.3) 0.2) 

7.9 (6.5, 

6h (>34 ng/L) 96 (93, 98) 88 (85, 90) 

9.6) 

0-3h (30 ng/L) abs 

-- 91 (88, 93) -- -- 

conc delta 

0-6h (20 ng/L) abs 

-- 90 (88, 92) -- -- 

conc delta 

B-209 

0.05 (0.02, 

0.09) 

0.93) 

0.94 (0.93, 

0.96) 

0.92 (0.90, 

0.94) 

0.94 (0.92, 

0.95) 

The biological characteristics of IL-6, IL-17A and TNF-α for 

monitoring patients at risk for developing cardiovascular disease. 

A. H. Wu 1 , J. Estis 2 , V. Torres 2 , J. Todd 2 . 1 University of California, San 

Francisco, San Francisco, CA, 2 Singulex, Inc., Alameda, CA 

Background: Atherosclerosis research has proven that chronic inflammation of 

the blood vessels plays a major role in the initiation and progression of the disease 

and plasma cytokine concentrations can risk stratify both primary and secondary 

prevention patients for future cardiovascular. Their use in clinical practice requires 

documentation of analytical and biological characteristics. We determined preliminary 

reference ranges, biological variability, and magnitude of elevation of plasma IL-6, 

IL-17A and TNF-α in heart failure (HF) and patients. 

Methods: Reference range (120 healthy subjects), biological variability (25 healthy 

subjects, 6 weekly samples and 17 at risk CVD patients, 3 samples over 9 mos), HF 

(30 NYHA class I-III subjects & 30 age/sex matched controls). Assays- IL-6, IL-17A, 

TNF-α, and cTnI (high-sensitivity lab developed tests run on the ERENNA System 

in a CLIA licensed lab) hsCRP & NT-proBNP, Roche. Biological variability (or 

reference change values, RCVs) was determined using nested ANOVA. The protocol 

was approved by a local ethics committee. 

Results: The findings of this study are presented in the table. The IL-6, IL-17A and 

TNF-α biomarkers were quantifiable in all healthy volunteers and we were able to 

establish 95/99%tile reference range cutpoints. The short- and long-term biological 

variability of these biomarkers in both healthy and CVD at risk patients was low 

and similar to values previously published for cTnI and hs-CRP; indicating that 

serial monitoring may be more appropriate than the use of reference ranges. These 

biomarkers (as well as hsCRP & NT-proBNP; p0.06 ug/L, we elected to measure our false positive 

rates of troponins using the usual Becton Dickinson (Franklin Lakes, NJ) PST and the 

Becton Dickinson rapid serum tube (RST). 

Materials and Methods: All troponin testing was performed on either of two 

Beckman DxI analyzers (Beckman Coulter, Fullerton, CA) . For Nov 26-Dec 24 

2012, RST tubes were made available for clinical usage in our emergency department, 

cardiology and cardiovascular units. No special instructions were provided to the 

nursing staff who drew many of the specimens. As there was ready access to the PST, 

we also obtained plasma specimens for troponin analysis. On a daily basis, previously 

analyzed PST and RST specimens were gathered as specified in the Table’s initial 

troponin levels. These specimens were recentrifuged and reanalyzed. Any specimen 

with a subsequent troponin



Objective: We compared the analytical performance of 2 high sensitivity (hs)-cTn 

assays - a pre-market prototype hs-troponin I (hsTnI, Abbott Diagnostics) and an 

existing in service hs-troponin T (hsTnT, Roche Diagnostics). 

Design and Methods: Serum from 695 subjects (298 female) who had been tested for 

hsTnT was analyzed for hsTnI. The concordance of hs-TnI values to the corresponding 

hs-TnT band was calculated. The stated limit of detection (LoD) for hs-TnT is 5 ng/L 

and 1.2 ng/L for hs-TnI (ClinChem 2012;58:59). The TnT cut point for AMI is 100 

ng/L (package insert). The 99 th centile upper reference limit (99C) for healthy subjects 

(< 65 years) previously determined was 15 ng/L for hs-TnT (AACC Annual Meeting 

2010 Abstract C-88) and 21 ng/L for hs-TnI (AACC Annual Meeting 2012 Abstract 

A-23). Statistical analyses were performed on MedCalc v12.0 (Mariakerke, Belgium). 

Results: The study subjects were stratified according to their hs-TnT concentrations: 

Group A (normal - below 15 ng/L), Group B (elevated - 16-100 ng/L), Group C (AMI 

cut point – greater than 100 ng/L). 

Table. 

Distribution of study subjects by hs-troponin concentrations 

Study subjects 

hs- troponin ng/L 

Group 

Age (yrs) 

range 

mean (95% 

CI) 

N hs-TnT hs-TnI 

median (95% median (95% 

total 

CI) 

CI) 

(female) 

IQR IQR 

15-99 

10.0* (9.0- 

A 

7.1** (6.5-8.2) 

65.9 (64.3- 268 (125) 11.0) 

(normal) 

4.0-13.6 

67.5) 

7.0-12.0 

22-99 

38.0 (34.0- 35.9 (30.3- 

B 

74.9 (72.7- 241 (91) 42.0) 39.9) 

(elevated) 

76.0) 

24.0-63.3 17.6-96.6 

C 

39-99 

256.5 (211- 620.3 (497- 

(AMI cut 71.6 (69.6- 186 (82) 339) 1000) 

point) 73.5) 

148-1330 194-6227 

*only 147 subjects (54.9%) with hs-TnT > LOD 

**only 260 subjects (97.0%) with hs-TnI > LOD 

TnT-TnI 

Concordance 

88.4% 

(31 increased 

TnI) 

71.0% 

(70 normal TnI) 

97.3% 

(5 normal TnI) 

There was close agreement in cTn values for Groups A and C. Notably, 95% (116/122) 

of subjects with hs-TnT below the LOD in Group A had detectable hs-TnI values and 

less than 1% of the samples had cTn concentrations above the instruments’ analytical 

measuring range. 

Conclusion: The hs-TnI is analytically more sensitive than hs-TnT (provides 

measurable values when hs-TnT is < LOD). There is strong concordance in hs-cTn 

results between these two troponin assays. Outcome studies are needed to clarify the 

clinical value of these hs-cTn assays in practice. 

B-212 

Development of Liquid Assays for the Measurement of Lipid Profile 

Components on the RX monaco Analyser 

L. Young, P. McGivern, P. Armstrong, J. Campbell, S. P. Fitzgerald. Randox 

Laboratories Limited, Crumlin, United Kingdom 

Introduction: Many clinicians continue to use total cholesterol and triglyceride 

levels as diagnostic markers for lipid disorders and cardiovascular risk. However, 

these parameters alone do not provide the necessary information required for accurate 

clinical assessment of an individual. It is now widely accepted that detailed lipoprotein 

information is required for accurate diagnosis and treatment of lipid disorders. 

Relevance: This study reports the development of five liquid assay kits with 

enhanced precision and assay range for the measurement of cholesterol, triglycerides, 

high density lipoprotein (HDL), low density lipoprotein (LDL), and lipoprotein(a) 

(Lp(a)) in serum and plasma. This is applicable to the fully automated bench top/ 

floor standing continuously loading RX monaco analyzer to facilitate the accurate 

assessment of cardiovascular risk. 

Methodology: In the cholesterol and triglycerides assays analyte levels are 

determined after enzymatic hydrolysis and oxidation. Both the HDL and LDL 

assays operate using a direct clearance method. The Lp(a) assay is a latex enhanced 

immunoturbidimetric assay. 

For all assays on the RX monaco the first result is generated after 14 minutes. Onboard 

and calibration stabilities were tested by storing two lots of reagent uncapped on 

the RX monaco analyser for a period of 28 days. Within-run and total precision were 

assessed by testing serum samples at defined medical decision levels, 2 replicates 

twice a day for 20 days. Correlation studies were conducted using commercially 

available assays. 

Results: For all the assays, the liquid reagents presented on-board and calibration 

stabilities of 28 days. The assays were found to be functionally sensitive to 

0.21mmol/L (cholesterol assay), 0.11mmol/L (triglycerides assay), 0.17mmol/L 

(HDL assay), 0.23mmol/L (LDL assay) and 6.18mg/dL (Lp(a) assay) and linear 

up to 16.97mmol/L, 13.09mmol/L , 4.28mmol/L, 18.34mmol/L and 103.89mg/dL 

respectively. The within-run and total precision for three different concentration levels 

typically had %C.V.’s ranging from



B-214 

Performance of a New Liquid Cardiac Markers Control with Extended 

2-8ºC Stability in a Dropper Vial Format for Utility in Both the Central 

Laboratory and at the Point-Of-Care 

B. Fernández, J. Starobin, P. Lenichek, S. Musngi, M. Ghadessi, M. Ban. 

Quantimetrix, Redondo Beach, CA 

Background: It is critical when measuring patient samples for indicators of disease 

that stable controls are used to validate instrument performance. Cardiac markers are 

used to diagnose and risk-stratify patients with acute coronary syndromes and other 

cardiovascular-related issues. Cardiac Troponin I (cTnI), N-terminal pro-natriuretic 

peptide (NT-ProBNP), B-type natriuretic peptide (BNP), and D-Dimer have been 

notoriously difficult to stabilize in a human serum based control format, requiring 

that the materials be lyophilized or frozen to provide adequate shelf-life and may only 

offer very limited 2-8ºC stability. 

Objective: To formulate an improved human serum derived cardiac markers control 

that exhibits extended 2-8ºC stability of at least 6 months for cTnI, NT-ProBNP, BNP 

and D-Dimer while allowing for the inclusion of other less-labile cardiac markers. 

Methods: A human serum derived matrix was formulated with preparations of cTnI, 

NT-ProBNP, BNP, and D-Dimer to clinically significant levels. Aliquots in plastic 

dropper vials and were stressed at 25 ºC and 37ºC for 6 days while remaining samples 

were maintained at -20 ºC and 2-8ºC for real-time analysis. The assays for cTnI, NT- 

ProBNP, and D-Dimer were performed on the Siemens Dimension® ExL, using 

the Kamiya K-assay® reagent for D-Dimer. The assays for BNP were performed on 

the Beckman Access® 2 using the Alere Triage® BNP reagent. The data was used to 

create an Arrhenius model allowing for the prediction of long-term stability. 

Results: 

Table 1: Stability Results 

Average Real-Time and Accelerated Stress Data Arrhenius Modeling (±20% Cutoff) 

Calculated 

Predicted 

Analyte Units Fresh 3 months 7 months 6 days 6 days @ 

Predicted 

Ea (cal/ 

-20ºC 

Value @ 4ºC @ 4ºC @ 25ºC 37ºC 

4ºC Stability 

mol) 

Stability 

1.024 1.078 0.82 0.68 

cTnI ng/mL 0.984 

25,495 12 months >> 10 years 

(+4%) (+10%) (-17%) (-31%) 

NT- 

ProBNP pg/mL 4385 4017 3795 4179 3712 

19,121 10 months >> 10 years 

(-8%) (-13%) (-5%) (-15%) 

2618 2272 2650 2531 

BNP pg/mL 2607 

10,838 10 months 5.8 years 

(0%) (-13%) (+2%) (-3%) 

2.93 

2.67 2.61 

D-Dimer μg/mL 2.76 

NA 

14,349 10 months 10 years 

(+6%) 

(-3%) (-5%) 

Conclusion: This liquid cardiac markers control formulation exhibits excellent 2-8ºC 

stability of up to 10 months when evaluated at a ±20% failure cutoff. The Arrhenius 

prediction is corroborated by the on-going real-time testing. The extended stability 

and dropper vial format is of particular convenience to the point-of-care testing format 

where samples can be thawed and ready to use without the need to use pipettes to 

deliver the sample. 

B-215 

Evaluation of a new STAT High Sensitive Troponin-I assay on the 

ARCHITECT i2000SR Instrument 

V. Juvent 1 , L. Lebeau 1 , J. Shih 2 , L. Lennartz 3 , P. Boudry 1 . 1 Centre Hospitalier 

Regional Boussu, Boussu, Belgium, 2 Abbott Laboratories, Abbott Park, IL, 

3 

Abbott, Wiesbaden, Germany 

Introduction: A new ARCHITECT high sensitive troponin-I assay has been developed 

that fulfills the requirements of the third universal definition of myocardial infarction 

(MI), which calls for rise and/or fall of Troponin levels with at least on value above 

the cut-off. Troponin is the preferred biomarker to be used in the diagnosis of MI and 

the cutoff should be the 99 th percentile of the upper reference limit of normal (ULN) 

with a precision at this cutoff of less the 10% total CV. The objective of this study 

was to evaluate the performance of the ARCHITECT STAT high sensitive Troponin-I 

(hsTnI) assay on the i2000 SR 

instrument in a routine laboratory and compare clinical 

samples to the routinely used ARCHITECT TnI assay. 

Methods: The ARCHITECT STAT High Sensitive Troponin-I is a double monoclonal 

antibody sandwich assay utilizing CMIA technology. Five day precision and 

verification of the LoB, LoD and LoQ were performed with guidance from CLSI 

guidelines EP5-A2 and AP17-A. The preliminary 99 th percentile URL was determined 

with 70 lithium heparin samples from a healthy population tested also for BNP, 

HbA1c and eGFR. One hundred ninety three lithium heparin samples from patients 

presenting with chest pain suspicious of acute coronary syndrome were used for a 

correlation study, comparing the previous ARCHITECT STAT Troponin-I assay with 

the new ARCHITECT STAT High Sensitive Troponin-I assay. 

Results. The total %CV from the 5-day precision protocol ranged from 2.6 to 3.9 

with sample concentrations ranging from19 pg/mL to 14032 pg/mL. The LoB, LoD 

and LoQ were verified to be 0.11 pg/mL, 0.5 pg/mL and 7.7 pg/mL, respectively. 

The %CV at 7.7 pg/mL was 10.6%. Using the ULN from the respective package 

inserts as the threshold, agreement between the routine ARCHITECT TnI and the high 

sensitive ARCHITECT assay was 94% with samples ranging from 0.5 to 20425 pg/ 

mL. Passing-Bablok analysis indicated a slope of 0.98. Altman Bland test showed an 

average % bias of -18%. 

In 71 samples from apparently healthy blood donors the mean (minimum, maximum) 

concentration for the hs TnI assay were 1.54 pg/mL, (0.1 to 26.5 pg/mL) with 

%HbA1c average at 5.3% (4.7 to 6.5%), BNP average of 26 pg/mL (10-4 to 114.3) 

and average MDRD eGFR of 93 ml/min/1.73 (36 to 169 ml/min/1.73). 66% of the 71 

healthy individuals had hs TnI values above the LoD of 0.5 pg/mL. 

Conclusion: The new ARCHITECT STAT High Sensitive Troponin-I assay fulfills 

the criteria for a high sensitive assay in regard to precision at 99 th percentile ULN. 

In apparently healthy individuals 66% had TnI levels over the limit of detection. 

The diagnosis of myocardial infarction as defined by the third universal definition of 

myocardial infarction is supported by the ARCHITECT hs TnI assay with improved 

precision at lower concentrations. 

B-216 

Analytical Evaluation of the ARCHITECT STAT High Sensitive 

Troponin-I Assay 

J. Lotz 1 , R. Lott 1 , L. Lennartz 2 , J. Shih 3 , K. Lackner 4 . 1 Institute for 

Clinical Chemistry and Laboratory Medicine, University Medical Center 

of the Johannes Gutenberg University Mainz, Mainz, Germany, 2 Abbott, 

Wiesbaden, Germany, 3 Abbott Laboratories, Abbott Park, IL, 4 Institute for 

Clinical Chemistry and Laboratory Medicine, University Medical Center 

of the Johannes Gutenberg University of Mainz, Mainz, Germany 

Introduction: The third universal definition of myocardial infarction (MI) calls for a 

risíng and/or falling pattern of Troponin (Tn) with at least one Tn measurement above 

the 99 th percentile upper limit of normal (ULN) for the confirmation of the diagnosis 

of myocardial infarction in a symptomatic chest pain population. High sensitive 

Troponin assays are now available with improved capability to support this definition. 

The objective of this study was to evaluate the analytical performance of the 

ARCHITECT STAT High Sensitive Troponin-I assay and to compare clinical sample 

results with the contemporary ARCHITECT STAT Troponin-I assay. 

Methods: The ARCHITCT STAT high sensitive Troponin-I assay is a double 

monoclonal antibody sandwich assay using CMIA technology on the ARCHITECT 

instrument. Five day precision, verification of LoB, LoD, LoQ, linearity and 

interference testing were performed with guidance from CLSI guideline EP5-A2, 

AP17-A, EP6-A and EP7-A. The 99 th percentile upper reference limit was determined 

using lithium heparin plasma from an apparently healthy population. Participants were 

further defined by medical history and BNP concentration. Comparison to the routine 

ARCHITECT method was performed by running 475 lithium heparin samples from 

patients being evaluated for myocardial infarction in parallel on the ARCHITECT 

systems connected to the automated laboratory solutions. 

Results: The performance of the assay was in agreement with the package insert 

data. Total %CVs from the 5 day precision study were



than 50%. Using the URL as threshold agreement between the current and the high 

sensitive ARCHITECT TnI assay was 94%, the precision of the new assay at low 

levels however is greatly improved, allowing for more confidence in diagnosis MI. 

B-217 

A simple single-enzyme two-reagent total homocysteine assay for 

widespread testing and screening 

plasma at 2-8C for at least 2 days. HF patients demonstrated significantly elevated 

ET compared to matched controls (Figure, 0.8-8.8 vs. 1.2-2.9 pg/mL; Mann Whitney 

p=0.001; OR = 5.2). 

Conclusions: These findings demonstrate that biologically active ET can be robustly 

measured in plasma with the use of a high sensitivity assay platform. Further studies 

are required to validate the clinical utility of ET alone and in combination with other 

biomarkers for the management of CVD patients. 

Y. Tan, S. Li, L. Tang-Hall, Q. Han, R. M. Hoffman. AntiCancer, Inc, San 

Diego, CA 

Background: Total plasma/serum homocysteine (tHCY) is an independent risk 

factor for cardiovascular disease and other serious diseases. Therefore, tHCY should 

be routinely measured like cholesterol. Current methods for tHCY measurement are 

applicable only to specific analyzers, are complex and expensive and therefore not 

suitable for clinical screening and routine testing. We have developed a 2-reagent 

single-enzyme tHCY assay for common automated analyzers. 

Methods: The protocol and principle of the two-reagent A/C HCY Assay is as follows: 

the Reagent I (RI) is a combination of a reducing reagent, homocysteine α γ-lyase, and 

a pre-chromophore consisting of a Schiff-based of N,N-dibutyl-p-phenylenediamine 

(DBPDA) and pyridoxal 5′-phosphate (PLP). When the sample (30 μL) of either 

plasma or serum is added to RI, the reduction of tHCY takes place and enzymatic 

reaction occurs thereby producing H 2 

S which binds to the pre-chromophore. Total 

time is 5 min. The second step consists of adding an oxidant in acid (potassium 

ferriccynide [K 3 

Fe(CN) 6 

]), the Reagent II (RII). The oxidation reaction takes place 

within 5 minutes. A colored product results which can be measured by absorbance 

at OD 660 nm or by fluorescence at Ex 660/Em 710 nm. The total time for the assay 

is 15 min. The throughput on Hitachi 912 Automatic Analyzer is 360 tests per hour, 

for example. 

Results: The assay takes 15 minutes. The 2-reagent assay was compared to a fourreagent 

enzymatic tHCY assay (FDA 510(k) 030765) for 125 plasma samples. The 

correlation coefficient was 0.99 and the slope was 1.0. The precisions of within and 

between assay were below 5% and 10%, respectively. The linearity of tHCY in the 

2-reagent assay was 3.7-45 μmol/L, and the detection limit was 3.7 μmol/L. The 

interferences of L-CYS, L-MET, lipid and protein were all below 10%. 

Conclusion: The 2-reagent tHCY assay has high precision and sensitivity and 

compares well with a more complex 4-reagent enzymatic tHCY test. The 2-reagent 

tHCY test is applicable to essentially any automated or manual analyzer. The 

simplicity and economy of the present 2-reagent tHCY test makes it advantageous 

over all commercial homocysteine assays currently available and therefore, for the 

first time, can enable widespread tHCY testing and screening. 

B-218 

Biologically Active (aa1-21) Endothelin-1 Is Robustly Measured in 

Human Plasma with a Highly Sensitive Single Molecule Counting 

Platform 

V. Torres, J. Estis, J. Felberg, J. Todd. Singulex, Alameda, CA 

Background: Since its discovery in 1989, plasma Endothelin-1 (ET) has been studied 

as a biomarker to risk stratify patients for developing CVD, especially heart failure 

(HF). Such studies have been hindered by the inability of assays to quantify the very 

low endogenous concentration of the biologically active 21 amino acid peptide. 

Objective : To develop a highly sensitive immunoassay for biologically active ET and 

characterize the concentrations of plasma ET in healthy volunteers and HF patients. 

Methods: Using single molecule counting technology on the Erenna® System 

we developed a paramagnetic-microparticle based sandwich immunoassay using 

monoclonals MAB3004 and MA3005 for quantifying plasma ET. Patients: under IRB 

approval and informed consent plasma was obtained from 29 HF (NYHA class I-III, 

median 63 yrs) patients and 30 age/sex matched controls as well as healthy volunteers 

(HV) to determine assay analytics, a preliminary reference range and sample stability 

estimates. 

Results: The analytical performance of the Erenna ET assay determined over 6 

independent assay runs was: LoD = 0.07 pg/mL, LLoQ = 0.33 pg/mL, dilutional 

linearity of neat non-spiked plasma samples was maintained to 0.31 pg/mL, and interassay 

precision (CV) 7% @ 1.2 pg/mL and 6% @ 1.8 pg/mL. ET was measurable in 

all plasma from HV (average 2.15 pg/mL; range 1.19-3.53 pg/mL) and was stable in 

B-219 

Prototype digital immunoassay for troponin I with sub-femtomolar 

sensitivity 

L. Chang 1 , P. Patel 1 , L. Song 1 , Y. Chen 1 , D. Hanlon 1 , K. Minnehan 1 , 

M. Gardel 1 , B. Pink 1 , L. York 1 , S. Sullivan 1 , R. Meyer 1 , B. Flaherty 1 , 

J. Christopher 1 , D. H. Wilson 1 , M. Conrad 2 , P. Jarolim 2 . 1 Quanterix 

Corporation, Cambridge, MA, 2 Brigham and Women’s Hospital, Harvard 

Medical School, Boston, MA 

Background: High-sensitivity cardiac troponin I (cTnI) measurement offers a 

promising new tool for early detection and monitoring of cardiovascular disease. The 

ability to reliably assign TnI values to all normal subjects tested represents a newly 

desired assay capability in many applications. We report preliminary analytical data 

from a prototype digital immunoassay for serum TnI that is capable of 2-3 logs greater 

sensitivity than the clinically used cTn assays and 1-2 logs greater sensitivity than 

the latest high-sensitivity troponin assays, most of which are not yet commercially 

available. 

Method: Reagents were developed for a paramagnetic bead-based ELISA for use in 

high-density microarrays. Individual anti-cTnI capture-beads with immunocomplexes 

and associated enzyme labels (β-galactosidase) were individually isolated within 

the microarrays and interrogated for presence of enzyme label. Wells containing an 

enzyme immunocomplex convert substrate to a fluorescent product, which becomes 

concentrated in femtoliter volume microwells. This permits imaging of wells 

containing single molecules of label with a CCD camera. Poisson statistics predict that 

each well will contain either one cTnI molecule or no cTnI molecules when the ratio 

of bound cTnI per bead is much less than one. Raw signal is recorded as “% active 

wells”, which is converted to “average enzymes/bead” to correct for non-Poisson 

behavior at higher cTnI concentrations. The output is related to a standard curve and 

converted to a cTnI concentration in the sample. The digital troponin I immunoassay 

was evaluated for recovery, linearity, precision, analytical sensitivity and ability to 

measure cTnI in normal serum samples. Discrimination of normal subjects and those 

with mild to moderate heart failure was also preliminarily assessed. 

Results: Limit of Detection (3SD method) was estimated as 0.017 pg/mL (0.7 fM) 

across 10 experiments and 2 reagent lots. Linearity conducted per CLSI EP6-A gave 

close agreement with linear fitting model (R2 = 0.989), with average deviation from 

linearity of 11%. Average recovery of NIST cTnI spiked into 4 serum samples was 

113%. cTnI values from 46 normal control samples ranged from 0.13 to 12.25 pg/ 

mL, with mean, median, 75 percentile of 1.92, 1.05, and 2.36 pg/mL respectively. 

Total imprecision from a normal serum sample tested on four separate runs was 9.5% 

CV with a mean cTnI of 1.45 pg/mL. cTnI values from 33 mild to moderate heart 

failure patients (NYHA classification II and III) ranged from 2.27 to 388 pg/mL, 

with a median of 12.52 pg/mL. The cohort of heart failure samples were significantly 

elevated relative to the normals (p = 0.0067). 




Conclusion: The assay demonstrated the capability of reliably quantifying cTnI in 

normal individuals, with a LoD well below the lowest normal sample tested. These 

data suggest the assay could represent an advance in sensitivity relative to current 

high-sensitivity cTnI methods, and could be a new enabling tool for high definition 

cTnI measurement. 

B-220 

Multicentre analytical comparison between Abbott ARCHITECT 

STAT cTnI and hsTnI assays 

P. Kavsak 1 , L. Clark 1 , R. Pickersgill 2 , J. Beattie 3 , E. Millar 1 , M. Napoleone 2 , 

N. Caruso 3 , A. Don-Wauchope 1 . 1 Juravinski Hospital and Cancer Centre, 

Hamilton, ON, Canada, 2 St. Joseph’s Healthcare, Hamilton, ON, Canada, 

3 

Hamilton General Hospital, Hamilton, ON, Canada 

BACKGROUND: An important aspect for laboratories considering switching to a 

high-sensitivity cardiac troponin (hs-cTn) assay is the analytical agreement between 

the same manufacturer’s contemporary cTn assay and the new hs-cTn assay across 

different platforms and sites. We assessed agreement and imprecision between 

the Abbott ARCHITECT STAT cTnI (contemporary) and the hsTnI assays in a 

multicentre setting. 

METHODS: Method comparison between cTnI and hsTnI assays was performed on 

20 different pooled EDTA plasma samples analyzed at 3 different hospitals (A,B,C) 

on 4 instruments (A-site:2x16200; B-site:1x8200, C-site:1x8200). The agreement 

amongst platforms was assessed by averaging the results obtained for each sample 

and subtracting each instrument result from the average and then dividing the absolute 

difference by the average result to obtain a %difference. The average cTnI and hsTnI 

concentrations from the 20 samples were also subjected to Passing&Bablok regression 

analysis. The analytical imprecision (over 2-months) was determined using an inhouse 

manufactured low cTnI pooled material for both assays as well as Abbott’s low 

QC material for the hsTnI assay. 

RESULTS: The average %difference in concentrations of the 20 samples across the 4 

platforms (80 results; range=5-162ng/L) was 3.1% (%difference range=0.0-8.7%) for 

hsTnI as compared to 30.4% (%difference range=0-300%) for the contemporary cTnI 

assay (80 results; range=0-122ng/L). The hsTnI concentrations were approximately 

1/3 rd higher than cTnI (see Figure). The in-house low QC material weighted average 

concentration (n=574) for cTnI was 32ng/L with the CV(pooled)=15.1%. The same 

material weighted average concentration (n=289) for hsTnI was 42ng/L with the 

CV(pooled)=4.89%. Over the same time period we also assessed 3 different low QC 

lots manufactured by Abbott with the hsTnI and obtained a CV(pooled)=4.91% on the 

weighted average concentration of 19ng/L (n=267). 

CONCLUSIONS: The Abbott hsTnI assay is more analytically sensitive, precise 

and comparable at concentrations near the 99 th percentile when compared to the cTnI 

assay. 

B-221 

Clinical Evaluation of a New Point-of-Care Device for Rapid and 

Accurate Measurement of Troponin I and NT-proBNP in Whole Blood 

or Plasma: The Samsung LABGEO IB10 

S. C. Kazmierczak, D. E. Kazmierczak, B. Heaphy. Oregon Health & 

Science University, Portland, OR 

Background: Rapid and accurate measurement of troponin and BNP in patients 

presenting with chest pain is critical for ensuring that the appropriate diagnosis, triage 

and treatment of patients can be implemented as soon as possible. It has now become 

the standard of care to perform these measurements in the point-of-care (POC) 

setting due to the extended test turnaround times often associated with measurements 

performed in the central laboratory. 

Methods: We performed a pilot evaluation of the LABGEO IB10 by Samsung using 

samples obtained from patients presenting to the emergency department with signs 

and symptoms suggestive of acute myocardial infarction. We obtained remainder 

whole blood samples from patients that had been originally collected for measurement 

of troponin I using the Abbott i-STAT®. Immediately after measurement using the 

i-STAT, whole blood was used to measure troponin I and NT-proBNP using the 

LABGEO IB10. Next, the whole blood sample was processed to obtain plasma 

and the plasma was used to measure troponin I and NT-proBNP on the LABGEO 

IB10and the Siemens Vista® analyzer. All whole blood and plasma measurements 

were completed within 90 minutes following collection. 

Results: Troponin I was measured in whole blood using the i-STAT and LABGEO 

IB10and plasma troponin I was measured using the LABGEO IB10and Siemens Vista 

analyzers. LABGEO values < 0.05 ng/mL and Vista values < 0.015 were plotted as 

0.00. Whole blood troponin measured using the i-STAT and LABGEO IB10 showed 

slope, intercept and r2 values of 1.722, 0.1796 and 0.6245, respectively. Better 

correlation for troponin I was observed between the Siemens Vista and the LABGEO 

IB10using plasma where slope, intercept and r2 values of 1.3643, -0.4052 and 0.8846, 

respectively, were obtained. Correlation of plasma NT-proBNP measured using the 

Siemens Vista and NT-proBNP using the LABGEO IB10showed slope, intercept and 

r2 values of 0.8486, 192.55 and 0.667, respectively. Measurement of troponin and 

NT-proBNP in whole blood and plasma using the LABGEO IB10showed excellent 

agreement with r2 values of 0.9744 and 0.963, respectively 

Conclusions: We found that the the LABGEO IB10POC analyzer produced rapid and 

accurate measurement of troponin I and NT-proBNP in whole blood and plasma in a 

POC setting. Troponin showed better correlation with the central laboratory compared 

with the i-STAT analyzer. 

B-222 

Differentiation of urinary thromboxane metabolites using LC-MS/MS 

explains the discordance with the AspirinWorks ELISA: implications 

for monitoring aspirin response. 

N. V. Tolan, A. J. Lueke, C. K. Koch, A. V. Gray, A. S. Jaffe, B. S. Karon, 

A. K. Saenger. Mayo Clinic, Rochester, MN 

Introduction: Measurement of urinary 11-dehydro-thromboxane B 2 

(11D-TXB2), 

the putative stabile metabolite of thromboxane A 2 

, allows for assessment of aspirin 

responsiveness. Elevated 11D-TXB2 concentrations for patients on daily aspirin 

therapy is potentially indicative of persistent platelet activation and increased 

cardiovascular risk. However, clinical outcome differences have been observed 

across trials utilizing various urinary thromboxane assays. We developed a LC-MS/ 

MS method to quantitate multiple thromboxane metabolites to determine whether 

additional metabolites beyond 11D-TXB 2 

are detected by the FDA approved ELISA 

method for monitoring aspirin response. 

Methods: We modified our clinical urine 11D-TXB2 LC-MS/MS method to include 

quantitation of two additionally relevant metabolites of thromboxane A 2 

: 11-dehydro- 

2,3-dinor-thromboxane B 2 

(11D-2,3D-TXB2) and 2,3-dinor-thromboxane B 2 

(2,3D-TXB2). In this method, acidified urine samples (pH 2.0±0.2) are spiked with d 4 

- 

TXB2 IS (Cayman Chemical) and ACN is added prior to on-line SPE (Cyclone MAX 

TurboFlow, Thermo Scientific) and LC separation (C-18 XBridge, Waters Corp.). 

Metabolites were monitored by tandem mass spectrometry (AB Sciex API 5000 

MS/MS) in negative MRM mode using the following transitions: m/z 371.2/165.1 

(d 4 

-11D-TXB2), 367.2/161.2,305.2 (11D-TXB2), 339.2/137.1,115.1 (11D-2,3D- 

TXB2) and 341.2/141.0,167.0 (2,3D-TXB2). Measurement of urinary thromboxane 

was also performed by manual competitive monoclonal ELISA (AspirinWorks, 

Corgenix). Final thromboxane concentrations were normalized to creatinine (pg/mg 


A237



cr). Analytical performance characteristics were established and included precision, 

analytical sensitivity, analytical specificity, linearity and recovery/accuracy. Urinary 

thromboxane was measured by ELISA and each metabolite was differentially 

quantitated by LC-MS/MS for 40 healthy volunteers not on aspirin therapy and 16 

donors taking daily aspirin. Results were evaluated using Bland-Altman plots and 

linear regression analysis. 

Results: LC-MS/MS intra-assay precision (n=20) was



Conclusions: 

Patients who were classified as MI4a according to the 2nd versus the 3rd universal 

definition of myocardial infarction do not differ to a high degree regarding the 

course of copeptin-values and thus, the new MI- definition does not select a subset 

of patient with more intense periprocedural hemodynamic changes. In addition, 

the old classification captured more patients with rehospitalization. MI4a needs to 

be investigated further with respect to a more accurate definition and its prognostic 

meaning. 

Conclusion: Troponin elevation in chest pain patients without a final diagnosis of 

AMI occur in 1.9-5.5% of patients. Agreement between methods is poor for low 

level elevations. Clinicians need to interpret small elevations of cardiac troponin with 

caution but they carry a good short term prognosis. 

B-231 

Liquid Assays for the Measurement of CK and CK-MB on the RX 

monaco Analyser 

P. McGivern, H. Johnston, P. Armstrong, J. Campbell, S. P. Fitzgerald. 

Randox Laboratories, Crumlin, United Kingdom 

B-230 

The incidence of troponin elevation in non AMI patients in the 

unselected emergency room population. 

P. O. Collinson 1 , D. Gaze 1 , S. Goodacre 2 . 1 St George’s Hospital, London, 

United Kingdom, 2 University of Sheffi eld, Sheffi eld, United Kingdom 

Objective: To compare the incidence of troponin elevation in the non AMI population 

when more sensitive troponin assays are used for the diagnosis of myocardial 

infarction using the universal definition of myocardial infarction. 

Methods: The study was a sub study of the point of care arm of the RATPAC trial 

(Randomised Assessment of Treatment using Panel Assay of Cardiac markers), set in 

the emergency departments of six hospitals. Prospective admissions with chest pain 

and a non-diagnostic electrocardiogram were randomised to point of care assessment 

or conventional management. Blood samples were taken on admission and 90 minutes 

from admission for measurement of a panel of cardiac markers. An additional blood 

sample was taken at admission and 90 minutes from admission, separated and the 

serum stored frozen until subsequent analysis. Samples were analysed for cardiac 

troponin I (cTnI) by 

the Stratus CS (CS) (Siemens Healthcare Diagnostics), range 30-50,000 ng/L 10% 

CV 60ng/L 99 th percentile 70 ng/L; the Beckman AccuTnI enhanced (B) (Access 2 , 

Beckman-Coulter) range 1 - 100,000 ng/L, 10% CV 30 ng/L, 99 th percentile 40 ng/L, 

the Siemens Ultra (S) (ADVIA Centaur, Siemens Healthcare Diagnostics), range.6 - 

50,000 ng/L, 10% CV 30 ng/L 99 th percentile 50 ng/L. and cardiac troponin T (cTnT) 

by the Roche high sensitivity cardiac troponin T assay hs-cTnT (Elecsys 2010, Roche 

diagnostics), range 3 - 10,000ng/L, 10% CV 13ng/L, 99 th percentile 14 ng/L. 

The universal definition of myocardial infarction utilising laboratory measurements 

of cardiac troponin performed at the participating sites together with measurements 

performed in a core laboratory was used for diagnosis. All patients were followed 

up for 3 months for major adverse cardiac events death, myocardial infarction, 

readmission with unstable angina or need for urgent revascularisation (MACE). 

Results: Samples were available from 838/1132 patients enrolled in the study. 782 

patients had a final diagnosis that excluded myocardial infarction. MACE occured in 

7 patients. The number of patients with at least one elevated troponin for each method 

was as follows, cTnI CS (>70 ng/L) 24 (3.1%) no MACE, cTnI S (>50 ng/L) 24 

(3.1%) 1 MACE, cTnI B (>40 ng/L) 15 (1.9%) no MACE and for cTnT (>14 ng/L) 43 

(5.5%) no MACE. Troponin elevation did not predict MACE. All four methods were 

elevated in 3 patients, two with marked elevation due to myocarditis. 

Introduction: The creatine kinase (CK) is a widespread enzyme that is part of the 

metabolic process and energy creation. It occurs as three different isoenzymes, 

each composed of two polypeptide chains: B and M. Elevated levels of CK usually 

reflect injury or stress to the brain, heart or skeletal muscle. Following injury to the 

myocardium, such as in acute myocardial infarction, CK is released from the damaged 

myocardial cells and this is reflected by increased serum levels. The isoenzyme CK- 

MB is produced by the heart muscle and its determination is an important element in 

the diagnosis of myocardial ischemia. 

Relevance: This study reports the development of two assay kits with enhanced 

precision and assay range for the measurement of CK and CK-MB in serum and 

plasma. This is applicable to the fully automated bench top/floor standing continuously 

loading RX monaco analyser to facilitate the diagnosis of myocardial ischemia. 

Methodology: The CK assay principle is an optimized standard method according to 

the concentrations recommended by the IFCC. The CK-MB assay principle is based 

upon that of an immunoinhibition assay as an antibody is incorporated into the CK 

reagent. This binds to and inhibits the activity of the M subunit of CK MB meaning 

that only the activity of the B subunit is measured via the Total CK assay UV test 

principle. 

For both assays on the RX monaco the first result is generated after 14 minutes. 

The reagents for both assays are liquid and ready to use. On-board and calibration 

stabilities were tested by storing two lots of reagent uncapped on the RX monaco 

analyser for a period of 28 days. Within-run and total precision were assessed by 

testing serum samples at defined medical decision levels, 2 replicates twice a day for 

20 days. A correlation study was conducted using commercially available CK and 

CK-MB assays. 

Results: The CK and CK-MB reagents present on-board and calibration stabilities 

of 28 and 21 days respectively. The assays were found to be functionally sensitive 

to 8.1U/L and 15.5UL for CK and CK-MB respectively and be linear up to 2097U/L 

and 2289U/L, CK and CK-MB respectively. The within-run and total precision for 

three different concentration levels typically had %C.V.’s of ≤6.0% and ≤7.1% for CK 

and CK-MB respectively. In the CK correlation study 41 serum patient samples were 

tested and the following linear regression equation was equation was achieved versus 

a commercially available assay: Y = 1.06x - 4.41; r = 1.00. In the CK-MB correlation 

study 43 serum patient samples were tested and the following linear regression 

equation was equation was achieved versus a commercially available assay: Y = 1.02x 

- 1.11; r = 1.00. 

Conclusion: Both assay kits exhibit good sensitivity and reproducibility with the 

added advantage of being fully comprised of liquid components with good stability. 

This is of value for the rapid and accurate determination of these analytes in human 

serum/ plasma for clinical applications. 

B-233 

Diagnostic value of CKMB for the determination of myocardial 

infarction in patients with cardiac troponin I concentrations in the 

gray zone 

Y. Zhu, J. Pellicier, R. Allen Jr.,, B. D. Horne. Medical University of South 

Carolina, Charleston, SC 

Background: Currently, the preferred biomarker for myocardial necrosis is cardiac 

troponins (I or T) due to its high clinical sensitivity and high myocardial tissue 

specificity. However, many clinicians still order both troponins and MB fraction of 

creatine kinase (CKMB) for the diagnosis of myocardial infarction (MI), although 

serial cardiac troponin testing is recommended. The major reason is that troponins 

may not be specific for MI when the 99th percentile of troponin concentration is used 

as the upper reference limit (URL), because many patients with other conditions 

may have elevations of troponins in the absence of overt ischemic heart disease. The 


A239



objective of this study is to determine if CKMB measurement can be used to improve 

the accuracy of the diagnosis of MI for patients with elevated cardiac troponin I (cTnI) 

but with levels that are less than the cutoff value for the diagnosis of MI according to 

the traditional WHO definition. 

Methods: cTnI was measured with a 3-site sandwich immunoassay using the direct 

chemiluminometric technology on the ADVIA Centaur® system (SIEMENS). The 

URL was 0.06 ng/mL and the cutoff value for MI according to the WHO definition 

was 0.78 ng/mL. CKMB was also measured on the ADVIA Centaur® system and 

the URL was 5 ng/mL. One hundred and forty five patients with cTnI concentrations 

between 0.06 and 0.78 ng/mL (gray zone) were included in the study. The final 

diagnosis was obtained from the discharge summary in the patients’ chart. 

Results: Of 145 patients, 16 were diagnosed as MI and 129 non-MI. Twenty four 

patients showed CKMB greater than 5 ng/mL, of which 2 had MI and 22 were non-MI 

patients. Of 16 patients with MI, 2 had elevated CKMB concentrations, and of 129 

patients with non-MI, 22 showed abnormal CKMB levels. According to these results, 

the diagnostic sensitivity of CKMB for MI in patient with TnI in the gray zone was 

12.5% with a positive predictive value of 8.3%. The diagnostic specificity of CKMB 

for MI in patient with TnI in the gray zone was 82.9% with a negative predictive 

value of 88.4%. 

Conclusion: Due to very low sensitivity and positive predictive value of CKMB test, 

it cannot be used for the diagnosis of MI for patients with cTnI in the gray zone. 

However, the specificity and negative predictive values are high. Therefore, it may be 

used to rule out MI for patients with cTnI in the gray zone. 

B-234 

Monoclonal antibodies for detection of retinol-binding protein 4 in 

human urine samples 

V. Filatov 1 , K. Muhariamova 1 , A. Klimenko 2 , S. Avdoshina 2 , O. Antipova 3 , 

A. Bereznikova 1 , A. Kara 3 , A. Katrukha 1 . 1 HyTest Ltd, Turku, Finland, 

2 

Peoples Friendship University of Russia, Moscow, Russian Federation, 

3 

School of Biology, Moscow State University, Moscow, Russian Federation 

Background: Acute kidney injury (AKI) is increasingly recognized as life-threatening 

pathology closely associated with metabolic syndrome and cardiovascular diseases. 

Current kidney biomarkers such as creatinine and blood urea nitrogen were proved 

to be not satisfactory in clinical setting for AKI diagnosis due to the late appearance 

in serum and lack of specificity. New generation of biomarkers has begun to be 

introduced into clinical practice. Among those new biomarkers is retinol-binding 

protein 4 (RBP4). 

Retinol-binding protein 4 is a low-molecular weight protein which participates 

in transport of retinol in the bloodstream. Serum RBP4 is known to be complexed 

(at least partly) with transthyretin. Recently it was shown that RBP may serve as a 

biomarker of loss of kidney function in acute kidney injury. RBP4 appears quite early 

both in serum and urine upon kidney injury therefore serving as early biomarker of 

kidney damage. 

The objective of the study was to develop human RBP4-specific monoclonal 

antibodies capable of detecting RBP4 in urine samples of patients with kidney injury. 

Methods: Using recombinant RBP4 as an immunogen, we developed 6 murine 

monoclonal antibodies (MAbs) specific to human RBP4. All antibodies were labeled 

by stable Eu3+ chelate and were tested in pairs to form two-site combinations suitable 

for the development of sandwich fluoroimmunoassay. Assay was calibrated using 

native human RBP4 (HyTest, Finland). 

Preliminary clinical studies were conducted on urine samples from patients with 

cardiorenal syndrome type 1 and 2. Urine samples from 25 patients with cardiorenal 

syndrome and from 15 apparently healthy controls were analyzed using MAb RB48- 

MAb RB49 fluoroimmunoassay. 

Results: RBP4-specific antibodies were shown to have epitopes in three distinct 

epitope groups. All MAbs were shown to be able to recognize both free and 

transthyretin-complexed RBP4 purified from human serum. Two-site MAb 

combination utilizing MAb RB48 (capture) and MAb RB49 (detection) was selected 

for the further evaluations based on sensitivity data. In-vitro study have demonstrated 

that MAb RB48-MAb RB49 pair detected RBP4 with sensitivity 0.7 ng/ml. 

To our knowledge, it is the first study aimed to measure urine RBP4 in patients with 

cardiorenal syndrome. RBP4 urine levels in healthy persons were shown to be 5.2±3.1 

ng/ml, which is in good accordance with previously published studies. However, in 

patients with cardiorenal syndrome RBP4 levels varied. For some patients, RBP4 

concentration was same as in control group, whereas others demonstrated very 

high RBP4 levels up to 350 ng/ml. High variability of RBP4 levels in patients with 

cardiorenal syndrome may be explained, at least in part, by different uremia levels of 

patients and/or by comorbidities of patients affecting kidney function. 

Conclusion: We developed monoclonal antibodies recognizing human RBP4 in 

sandwich fluoroimunoassay with good sensitivity. Pilot clinical study showed 

applicability of MAb RB48-MAb RB49 fluoroimmunoassay for detecting RBP4 

in urine samples of patients with cardiorenal syndrome type 1 and type 2 as well 

as healthy controls. Additional studies aimed to clarify the clinical utility of RBP 

measurements in the urine of patients with cardiorenal syndrome are needed. 

B-235 

Effect of Short-Term Storage Conditions on Cardiac Troponin I 

Stability as measured by the Abbott ARCHITECT STAT TnI assay 

A. Rezvanpour 1 , L. Clark 2 , B. Mallory 2 , E. Millar 2 , L. Ford 2 , P. Kavsak 1 . 

1 

McMaster University, Hamilton, ON, Canada, 2 Hamilton Health Sciences, 


Background: Analytical (i.e., CV>20% at the 99 th percentile) or pre-analytical 

(i.e., different tube-types) factors may lead to inappropriate interpretation of cardiac 

troponin (cTn). Another important pre-analytical factor is in vitro stability of cTn, as 

delays in laboratory testing or repeats may pose significant risk if an unacceptable 

degradation of cTn occurs, with the corresponding result being falsely lower. Here, we 

assessed the stability of cTnI concentrations as measured by the Abbott ARCHITECT 

STAT TnI assay under different conditions and over different timeframes. 

Methods: Eleven EDTA-plasma pool samples (off-cell) were collected. Baseline 

plasma cTnI concentrations (range:0.05-28.30ug/L) were measured using the 

ARCHITECT STAT Troponin I assay. The samples were then refrigerated (2-8°C) 

and re-analyzed after 15 and 72h. To test the on-cell stability of cTnI, three EDTAblood 

tubes (tube1=0.07ug/L;tube2=0.19ug/L;tube3=17.75ug/L) were split into two 

aliquots and centrifuged (plasma not separated). Following the baseline measurement, 

the first aliquot of each sample was stored at 2-8°C and the second at room temperature 

(RT). Further analysis of the samples was carried out at 3, 6, and 24h post-storage. 

Stability was confirmed if the subsequent cTnI concentrations were



major cause of death in CKD patients. Apart from traditional and new CVD markers, 

in CKD patient, there has been increasing concern about extraskeletal ossification 

especially vascular ossification. Many studies suggest product of serum calcium and 

phosphorus (ca x po4) as its marker. So, aim of this study was to assess the utility of 

ca x po4 in prediction of CVD in predialysis CKD patients. 

Methods: This cross-sectional study, conducted in Tribhuvan University Teaching 

Hospital, Nepal included 150 pre-dialysis CKD patients and 150 healthy controls 

(75 male and 75 female both), with mean±SD estimated Glomerular Filtration Rate 

(eGFR) 18.1±7.9 & 91.2±16.2 ml/min respectively. CKD was defined as per National 

Kidney Foundation-Kidney Disease Outcome for Quality Initiative (NKF-KDOQI) 

guideline and GFR was estimated by revised MDRD formula. We measured various 

biochemical analytes and CVD markers in fasting blood, corrected calcium for 

albumin & performed electrocardiogram. CVD risk was measured by traditional and 

CKD related CVD risk factors, presence of multiple risk factors (NCEP-ATP III) and 

Framingham risk score. Data were analyzed using Chi-square test, t-test, ANOVA and 

logistic regression. P-value of


Technology/Design Development 

B-240 




Analytical Performance Testing of VITROS® Immunodiagnostic 

Systems Assays* for Aβ42 Peptide and Tau Protein 

P. Contestable 1 , I. Baburina 2 , G. Green 3 , H. Soares 4 , S. Jackson 1 , K. 

Ackles 1 , A. Tweedie 1 , L. DiMagno 1 , D. Byrne 1 , D. Kozo 2 , J. Courtney 2 , 

S. Salamone 2 . 1 Ortho Clinical Diagnostics, Rochester, NY, 2 Saladax 

Biomedical, Inc., Bethlehem, PA, 3 Bristol-Myers Squibb, Princeton, NJ, 

4 

Bristol-Myers Squibb, Wallingford, CT 

Background: Evaluation of cerebrospinal fluid (CSF) biomarkers in Alzheimer’s 

disease (AD) is increasingly more important for improving the certainty of antemortem 

diagnosis of AD, ensuring proper patient management. Use of such markers for 

clinical purposes, in conjunction with potential disease-modifying therapies, requires 

assays that can deliver high analytical and clinical performance. Two biomarkers, beta 

amyloid1-42 (Aβ42) and tau have been shown to correlate with disease progression. 

This study reports the analytical performance of the VITROS® Immunodiagnostic 

Products Amyloid Beta 42 (AB-42) assay and VITROS® Immunodiagnostic Products 

Tau assay currently under development. 

Methods: VITROS AB-42 and Tau assays are being developed for the VITROS 

Immunodiagnostic Systems. Analytical performance was evaluated following CLSI 

guidelines using two VITROS AB-42 and two VITROS Tau assay reagent lots, three 

CSF pools, and three controls with each assay. Linearity was tested with 11 admixtures 

of endogenous Aβ42 or tau in CSF and synthetic Aβ42 or recombinant tau 441 in a 

buffer based matrix. Interference testing included commonly prescribed drugs, other 

Aβ peptides, recombinant tau and endogenous substances. Limit of detection (LoD) 

and lower limit of quantitation were confirmed with 20 replicates per day on three 

days for each assay. Fifty individual CSF samples were run in singleton with two lots 

of reagent for each of the assays on the VITROS® ECiQ and VITROS® 

3600 Immunodiagnostic Systems to evaluate lot-to-lot and system-to-system 

variability. The results from the VITROS 3600 using Lot 1 reagent for each assay 

were used as the control condition and linear regression was performed. 

Results: The within-laboratory coefficient of variation (CV) for the three CSF pools 

and control fluids ranged from 1.3% to 8.2% for VITROS AB-42 and from 2.4% to 

4.0% for VITROS Tau. Both assays showed good linearity across the measuring range 

(0 to 2,500 pg/mL for VITROS AB-42 and 0 to 8,000 pg/mL for VITROS Tau) with 

the admixtures of endogenous and synthetic peptides. Bias introduced by commonly 

prescribed drugs at high levels was



reference range, analytical sensitivity, analytical specificity, and specimen stability. 

Laboratories are challenged to validate accuracy without having a gold-standard or 

predicate method in the validation of body fluid tests. This work focuses on comparing 

the assessment of accuracy using spiked recovery, dilution recovery, and mixing 

recovery to method comparison using the gold-standard method for Na, K, and Mg. 

Methods: Validation of fecal Na, K, and Mg was performed on the Roche Cobas 

c501 (Roche Diagnostics, Indianapolis,IN) with an ion-specific electrodes (ISE) 

module. Validation was performed using residual stool samples submitted for 

clinical testing. Formed samples were cancelled for testing and excluded from the 

study. Samples were aliquotted into two tubes after thawing and thorough mixing. 

ICP-OES (PerkinElmer, Shelton,CT) aliquots were digested 30 min with 6N HCl, 

centrifuged, and the supernatant analyzed for Na, K, and Mg. The second aliquot 

was centrifuged at 14,000rpm for one hour, and the supernatant analyzed on a Roche 

Cobas c501 using MG2 reagent (Mg) and indirect ISE (Na,K). Spike recovery was 

performed using standard solutions of KH 2 

PO 4 

or MgSO 4 

( 0.999). The migration time of methamphetamine 

was 14.4 min (D) and 15 min (L). Highly precise run-to-run separations were obtained 

and migration shifts were corrected using the internal standard migration time. This 

technique was applied to the identification of methamphetamine stereoisomers in 

98 patient urine samples. Samples were first run on a LC-MS/MS to confirm the 

presence of methamphetamine. Results showed that 81% of the samples contained 

D-methamphetamine, the illicit stereoisomer. 

Conclusion:The robust CE-MS method developed here permits the separation and 

quantification of illegal and legal methamphetamines. 


A243



B-246 

Performance evaluation of a novel high-risk Human Papilloma Virus 

Genotyping test (Clinichip HPVTM) 

H. Yamada, Y. Tabe, K. Ishii, Y. Terao, S. Takeda, T. Horii, A. Ohsaka. 

Juntendo University Hospital, Tokyo, Japan 

B-245 

High-Throughput Measurement of Serum Glucose in the Clinical 

Laboratory by NMR 

J. Wolak-Dinsmore, I. Shalaurova, T. O’Connell, J. Otvos. LipoScience, 

Raleigh, NC 

Background: The diagnosis of diabetes and pre-diabetes has long relied upon the 

accurate and precise measurement of blood glucose levels. A blood glucose assay 

has been developed using nuclear magnetic resonance (NMR) technology on the 

Vantera® Clinical Analyzer. This platform is currently used for measurement of 

lipoprotein particle concentrations, but the information-rich nature of the NMR 

spectrum enables other clinically valuable metabolites such as glucose to be measured 

in the same spectrum. The quantification of glucose can be carried out in a highthroughput 

fashion using the fully automated Vantera Clinical Analyzer. 

Methods: The Vantera Clinical Analyzer consists of a 400MHz NMR system with 

automated fluidics sample handling, data processing and analysis. In this study, 1 H 

NMR spectra on fasting serum samples from 46 patients were collected and analyzed 

on the Vantera Clinical Analyzer. As an orthogonal measurement, glucose was also 

measured using a standard chemistry assay implemented on an AU400 Olympus 

Analyzer. The NMR spectra were deconvoluted using proprietary modeling software 

where the model consisted of reference spectra of glucose and serum proteins. 

Glucose concentrations were quantified and compared with the chemical analysis 

results. Precision of the NMR glucose measurement was determined using three 

different serum pools: glucose concentrations were 70, 116 and 185 mg/dL. 

Results: A comparison of glucose measurements made by NMR vs. chemistry 

methodology show an excellent correlation, R=0.997. In addition, precision 

measurements on low, medium and high glucose serum pool samples indicate CVs 

between 1-2%. 

Conclusion:The ability to quantify serum glucose by NMR has been demonstrated 

and characterized for clinical samples. These results highlight the suitability of 

NMR for high-throughput automated quantification of glucose as well as many other 

clinically valuable metabolites. 

Background: Persistent infection with carcinogenic human papilloma virus (HPV) 

is closely associated with development of cervical cancer. The efficient screening 

test to detect the high-risk HPV is clinically important. A novel DNA test Clinichip 

HPV (Sekisui medical, Tokyo, Japan) identifies 13 different high-risk genotypes of 

HPV (types 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59 and 68) by loop-mediated 

isothermal amplification (LAMP) and automated DNA chip technology with 2.5 

hrs of examination time. In this study, the performance of the Clinichip HPV was 

evaluated as a screening laboratory test for high-risk HPV infection. 

Methods: The Little Genius (Bioer Technology, Hangzhou, P.R.China) and the 

Genelyzer (Toshiba Hokuto Electronics, Tokyo, Japan) were used for the Clinichip 

HPV assay. A total of 118 cervical scrape specimens were obtained from patients. 1) 74 

specimens were tested their genotypes by the Clinichip HPV and by a conventionally 

employed HPV polymerase chain reaction-restriction fragment length polymorphism 

(PCR-RFLP). PCR sequencing was performed in the cases with discrepancy of results 

between Clinichip test and PCR-RFLP. HPV DNA extracts which used to PCR- 

RFLP were further purified by MinElute PCR Purification Kit (QIAGEN) for the 

Clinichip HPV and PCR sequencing. 2) To determine the consistency of genotyping 

performance, 44 DNA samples extracted from patient specimens have been tested 

by the Clinichip HPV in the different two laboratories. HPV DNA was extracted 

by Amplilute liquid media extraction kit (Roche). In the cases of which results 

showed discrepancy between the laboratories, DNA extraction was further purified 

by MinElute PCR Purification Kit, then retested in each laboratories. Finally, PCR 

sequencing was performed. 

Results: 1) Comparison of genotyping by the Clinichip HPV and PCR-RFLP assay 

resulted in 27% disagreement (20/74 specimens). With regard to detected genotype, 

24 genotypes were mismatched between the Clinichip HPV and PCR-RFLP. For 19 

of 24 mismatched genotypes, the results of PCR sequence were consistent with the 

Clinichip HPV and for the other 5 were consistent with PCR-RFLP. 2) Comparison 

of the results obtained by the Clinichip HPV between the two different laboratories 

resulted in 18% discrepancy (8/44 specimens), mostly observed in the cases with 

multiple HPV infections. However, 88% of mismatched cases (7/8) showed identical 

genotypes after further DNA purification. 

Conclusion: The Clinichip HPV that required highly purified DNA samples provided 

more accurate information regarding the high-risk HPV genotype than PCR-RFLP. 

Although the genotyping performance was partially diminished in the cases with 

multiple HPV infections, the Clinichip HPV is a promising laboratory test for 

screening high-risk HPV infection. 




B-247 

Development of an enzymatic assay to measure lactate in perchloric 

acid-precipitated whole blood 

J. Lu 1 , B. S. Pulsipher 1 , D. G. Grenache 2 . 1 ARUP, Salt Lake City, UT, 

2 

University of Utah, Salt Lake City, UT 

Background: Lactate and pyruvate are products of glycolysis. Blood pyruvate 

concentrations have clinical utility when measured in conjunction with lactate in the 

same sample in order to calculate the lactate:pyruvate (L:P) ratio. However, difference 

in sample types makes this challenging. Pyruvate is measured in whole blood added to 

perchloric-acid and lactate is measured in whole blood or plasma. Utilizing the sample 

type for pyruvate and lactate assays is desirable. 

Objective: To develop a method to measure lactate in perchloric-acid precipitated 

whole blood and validate the L:P ratio as calculated from the analysis of both analytes 

in the same sample. 

Methods: Samples were prepared by the addition of 1 mL heparin or EDTA 

whole blood to 2 mL 8% (w/v) cold perchloric acid, incubated on ice for 10 min, 

then centrifuged to obtain a protein-free supernatant. Lactate was measured by its 

oxidation to pyruvate and hydrogen peroxide using lactate oxidase and the absorbance 

of the resulting chromogen determined at 540 nm on a cobas c501 chemistry analyzer. 

Sample processing effects, method accuracy, linearity, imprecision, sensitivity, 

sample stability, and a reference interval were determined. 

Results: Compared to baseline, delayed addition of whole blood to perchloric-acid 

significantly increased lactate by 24, 56, and 76% at 30, 60, and 120 min, respectively 

after collection (p=0.01). Failure to incubate samples on ice for 10 min after collection 

or immediately centrifuge after incubation significantly decreased lactate by 23 and 

30%, respectively (p



B-251 

Practical Approach to the Analytical Validation of Chemistry Testing 

in Body Fluids 

D. T. MEIER, L. J. Ouverson, N. A. Baumann, D. R. Block. MAYO 

CLINIC, ROCHESTER, MN 

Introduction: Biochemical analysis of body fluids lends insight into the pathogenesis 

of disease in a variety of clinical conditions. Most commercially available methods 

are not FDA-approved for body fluids and the onus is on the lab to characterize the 

performance of these methods to avoid reporting inaccurate results. Limited resources 

are available describing how to perform this task. The goal of this work is to present 

a representative validation of lactate dehydrogenase (LDH) in body fluid as a model 

for other laboratories. 

Methodology: Residual samples for validation were obtained from clinically ordered 

testing. Validation was performed on Roche Cobas c501 (Roche Diagnostics) 

analyzers. The 3 most prevalent fluid types were identified retrieving data from the 

laboratory information system (LIS) (1/1/2009-6/30/2009): pleural (58%), abdominal 

(13%), and CSF (10%). Intra-assay precision and analytical sensitivity were 

determined in a single run (n=20) and inter-assay precision over 20 days (n=20) with 

one body fluid type and serum. Spiked recovery was performed to access accuracy 

using each fluid type (10% by volume) spiked with elevated serum specimens (n=4). 

The mean % recovery (measured/expected) 100+/-10% was considered acceptable. 

Analytical specificity was assessed in multiple fluid types (n=10) for hyaluronidase 

pretreatment, hemolysis (spiked hemolysate, measured as H-Index), and icterus 

(spiked bilirubin, measured as I-Index) at increasing concentrations (



Samples: The serum and plasma samples were collected from inpatients/outpatients 

and the employees who volunteered. This study has been approved by the ethical 

committee in Hamamatsu University School of Medicine. 

Material and Method: The reagent PANACLEAR MMP-3 “Latex” (Sekisui Medical 

Co., Ltd.) and the automated clinical chemistry analyzer LABOSPECT 008 (Hitachi) 

were used for the following evaluations: (1) precision, (2) dilution linearity (2 level of 

MMP-3 samples were diluted with physiological saline) and limit of detection (2.6SD 

method), (3) interference (evaluated with Interference Check (Sysmex) and ascorbic 

acid), (4) correlation with results from JCA-BM1650 (JEOL Ltd.), and (5) probe 

contamination test (evaluated on 42 parameters of the same pre-installed module). 

Results: (1) Within-run precision of CV (n=20) :1.35 % (Control L; mean 110.9 ng/ 

mL), 0.78 % (Control H; mean 435.4 ng/mL ), 1.62 % (pooled serum; mean 99.2 ng/ 

mL) (2) Linearity was up to 1500 ng/mL and limit of detection was 9.85 ng/mL. (3) 

No influences were observed by bilirubin < 200 mg/L, hemoglobin < 5 g/L, RF < 550 

U/mL or ascorbic acid < 500 mg/L in sample. (4) High correlation was noted, with the 

regression formula being y = 0.991x-13.9 and the correlation coefficient being 0.985 

(N=92). (5) Probe contamination test: No influence by prove contamination test was 

noted on any of the 42 parameters. 

Conclusion: PANACLEAR MMP-3 “Latex” with LABOSPECT 008 was shown in 

the present study as having favorable performance. Wide assay range with linearity 

up to 1500 ng/ml is especially convenient because high level MMP-3 samples don’t 

require dilution and retesting. Additionally, in couple with LABOSPECT 008, routine 

measurement of MMP-3 could be easily handled, and real-time reporting could lead 

to clinical remission. This reagent could be useful for measuring MMP-3 in clinical 

laboratories. 

B-255 

GlycA and GlycB: Novel NMR Markers of Systemic Inflammation 

J. Otvos, I. Shalaurova, J. Wolak-Dinsmore, S. Matyus. LipoScience, 

Raleigh, NC 

Background: Serum concentrations of many glycosylated acute-phase proteins such 

as C-reactive protein (CRP) and fibrinogen are used clinically to assess and monitor 

both acute and chronic inflammation. Serum NMR spectra obtained for lipoprotein 

particle analysis using the automated NMR Profiler system contain two NMR signals 

originating from N-acetyl methyl group protons on the N- and O-linked glycans of 

serum glycoproteins. One, that we named GlycA, comes from N-acetylglucosamine 

and N-acetylgalactosamine and the other, GlycB, from sialic acid moieties. We 

hypothesized that the measured amplitudes of these signals would reflect global 

protein glycosylation levels, thereby providing measures of inflammation status 

that might have clinical utility similar or complementary to existing inflammatory 

biomarkers. 

Methods: We used archived serum NMR spectra from previously-performed 

automated NMR LipoProfile (lipoprotein particle) analyses conducted using the 400 

MHz NMR Profiler analyzers at LipoScience. As shown in the Figure, the GlycA 

and GlycB signals overlap the complex signal envelope from the allylic protons 

of the lipids in VLDL, LDL, and HDL particles. To accurately quantify their 

signal amplitudes, we developed an automated linear non-negative least-squares 

deconvolution algorithm that takes account of the spectral contributions of serum 

protein and 59 different lipoprotein subclasses. GlycA and GlycB levels are reported 

in units of μmol/L N-acetyl methyl groups. 

Results: GlycA and GlycB levels were measured with good precision (0.97). With the 

automation the %CVs of all three concentration levels were



B-257 

New Method for Evaluating Individually the Reliability of Test Result 

in Clinical Chemistry Analyzer “Reaction Curve Fitting Method”- 

Clinical Applications 

Y. Yamamoto 1 , S. Matsuo 1 , E. Kuramura 2 , N. Hatanaka 2 , K. Kamihara 3 , 

T. Mimura 3 . 1 Tenri Health Care University, Nara, Japan, 2 Tenri Hospital, 

Nara, Japan, 3 Hitachi High-Technologies Corporation, Tokyo, Japan 

Background: Reaction Curve Fitting Method has developed to analyze the reliability 

of each test results by quantifying the pattern of reaction curves outputted form 

clinical chemistry analyzer. 

Objective: We evaluated the availability of Reaction Curve Fitting Method as tools 

which confirmed individually the reliability of test result using a huge number of test 

results in clinical applications. 

Methods: Clinical Chemistry Analyzer, LABOSPECT 008 (Hitachi Hightechnologies) 

was used. The target tests in the end-point assay were TP, UA, CHO, 

LDL-C, Fe, CRP, IgG, IgA and IgM. Rate assay were AST, LD, ALP, GGT, CK and 

UN. 10482 samples (daily average 1048) were measured for two weeks in November, 

2012. The allowable range of each index factor was established before this evaluation. 

The measured results were checked with the Reaction Curve Fitting Method after 

daily measurement finished. Confirmation of each measured result was evaluated by 

observing graphs plotted the allowable range for every index factor. When the sample, 

out of the allowable range, was detected, the properties of samples, index factor of 

relevant tests and the test result of relevant tests were confirmed. Analysis software of 

the Reaction Curve Fitting Method, MiRuDa (Hitachi High-Technologies) was used. 

Results: During the evaluation, daily reproducibility for index factors of QC samples 

in the Reaction curve fitting method was acceptable. Quantitative index factors (A 1 

, p) 

were generally distributed within the allowable range as defined by the index factor 

and test result. Reaction curves of samples that index factor indicating Reactivity (k), 

Quantification (A 1 

, p) and (Err) were within the allowable range matched fitted curve. 

Some marked hemolysis and increased bilirubin samples exceeded the allowable 

range of index factor indicating absorbance at reaction starting point (A 0 

, q). The 

number of samples in the rate assay is more likely to be out of the allowable range. 

In the Reaction Curve Fitting Method, noise due to optical system (AST, TP), 

absorbance decrease after color reaction (UA), reaction inhibition by therapeutic drug 

(Fe), discrepancy of index factor k or A 1 

(M protein of IgG, elevated serum IgG4) 

were detected, however, they were not detected by the current abnormal value check, 

previous value check and CDC check. 

Consideration: The current check methods are hard to distinguish between the cause 

of abnormality about measurement and the change of medical conditions. In the 

Reaction Curve Ftting Method, if reaction curve is stable, each index factor is within 

the acceptable range. The Reaction Curve Fitting Method is revolutionary technique 

for confirming the reliability of each test results about reaction curve. 

Conclusion: Reliability in measured values can be determined by checking each 

reaction curve in the Reaction Curve Fitting Method. 

B-258 

Analytical evaluation of soluble IL2-Receptor, ACTH, GH 

Measurement by Automated Immunoassay System “ IMMULITE 

2000 XPi ” 

E. Hamada, K. Noji, M. Maekawa. Hamamatsu University School of 

Medicine, Hamamatsu, Japan 

Background: The full automated random-access multiparameter luminescence 

immunoassay system, IMMULITE 2000 XPi is based on a solid phase two-site 

chemiluminescent enzyme immunoassay (CLEIA). Here we evaluated analytical 

performance of the IMMULITE 2000 XPi measurement system of soluble IL2- 

Receptor (IL2R), ACTH and GH. 

Samples: We used serum and plasma samples collected from our inpatients/ 

outpatients and the employees who volunteered, as well as control samples 

commercially available. This study has been approved by the ethical committee in 

Hamamatsu University School of Medicine. 

Material and Method: In this study, we compared IMMULITE 2000 XPi 

Immunoassay System and its dedicated reagents (Siemens Healthcare Diagnostics, 

USA) with AP-X automated microplate EIA analyzer (Kyowa Medex, Japan) for 

IL2R, Modular Analytics ECLusys (Roche Diagnostics, Germany) for ACTH, and 

Daiichi-GH kit (TFB, Japan) for GH. 

Results: 1. Within-run precision 

The CV% for the control samples measured 20 times in sequent were 2.8% (455 

U/mL), 3.4% (1599 U/mL) for IL2R; 2.7% (30.2 pg/mL), 3.0% (415.3 pg/mL) for 

ACTH; 3.1% (1.55 ng/mL), 2.3% (4.05 ng/mL), 2.0% (9.30 ng/mL) for GH. 

2. Between-run precisionThe CV% for the same samples as used for within-run 

precision with dual measurement for 10 days were 3.4%, 2.3% for IL2R; 3.0%, 2.3% 

for ACTH; 3.7%, 3.7%, 2.6% for GH. 

3. Linearity 

Linearity observed in high concentration range for IL2R, ACTH, GH was up to 7218 

U/mL, 1104 pg/mL, 39.5 ng/mL, respectively. Linearity in low concentration range 

also indicated favorable results. 

4. Minimal detection limit 

The detection limit of IL2R, ACTH, GH were 2.4 U/mL, 3.37 pg/mL 0.0095 ng/mL, 

respectively. 

5. Interference with coexisting materials 

Interferences with coexisting materials used Interference Check A Plus and 

Interference Check RF Plus (Sysmex Co., Japan). Only small positive interferences 

were observed in IL2R measurement with RF and in ACTH measurement with 

bilirubin C. However, no interferences were observed by bilirubin F and C < 20mg/L, 

hemoglobin



negative calls of low allele frequency samples. The assay has clinical applicability for 

the selection of patients for early phase clinical studies. The assay design principles 

and considerations may be applicable to other efforts to develop and validate clinical 

mutation detection assays, including NGS-based clinical assays. 

B-260 

Comparison of two blood gas extraction devices related to sample 

stability 

R. Gomez-Rioja, P. Fernandez-Calle, M. J. Alcaide, P. Oliver, J. M. 

Iturzaeta, A. Buno. Hospital Universitario La Paz, Madrid, Spain 

Background: The stability of samples for blood gas analysis mainly depends on the 

diffusion of gases through the plastic components of the syringes and the metabolic 

effect of cell constituents. When validating a change of the extraction devices, time 

influence should be evaluated. 

The aim of this study was to asses the comparability of blood gas parameters results 

between two types of syringes during a variable time up to 3 hours. 

Methods: Two extraction devices were compared: PRESET (Beckton Dickinson) and 

SAFE-PICO (Radiometer) on 40 blood samples. Paired samples were obtained from 

the same IV line-blood drawn for every patient and processed immediately in a blood 

gas analyzer ABL-90 (Radiometer). Before and after the analysis they were purged 

to avoid the presence of bubbles and stored at room temperature for a period varying 

from 30 minutes to 3 hours until they were re-analyzed. 

To assess the interchangeability of patients´ results, the CLSI-EP15 protocol was 

performed at clinical decision levels. Allowable bias was the criteria to define a 

significant change. 

A univariate general linear model (GLM) was used to assess differences considering 

syringe type and time interval between repeated analyses. 

Results: Confidence intervals (95%) of the differences of concentration of all blood 

gas parameters were lower than the allowable bias at clinical decision levels. 

GLM showed no significant differences between the types of device independently of 

the sample storage time. 

Related to time, four parameters showed a significant variation. 

Analytical Allowable 

GLM study 

Parameter Units 

Storage Syringe Effect description 

range bias* (%) 

Time (p) type (p) over time 

pH 7.24-7.5 1.5



analyzers; similarly, lipase slopes were >1.5 on all. For Sites A#1 and A#2, 87% of 

the intercepts ranged between -5.01 to 5.00, for Site B and Site C, this was 85%. When 

combined, the intercepts of 178 of 208 (86%) analytes ranged between -5.01 to 5.00. 

Correlation coefficients (R) were >0.9701 for 94% of Site A#1’s, 92% of Site A#2’s, 

87% of Site B’s, and 96% for Site C’s analytes. When combined, the correlation 

coefficients for 192 of 208 (92%) analytes were >0.9701. 

Conclusion: The four AU5822 analyzers offered consistent simple precision, linearity, 

and correlation results. Assays that did not correlate with the previous instrumentation 

were expected and due to methodology changes. Some analytes, however, despite 

methodology changes, did not require or required only minor adjustments of the 

reference intervals. This multi-center study demonstrates acceptable AU5822 site-tosite 

reproducibility and analyzer performance consistency. 

B-263 

Development of Quantimetrix Next Generation Complete D, a 25-OH 

Vitamin D Clinical Control 

A. Schaeffer, P. Lenichek, B. Fernandez, M. Ban, M. Ghadessi. 

Quantimetrix Corporation, Redondo Beach, CA 

Background: One major issue in 25-OH Vitamin D (25-OH D) testing is the lack 

of commutable control material to evaluate assay performance. Production of 25-OH 

D control material is challenging due, most importantly, to the difficulty in obtaining 

serum pools containing adequate endogenous levels of 25-OH D. Efforts to modify 

pooled human serum to produce the 25-OH D levels necessary for a clinical control 

can lead to matrix effects. These matrix effects can cause the assay systems to 

respond differently to the control than to patient material, leading 

to a lack of commutability across assay platforms. Objective. A study was performed 

to determine what factors determined the commutability of 25-OH D serum control 

material, including the impact of charcoal stripping, the addition of 25-OH D 2 

and 

D 3 

to increase the analyte concentration in the serum, and the addition of a group 

of stabilizers and antimicrobials known to maintain 25-OH D concentrations for 

two years at 2-8⁰C. Method. Four sample pools were prepared; pooled human 

serum containing an endogenous 25-OH D content of 23.1 ng/mL, the same pooled 

human serum with added 25-OH D 2 

or D 3 

to a concentration of ~50ng/mL 25-OH 

D, and charcoal stripped serum with equimolar 25-OH D 2 

and D 3 

added to a final 

concentration of 44.5 ng/mL. The samples were analyzed using the Abbott Architect ® 

i2000, Roche Cobas ® 6000, Siemens Centaur ® XP, and Diasorin Liaison ® systems. 

These results were compared to the values produced by a HPLC-UV system which 

has been demonstrated to produce results comparable to the LC-MS-MS ID method 

described in JCTLM 

Methods: C8RMP4 and C8RMP3. A separate study compared the effect of 

the stabilizers and antimicrobials mentioned above on observed total 25-OH D 

concentrations using the same assays. 

Results: The whole serum concentrations were within 20% of the HPLC results for 

all instruments but the Cobas, which differed by from the HPLC 25-OH D value by 

43.1%. With the charcoal stripped serum, the Liaison and Centaur values differed 

from the HPLC 25-OH D by 119.1 and 119.3% respectively. This demonstrates that 

these methods are sensitive to the removal of hydrophobic components by the charcoal 

stripping process. The Centaur was shown to be highly sensitive to the addition of 25- 

OH D. The 25-OH D values deviated from the HPLC by 159.9% when 25-OH D 2 

was 

added and by 118% when 25-OH D 3 

was added. These percentages may also indicate 

a differential response to the added D 2 

and D 3 

forms of 25-OH D by the Centaur assay. 

Finally, the preservatives and stabilizers tested had little impact on measured 25-OH 

D concentration; the greatest difference was 5.2% (Architect). 

Conclusion: Based on these results, the next generation Quantimetrix Complete D 25- 

OH Vitamin D control product will be human serum based without charcoal stripping 

and with a minimum of 25-OH D addition to avoid matrix effects. The stabilizers and 

antimicrobials tested can be used with no impact on the commutability of the control 

for the assays in this study. 

B-264 

Sensitive detection of cTnI in whole blood on MagArray biosensors 

H. Yu 1 , A. Seger 1 , S. Osterfeld 1 , L. Carbonell 1 , I. Yamaguchi 2 , W. Chang 2 , 

M. Greenstein 2 . 1 MagArray Inc, Sunnyvale, CA, 2 Wako Life Sciences, Inc, 

Mountain View, CA 

Background: Separation of plasma or serum from the whole blood is often essential 

for the detection of protein biomarkers on various platforms. Here we report the 

direct detection of cTnI in whole blood on MagArray platform with no extra steps 

of processing the whole blood samples. We attribute this unique capability to the 

fundamental detection mechanism of MagArray platform, by which magnetic signals 

are generated and detected using magnetic nanotags. In contrast to systems based on 

optical signals, magnetic signals are not affected by the common optical interference 

in complex matrices. The detection of cTnI in whole blood samples demonstrates 

MagArray’s biosensors are well suited for complex biological matrices such as whole 

blood samples. 

Methods: Antibody pairs for cTnI assay were screened and selected on MagArray 

platform, and the assay was first developed using purified cTnI in buffers. The assay is 

then used for the detection of purified cTnI added to whole blood. The assay consists 

of sequential additions of sample and nanotag solution to the reaction well with no 

washing. The whole assay time is 12 minutes. Standard curves of cTnI in both pure 

buffer and whole blood were established and compared. Protein interference from 

hemoglobin, albumin, and IgG spiked into whole blood was also investigated. 

Results: The detection sensitivity of cTnI in whole blood without any sample 

processing on MagArray platform is close to 10pg/ml. As a comparison, the 

sensitivity of cTnI detection is approaching 1pg/ml in pure buffer. We assume this is 

due to the higher viscosity of whole blood samples that slows down the binding rates 

of analyte and detection antibody. Also, the assay is found to be relatively insensitive 

of interference from IgG and albumin. High concentration of hemoglobin (40%wt) 

led to lower signals which again were likely caused by the higher viscosity of the 

hemoglobin spiked samples. 

Conclusion: MagArray platform provides a unique opportunity of detecting proteins 

in whole blood. Since no extra step is required to process whole blood samples, the 

complexity of the assay format is greatly reduced. The detection of magnetic signals, 

rather than optical signals, is a key benefit of the MagArray platform for protein 

detection in complex biological matrices. 

B-265 

A Sensitive, Inexpensive Detection Substrate for Microarray 

Applications 

W. D. Nelson, G. Opperman, D. Pauly, K. Pauly. SurModics, Eden Prairie, 

MN 

Background: Traditionally most microarray applications have utilized fluorescence 

detection technology to gain the desired level of sensitivity. Microarrays are often 

run using a glass slide format to which either antibodies, proteins or nucleic acids are 

bound, depending on the application. 

Objective: Here, we have shown that detection using a simple precipitating substrate 

can be just as sensitive, without the higher costs of both the detection probes and 

analyzers inherent with fluorescent detection. This novel colorimetric detection 

combines the power of optimal surface coating, substrate choice and visualization 

techniques. 

Methods: Biotinylated oligonucleotide was titrated and printed onto the surface of 

a coated glass slide. The slides were then incubated with either, streptavidin-Cy5 

(fluorescence) or streptavidin-horseradish peroxidase (colorimetric), washed and spun 

dry. Slides using Cy5 detection were scanned on an Axon 4200 AL scanner in the 632 

nm channel. Precipitating tetramethylbenzidine (TMB) substrate was incubated for 20 

minutes on slides printed with horseradish peroxidase, washed with water to stop the 

reaction, and dried. Colorimetric imaging was performed using polarizing filters and 

light transmittance. Further experiments examined the effect of different coatings on 

the detection level for both TMB and fluorescence. 

Results: The results indicated that when the polarizing filters were used in 

combination with the precipitating substrates, the same level of sensitivity as 

fluorescence detection was achieved. In a titration of oligonucleotide printed on the 

surface, both the colorimetric substrate and fluorescent probe provided equivalent 

levels of detection at 1 nM. 




Conclusion: We have found that colorimetric detection for microarray applications 

is a sensitive, inexpensive detection alternative to fluorescence. The simplicity of 

the novel colorimetric system may offer advantages in certain settings (e.g, Point Of 

Care) where fluorescence systems are not practical. 

Conclusion: Five grades of filter papers (TFN, 226, 903, CF10 and CF12) show 

similar analytical behavior and are suitable for DBS analysis by LC-MS/MS. 

B-266 

Evaluation of a Novel Surface Modification Technology for Molecular 

Diagnostic Applications on a Variety of Surfaces 

G. Opperman, W. D. Nelson, A. Torguson, S. Lundquist, K. Pauly, D. 

Pauly. SurModics, Inc., Eden Prairie, MN 

Background: Many molecular diagnostic devices require immobilization of a capture 

biomolecule to a surface in a manner that preserves the activity of the biomolecule 

and reduces non-specific interactions. The ability to provide these attributes to a wide 

variety of surfaces is invaluable to the successful development of diagnostic assays. 

Objective: In this work we evaluated a novel photochemical surface immobilization 

technology on a wide variety of substrate materials. The coated articles were evaluated 

for biomolecule immobilization and surface passivation. 

Methods: An example polymer coating was applied to a wide range of substrates. 

These included glass, silicon, and plastics such as polypropylene, polystyrene, 

polymethylmethacrylate and polycycloolefin. The coating contained reactive groups 

to provide specific immobilization and a hydrophilic backbone to provide passivation 

against non-specific binding during assay. Model DNA assays were used to evaluate 

oligonucleotide binding and hybridization efficiency of substrates. An oligonucleotide 

containing a 5’ amine and 3’ biotin label was printed on the coated surfaces to 

determine oligonucleotide binding capabilities of each surface. A hybridization assay 

was done using a biotinylated probe complementary to a capture probe on the surface 

to model assay performance. 

Results: All of the surfaces evaluated bound oligonucleotides to a high signal and 

displayed low levels of background. 

Conclusions: When developing assays for clinical applications, consideration of 

the surface properties and attachment of the biomolecule is critical to maximize 

performance of the array. This work highlights a novel surface modification 

technology that has the versatility and ease of manufacture to be used in a wide range 

of diagnostics assays. 

Figure 1. Fan form 

(HemaForm) and traditional spot filter paper. 

B-267 

Performance Comparison of Filter Papers for Dried Blood Spot 

Analysis by LC-MS/MS 

J. Wright, I. Valmont, J. Hill, J. Hill. Spot On Sciences, Austin, TX 

Background: Dried blood spot (DBS) sampling methods are increasingly used due to 

many advantages over conventional venipuncture collection. Analytical performance 

can vary with differences in absorbent filter paper grades and manufacture. To 

determine optimal filter paper grades for dried blood spot analysis, we compared a 

wide variety of commercially available absorbent materials for sample wicking rates, 

consistency and recovery. 

Methods: More than 35 grades of absorbent materials were tested for whole blood 

wicking rates and consistent sample coverage. Blood was added drop wise by 

pipet onto horizontal materials/filter papers and wicking and spreading behavior 

was observed and, if appropriate, the time to reach the edge of a pre-drawn circle 

was measured. Based on these results, 5 filter paper grades were chosen for further 

analysis: TFN 

(Munktell), 226 (Ahlstrom) and 903, CF10 and CF12 (Whatman). Whole blood 

containing tolbutamide, nifedipine, ramipril and cortisol was spotted on both filter 

paper strips and on pre-cut fan forms (HemaForm; Figure 1) from each of the five 

filter paper grades. The samples were air dried overnight and punches (4 mm) were 

removed from the paper strips and a blade was removed from the fan form. Each 

sample (n=3) was extracted in MeOH:H2O containing deuterated internal standards 

for 30 minutes with sonication and analyzed by LC-MS/MS. 

Results: Recoveries and analytical variability (%CV) was determined for tolbutamide, 

nifedipine, ramipril and cortisol. Consistent recovery values and variability was 

observed between the 5 grades of filter papers and between the traditional spots and 

the fan form. 


A251


Electrolytes/Blood Gas/Metabolites 

B-269 




Certification of Creatinine in Standard Reference Material 3667 

Creatinine in Frozen Human Urine by Liquid Chromatography-Mass 

Spectrometry 

J. E. Camara, K. W. Phinney. NIST, Gaithersburg, MD 

Background: Creatinine levels in serum and urine are important indicators of kidney 

function. In addition, other analytes are often normalized to creatinine levels to adjust 

for urine sample volume variation and very low levels of creatinine in urine may be 

indicative of sample adulteration. The objective of this study was to assign a certified 

creatinine value to a new Standard Reference Material® (SRM) provided by the 

National Institute of Standards and Technology (NIST) in order to support accurate 

creatinine measurements for the clinical community. SRM 3667 Creatinine in Frozen 

Human Urine was prepared from a pool of normal human urine of both males and 

females and contains an endogenous, unmodified level of creatinine. 

Methods: To determine the linearity of the method, stock solutions of SRM 914a 

Creatinine and creatinine-d3 were mixed in appropriate amounts to produce calibrants 

with mass:mass ratios spanning 0.06 to 1.4 in 0.01 mol/L HCl solution. Evaluation of 

method accuracy was performed by spiking known amounts of SRM 914a Creatinine 

into urine at three different levels. For certification analyses, SRM 3667 samples were 

prepared on two separate days (n=36 and n=24, respectively). Urine was combined 

with internal standard solution to achieve a 1:1 creatinine:creatinine-d3 mass ratio. 

The sample was then brought to a final 1:10 (volume fraction) dilution and a final 0.01 

mol/L HCl concentration and allowed to equilibrate overnight. Prior to analysis, urine 

samples were diluted with additional 0.01 mol/L HCl to achieve a final 1:100 (volume 

fraction) concentration compared to original samples. SRM 967a Creatinine in Frozen 

Human Serum was analyzed as a control material. All calibrants and samples were 

separated by reverse-phase liquid chromatography (LC) using an isocratic gradient 

and detected by mass spectrometry (MS) in positive, electrospray ionization mode 

using single ion monitoring (SIM). The possible interferent creatine was also 

monitored by SIM. For additional validation, SRM 3667 was analyzed for creatinine 

by three external laboratories utilizing traditional chemical and enzymatic methods. 

Results: This method displayed linearity over the entire calibrant range (0.05 mg/dL 

to 1.0 mg/dL) with R 2 =0.9988. The % recovery was 104 % to 105 % for each spiked 

level of creatinine. The mean values for Day 1 and Day 2 were 614 μg/g and 612 μg/g, 

respectively, with within-day and overall % CV values ≤ 1 %. The final certified value 

± expanded uncertainty for creatinine in SRM 3667 was reported as 613 μg/g ± 13 

μg/g (61.8 mg/dL ± 1.3 mg/dL). Creatinine values provided by external laboratories 

ranged from 56.3 mg/dL to 67.8 mg/dL. 

Conclusion: This LC-MS method possesses appropriate linearity, accuracy, and 

precision to be utilized in the assignment of a NIST certified value for creatinine in 

SRM 3667. The creatinine value obtained by LC-MS analysis is comparable to values 

obtained by traditional chemical and enzymatic methods from external laboratories. 

SRM 3667 Creatinine in Frozen Human Urine will support accurate measurements of 

creatinine in urine by the clinical community. 

B-270 

Predicting Acute Kidney Injury Using a Novel Quantitative Method 

During Burn Resuscitation 

A. N. Steele, E. Howell, J. Bockhold, Z. Godwin, N. K. Tran. University of 

California Davis, Davis, CA 

Background: Burn patients are at high-risk for acute kidney injury (AKI). AKI 

is frequently the result of hypo-resuscitation and a major cause of death among 

burn population. Serum creatinine and urine output (UOP) are routinely used for 

determining the severity of AKI, however, both poorly reflect renal perfusion status 

during critical illness. Neutrophil gelatinase associated lipocalin (NGAL) may serve 

as a novel biomarker for predicting AKI. We propose an innovative area under the 

curve (AUC) analysis method to determine the clinical significance of creatinine 

and NGAL excursions above their respective reference intervals. Furthermore, 

we hypothesize AUC analysis may better predict AKI in severely burned patients 

compared to traditional biomarker trending and discrete measurements. 

Methods: We conducted a pilot prospective observational study of 15 adult (age 

≥18 years) patients with ≥20% total body surface area (TBSA) burns. NGAL and 

creatinine measurements were determined every 4 hours during the first 48 hours postadmission. 

AKI was defined by the RIFLE criteria. AUC and duration of NGAL and 

creatinine outside their respective reference intervals were calculated. 

Table 1. AKI versus Non-AKI Patients 

AKI 

Patients 

(n = 6) 

Non-AKI 

Patients 

(n = 9) 

P-value 

Mean (SD) Age (years) 40.5 (14.5) 35.8 (14.5) NS 

Mean (SD) TBSA (%) 49.3 (23.4) 40.6 (18.5) NS 

Gender (M, F) 5,1 8,1 NS 

184.9 

Mean (SD) NGAL (ng/mL) 

110.8 (5.2) 0.016 

(72.2) 

Mean (SD) Serum Creatinine (mg/dL) 1.36 (0.67) 0.99 (0.13) NS 

Mean (SD) Urine Output (mL/hr) 87.1 (28.6) 85.2 (56.1) NS 

Mean (SD) NGAL AUC above reference interval 2839 

672 (237) 0.022 

(ng·hr/mL) 

(1004) 

Mean (SD) Time NGAL was below reference interval 

6.6 (5.2) 11.6 (4.1) 0.032 

(hr) 

Mean (SD) Serum Creatinine AUC below reference 

3.0 (1.1) 4.2 (1.8) 0.035 

interval (mg·hr/dL) 

Mean (SD) Time creatinine was above reference 

13.7 (4.8) 7.7 (2.7) 0.002 

interval (hr) 

Mean (SD) Time creatinine was below reference 

9.6 (3.4) 14.5 (5.1) 0.013 

interval (hr) 

Note: Reference intervals for serum creatinine and NGAL are 0.6-1.2 mg/dL and 40-100 ng/ 

mL, respectively. 

Abbreviations: AKI, acute kidney injury; AUC, area under the curve; F, female; M, male; 

SD, standard deviation; TBSA, total body surface area 

Results: Study results are summarized in Table 1. Patient demographics were similar 

between AKI and non-AKI patients. Creatinine was also similar between the two 

groups. Multivariate logistic regression showed creatinine time below (OR 0.94, 

95% CI 0.89-0.99, P=0.012) and NGAL AUC above (OR 1.01, 95% CI 1.00-1.02, 

P=0.038). Their respective reference intervals served as independent predictors for 

AKI. 

Conclusions: Discrete serum creatinine and UOP measurements are inadequate 

for predicting AKI in severely burned patients. In contrast, NGAL serves as an 

early independent predictor of AKI. Our innovative AUC method helps to better 

characterize NGAL and creatinine excursion beyond their reference-intervals to 

augment the clinical utility of biomarkers such as NGAL and creatinine for predicting 

AKI. Future studies are warranted to further validate the AUC method during critical 

illness. 

B-272 

Effect of Non-Glucose Carbohydrates on the Measurement of Glucose 

with Blood Gas Analyzers 

M. E. Lyon. Royal University Hospital, Saskatoon, SK, Canada 

Background: The ability of non-glucose carbohydrates like maltose, galactose and 

xylose to falsely elevate blood glucose results with certain analytical methods has 

been well documented. 

Objective: To evaluate the impact of maltose, xylose, galactose and glucosamine on 

the performance of blood gas analyzer glucose electrodes. 

Methods: Glucose was measured using left over patient whole blood specimens 

spiked with increasing concentrations of either maltose, xylose, galactose or 

glucosamine, and the change in glucose concentration from the non-spiked baseline 

specimen was calculated. Glucose concentration was measured using the following 

blood gas analyzers: GEM 3500 (Instrumentation Laboratory, Boston, MA), ABL90 

(Radiometer, Copenhagen, Denmark) and ABL800 (Radiometer, Copenhagen, 

Denmark). The concentrations of the interferents tested were: maltose (2, 5, and 10 

mmol/L); galactose (2, 5 and 10 mmol/L); xylose (1, 2 and 3 mmol/L); glucosamine 

(1, 3 and 5 mmol/L). Mean and standard deviation (SD) changes in glucose 

concentrations resulting from the addition of the interferent were calculated. 

Results: The mean changes in glucose concentration observed with a) Maltose at 2, 5 

and 10 mmol/L and the GEM 3500 were -0.05, -0.06 and -0.19 mmol/L, respectively; 

the ABL90 were -0.02, -0.08 and -0.19 mmol/L, respectively; ABL800 were -0.11, 

-0.17 and -.28 mmol/L, respectively b) Galactose at 2, 5 and 10 mmol/L and the GEM 

3500 were 0.57, 1.51 and 2.70 mmol/L, respectively; the ABL90 were 0.03, 0.13 and 

0.26 mmol/L, respectively; ABL800 were 0.11, 0.29 and 0.61 mmol/L, respectively 




c) Xylose at 1, 2 and 3 mmol/L and the GEM 3500 were 0.46, 0.58 and 0.98 mmol/L, 

respectively; the ABL90 were -0.08, -0.14 and -0.17 mmol/L, respectively; ABL800 

were 0.01, -0.02 and -0.07 mmol/L, respectively and d) Glucosamine at 1, 3 and 5 

mmol/L and the GEM 3500 were 0.33 , 0.93 and 1.47 mmol/L, respectively; the 

ABL90 were 0.06, 0.15 and 0.26 mmol/L, respectively; ABL800 were 0.04, 0.20 and 

0.35 mmol/L, respectively. 

Conclusions: The glucose methods with different blood gas analyzers demonstrated 

varying degrees of susceptibility to interference by non-glucose carbohydrates like 

maltose, xylose and galactose as well as glucosamine. 

B-273 

Influence of Sodium Replacement Rate in Osmotic Demyelination 

Syndrome 

V. Palamalai, A. A. Killeen. University of Minnesota, Minneapolis, MN 

Background: Osmotic demyelination syndrome (ODS) can result from over-rapid 

correction of hyponatremia. We sought to determine the optimal rate of sodium 

replenishment based on published cases of ODS. 

Methods:The PubMed database was queried using the key words central pontine 

myelinolysis, osmotic demyelination syndrome, and extrapontine myelinolysis 

and over 400 articles were retrieved. The information regarding rate of sodium 

replacement was obtained from these articles and used to determine the number of 

cases of ODS that occurred at different rates of sodium replacement. 

Results: In the current review, alcoholism was seen in over 30 % of cases. The next 

significant association was with dehydrating conditions either by emesis or diarrhea. 

Liver disorders and associated transplantations were the next significant category. At 

a rate of replacement of 6 mmol/L/day, less than 10 % of individuals were affected 

by ODS, while at 9 mmol/L/day less than 15 % of individuals were affected. Both 

morbidity and mortality significantly increased at rates of replacement > 10 mmol/L/ 

day. ODS is a condition in which the maxim prevention is better than cure holds good. 

Although mortality has come down, significant morbidity still persists with almost 60 

% of survivors having significant persistent disability. 

Conclusions: The prevalence of ODS is related to the rate of replacement of sodium. 

With rates < 9 mmol/L/day the likelihood of developing ODS is reduced compared 

to faster rates of sodium replenishment, however the risk of developing ODS is not 

completely eliminated even at lower rates. 

B-275 

Measures reducing discrepancies in arterial PO2 results between 

POCT and standard laboratory blood gases analysis 

Y. Zhu, C. A. Schmidt, A. G. Sofronescu, N. A. Epps, K. Q. Washington, 

F. S. Nolte, B. D. Horne, R. Martinette, L. C. Fuller. Medical University of 

South Carolina, Charleston, SC 

Background: Previous studies have shown that specimens transported by pneumatic 

tube systems (PTS) may have falsely elevated PO 2 

due to air contamination. We have 

also observed that in some samples, the difference in PO 2 

values measured by i-STAT 

Point of care testing (POCT) and Radiometer, a standard laboratory blood gases 

analyzer can be more than 10 mmHg, which is considered clinically significant. Since 

no specimen transport is needed in POCT, we hypothesize that the higher values of 

PO 2 

measured by Radiometer are due to air contamination during blood collection 

and subsequent air mixing with the blood during PTS transport. The objective of this 

study is to determine if use of air bubble removal device, manual specimen delivery, 

PTS transport with padding can reduce the bias in PO 2 

values between i-STAT and 

Radiometer. 

Methods: Twenty patients were enrolled in the study. Four blood samples were 

collected by respiratory therapists from each patient with a central line using Filter- 

Pro Vent Blood Sampling kit with Air Bubble Removal device. Air bubbles were 

removed immediately after collection according to the manufacture’s instruction. 

The first specimen was measured by i-STAT and the rest of three specimens were 

sent to the lab in three different ways: 1) walked to the laboratory, 2) sent via PTS 

with padding, and 3) sent via PTS without padding. All specimens were analyzed in 

duplicate within 15 minutes of collection. We compared PO 2 

results via a two-sided, 

paired t-test and P< 0.05 was considered statistically significant and the bias greater 

10 mmHg was considered clinically significant. 

Results: The average PO 2 

(mean ± SD) values measured by i-STAT and Radiometer 

were 80.3 ± 27.0 (i-STAT), 84.2 ± 27.9 (walked sample), 85.3 ± 28.5 (PTS with 

padding), and 86.9 ± 28.9 mmHg (PTS without padding) respectively and the 

difference in PO2 values between i-STAT and Radiometer were statistically 

significant (all P values < 0.05). The mean differences (mean ± SD) between i-STAT 

and Radiometer were 3.9 ± 4.2 (walked samples), 5.0 ± 3.1 (PTS with padding), and 

6.8 ± 4.2 mmHg (PTS without padding) respectively. The difference in PO 2 

values 

between walked and PTS with padding samples was statistically insignificant (P = 

0.11), but the difference between walked and PTS without padding samples was 

statistically significant (P < 0.05) 

Conclusion: Compared to i-STAT, PO 2 

values measured by Radiometer are still 

higher even using the air bubble removal device, suggesting that there is a systematic 

error between i-STAT and Radiometer. However, the average bias is less than 10 

mmHg, indicating that use of air bubble removal device reduces the bias to the 

clinically insignificant levels. There is no statistically significant difference in PO 2 

values between walked and PTS with padding samples, but the difference between 

walked and PTS without padding samples is statistically significant, suggesting that 

padding can reduce PO 2 

bias for samples transported via PTS. 

B-276 

Short and Long-Term Verification of Performance Between Lots of 

Reagent with Patient Specimens. A Practical Example with a Blood 

Calcium Assay. 

V. M. Genta 1 , R. Murray 1 , E. Ravago 1 , D. Cline 2 , W. Tang 1 , D. Greiber 1 . 

1 

Sentara Virginia Beach General Hospital, Virginia Beach, VA, 2 Sentara 

Healthcare, Norfolk, VA 

Background: Calcium blood values are monitored by physicians for diagnosing 

disorders of calcium metabolism (e.g. hyperparathyroidism and osteoporosis), 

for assessing the effects of treatment, and for monitoring calcium homeostasis. 

Consequently, the laboratorian has to ensure uniformity of performance of the 

calcium assay within and between lots of reagents. We report three years experience 

in monitoring homogeneous performance of a blood calcium assay. 

Methods: The calcium assay was performed between 2010 and 2013 with two 

Cobas® c501 (Roche) instruments using Roche reagents, with their assigned 

calibration set-point, on patient blood specimens obtained by venipuncture prior to 

elective surgery. The short term homogeneity of performance was evaluated with the 

paired t-Test. Power analysis for the paired t-Test, using prior experience, showed 

that for alpha = 0.05, difference = 0.25 mg/dL, standard error of the difference = 

0.2 mg/dL, ten patient specimens would ensure a power = 0.95. Upon receipt of a 

new reagent, ten patient blood specimens were assayed in parallel, and within one 

hour, with the old and the new lot using their respective calibration set-points. The 

long term homogeneity of performance was verified by comparing the distribution 

of the values obtained by assaying patient blood specimens over a period of several 

months with a new lot of reagent, to the distribution of the values obtained with the 

previous lots of reagent for similar patient population. Power analysis, paired t-Test, 

descriptive statistics, ANOVA, Anderson-Darling test for normality and their graphic 

representations were performed using Minitab® (Version 16, Minitab Inc.) statistical 

software. 

Results: The paired t-Test showed statistically significant differences between lots of 

reagent (P < 0.05). However, for each comparison the mean differences were less than 

0.3 mg/dL with a maximum standard error of the mean = 0.14 mg/dL. Furthermore, 

the plot of the differences between new and old lot by the value of calcium as 

determined with the old lot showed that the differences were within 0 and 0.5 mg/ 

dL. The new reagent lot with its set-point was accepted. The long-term studies, using 

patient specimens, showed no statistically significant differences between means and 

standard deviations (P>0.05) for blood calcium values as determined with several 

reagent lots for similar patient populations. The Anderson-Darling test did not show 

statistically significant departures from normality (P > 0.05 ) for each distribution and 

the normal probability plots showed overlapping distributions for each reagent lot. 

Conclusions: These observations clearly showed that the paired t-Test and its graphic 

representation performed on ten paired observations would identify differences greater 

than 0.25 mg/dL between lots of reagents.Since no mean difference exceeded 0.3 mg/ 

dL, no correction of the set point for that lot of reagent was deemed necessary. This 

decision was corroborated by the long-term study showing equality of distribution 

of calcium values for presurgery patients as determined with several lots of reagent. 

Finally, it is clear that to perform these data analyses appropriate statistical software 

has to be available to the laboratorian. 


A253



B-277 

Salicylate Interference with an Indirect ISE Method Causes Falsely 

Elevated Chloride Results 

R. M. Jackson, J. W. Meeusen, N. V. Tolan, J. H. Steuernagle, Q. Qian, 

B. S. Karon, P. J. Jannetto, D. R. Block, N. A. Baumann. Mayo Clinic, 

Rochester, MN 

Background: Salicylate interference with the Roche Cobas Integra 400 chloride ionselective 

electrode (ISE) direct method has been reported. However, the manufacturer 

product information states that there is no significant salicylate interference for 

the indirect method (up to 3 mmol/L salicylate (414 mg/dL)). A recent case of 

pseudohyperchloridemia (181 mmol/L) associated with toxic serum levels of 

salicylate (35 mg/dL) at our institution lead us to further characterize the extent of 

salicylate interference with the Integra 400 chloride ISE indirect method. 

Objectives: (1) To correlate the extent of false-elevation in chloride concentration due 

to salicylate interference with both salicylate concentration and ISE time in service 

(2) To determine the prevalence and impact of this interference in a hospitalized 

patient population and (3) To test the use of anion gap as a mechanism to identify 

pseudohyperchoridemia and prevent reporting of erroneous results. 

Methods: Chloride in plasma or serum was measured using both the Roche Integra 

400 ISE indirect method and the Roche Cobas 8000 ISE module indirect method. 

Serum salicylate was quantified using an EMIT assay on the AU680 Beckman Coulter, 

Inc analyzer. Chloride was measured in residual salicylate-positive serum (n=26) and 

electrolyte results were reviewed. Pooled waste salicylate-negative serum was spiked 

with salicylate (0-150 mg/dL) and aliquots were frozen. Chloride measurements were 

repeated over the service life of electrode (0-45 days). Three hundred consecutive 

waste plasma samples from hospitalized patients were screened for presence of 

salicylate. Over a five month period, physician-ordered electrolyte panels measured 

on the Integra 400 ISE with chloride >130 mmol/L and a low anion gap (5 mmol/L 

(range 0-44 mmol/L). 

Conclusions: There is significant salicylate interference with the Integra 400 chloride 

ISE indirect method and the extent of the interference increases with both salicylate 

concentration and electrode time in service. Chloride results in combination with 

low or negative anion gap can be used to identify possible chloride interference and 

avoid reporting of erroneous results. Salicylate does not interfere with the Cobas 8000 

chloride ISE indirect method. 

B-278 

Ionized Calcium Measurement in CRRT 

J. Penman, G. N. Hoag. Vancouver Island Health Authority, Victoria, BC, 

Canada 

Background: Continuous renal replacement therapy (CRRT) is an increasingly 

popular alternative to hemodialysis with fewer complications. Venous blood is 

circulated through an extracorporeal device, usually anticoagulated by citrate, with 

the subsequent addition of calcium prior to the blood being returned to the patient. 

The addition of citrate and subsequently calcium in the CRRT circuit is based on 

empirical algorithms using ionized calcium measurements of the patient’s blood 

prior to the CRRT device and prior to return to the patient. Adjustments to added 

citrate and calcium are based on ionized calcium measurements down to 0.25 mmol/L 

and ionized calcium changes of 0.05 mmol/L. Algorithms are widely employed but 

literature to support the measurement of ionized calcium at this level is lacking. 

PURPOSE: The purpose of this project was to evaluate the ability of Instrumentation 

Laboratories GEM4000 and Radiometer ABL 835 point of care analyzer systems 

(used in our institutions for CRRT monitoring) to measure ionized calcium at nonphysiological 

levels with sufficient accuracy and precision. 

METHODS: All the test systems had been previously verified according to our 

standard operating procedures. Accuracy was assessed from results obtained with 

College of American Pathologists (CAP) proficiency testing material and each 

manufacturer’s own calibration/linearity material. Total imprecision was determined 

by measuring ionized calcium with theoretical target values between 0.27 and 0.50 

mmol/L, created by mixing of each manufacturer’s material. 

RESULTS: The test systems demonstrated adequate precision to discriminate ionized 

calciums differing by 0.05 mmol/L: 

•ABL: 0.53(3.1), 0.47(3.5), 0.41(3.6), 0.36(3.3), 0.31(4.0), 0.27(3.2), mmol/L(CV%) 

•GEM: 0.50(1.4), 0.40(1.6), 0.32(2.1), 0.25(2.4), 0.18(3.2), 0.11(3.0), mmol/L(CV%) 

Both test systems showed similar accuracy with CAP proficiency testing material and 

similar accuracy and correlation with both systems’ calibration/linearity materials. 

Each system showed better accuracy compared to the target values provided for its 

own calibration/linearity material. 

Both systems compared closely but not identically to another analyzer from the same 

manufacturer: 

•ABL: 0.38 & 0.41 at a target of 0.35 mmol/L with Radiometer calibrator/Linearity 

material 

•GEM: 0.31 & 0.32 at a target of 0.35 mmol/L with IL calibrator/Linearity material 

•Comparing both systems to the stated “true value” of the Radiometer calibration/ 

lineartity material (supplied by Radiometer and differing from their target values 

provided for calibration/linearity): 

•Both systems were closest at 0.05 mmol/L (ABL 0.56 mmol/L and GEM 0.55 

mmol/L) 

•They diverged from each other below 0.50 mmol/L. 

•At 0.25 mmol/L the ABL system registered 0.33 mmol/L and the GEM registered 

0.21 mmol/L. 

CONCLUSIONS: Both analyzer systems were sufficiently precise to reliably detect 

changes in ionized calcium as small as 0.05 mmol/L defined by the CRRT algorithms. 

However both gave results that differed by as much as 0.08 mmol/L from a stated 

“true value” of 0.25 mmol/L. 

This indicates: 

•Any given algorithm for CRRT may need to be adjusted for the specific analyzer 

system (and ideally the individual analyzer), and 

•Results from more than one analyzer system should not be used to monitor and 

control a given CRRT therapy session. 

B-279 

Carboxyhemoglobin - Pre-analytical Errors from Blood Collection 

Devices 

P. V. A. Pamidi, H. Yim. Instrumentation Laboratory, Bedford, MA 

CO-Oximetry based Carboxyhemoglobin (COHb) measurements are routinely used 

to assess carbon monoxide poisoning. Blood samples collected in different devices 

(syringes and evacuated blood collection tubes) are routinely used in hospitals and 

laboratories for clinical chemistry assays. Instrumentation Laboratory (IL) has 

recently learned through a customer evaluation that blood samples collected in 

plastic tubes containing lithium heparin and gel separator can significantly elevate 

the carboxyhemoglobin (COHb) levels. Pre-analytical errors in Carboxyhemoglobin 

measurements from different blood collection devices in CO-Oximetry analyzers are 

evaluated in this study. 

Blood samples collected in different blood collection tubes and syringes (from 

a healthy volunteer) were used for COHb measurements in three CO-Oximetry 

analyzers (GEM Premier 4000 and IL 682 from Instrumentation Laboratory and 

ABL 837 from Radiometer). Carboxyhemoglobin measurements from blood samples 

collected with arterial syringes, glass or plastic evaluated tubes with or without gel 

separator are summarized in figure below. Plastic blood collection tubes and draw 

volume showed significant potential for pre-analytical errors. All blood collection 

tubes with gel barrier showed increased bias in COHb measurements compared to 

arterial syringes. 




Conclusions: Plastic blood collection tubes with gel barrier showed elevation 

in Carboxyhemoglobin results compared to arterial syringes. Sample draw 

volume variations in plastic collection tubes can cause pre-analytical errors in 

Carboxyhemoglobin measurements. 

B-281 

Performance Evaluation of Homocysteine on Beckman Coulter 

AU5822 Analyzer 

M. K. Zimmerman 1 , P. A. Vollmer 2 . 1 Indiana University School of Medicine, 

Indianapolis, IN, 2 Indiana University Health, Indianapolis, IN 

B-280 

Application of Predictive End Point Methodology in GEM® Analyzers 

J. CERVERA, N. Raymond, S. Mansouri. Instrumentation Laboratory, 

Bedford, MA 

Rapid report of clinical parameters such as blood gases and metabolites is important in 

critical care areas for prognosis and clinical outcome. Typically, such measurements 

are accomplished by blood analyzers using various electrochemical sensors and the 

result is reported when the sensor output has reached an end point which is close 

to an equilibrium or steady state level. However, reaching an end point for sensors 

with diffusion controlled response characteristic, such as pO2 and glucose could cause 

delay in reporting the sample results. 

This paper describes a methodology for reducing time to result by predicting the end 

point through signal extrapolation before the sensor response reaches equilibrium or 

steady state. This is accomplished by fitting the generated voltametric or amperometric 

sensor signals with a logarithmic function of response time. The methodology allows 

for using a simple linear or quadratic curve fitting equation for end point prediction. In 

addition, the curve fitting method requires methods to detect and eliminate incorrect 

data points that could cause an incorrect extrapolation, resulting in incorrect results. 

This paper will also discuss the processes selected to assure sample data integrity. 

Predictive end point methodology was applied to the sensor response in the GEM® 

Premier 4000 analyzers (Instrumentation Laboratory, Bedford, MA) during the 

evaluation test. Sensor output is collected at one second intervals and the response 

from 15 to 30 seconds was used to predict the end result at 55 seconds. Data from six 

GEM Premier 4000 analyzers running five levels of quality control materials over a 

period of four weeks were pooled and processed. Examples of the predicted and actual 

end points for all sensor types are summarized in the following table. There is a good 

agreement between the predicted and actual values. This study demonstrates capability 

of the new predictive method for reducing time to result in clinical analyzers. 

Analytes QC Average from Average from Average 

Average from Average from 

QC 

Average 

traditional curve fitting of Analytes traditional curve fitting 

Level 

Level 

of Delta 

methodology methodology Delta 

methodology methodology 

PO2 1 35 32 -2.5 Sodium 1 107 107 -0.3 

2 51 49 -2.1 2 126 126 -0.4 

3 91 90 -1.5 3 140 140 -0.4 

4 262 263 0.8 4 156 157 -0.6 

5 565 571 6.2 5 178 179 -0.7 

PCO2 1 21 21 0.2 Potassium 1 1.18 1.18 -0.004 

2 36 35 -0.2 2 2.79 2.79 -0.007 

3 65 65 0.0 3 4.94 4.95 -0.011 

4 96 95 0.5 4 6.81 6.83 -0.020 

5 124 125 1.0 5 10.15 10.18 -0.026 

Glucose 1 17 17 0.07 Calcium 1 3.08 3.09 -0.018 

2 94 94 0.2 2 1.56 1.56 -0.007 

3 194 195 0.69 3 1.12 1.13 -0.004 

4 472 472 0.46 4 0.64 0.64 -0.002 

5 676 674 -2.01 5 0.35 0.35 0.000 

Lactate 1 0.4 0.4 0.01 Chloride 1 68 68 0.2 

2 0.9 0.9 0 2 83 83 0.2 

3 4.3 4.3 0.03 3 100 99 0.2 

4 10.3 10.4 0.08 4 127 127 0.4 

5 15.3 15.4 0.11 5 156 155 0.4 

Background: The thiol-containing amino acid, homocysteine (Hcy), produced in the 

metabolism of methionine, has emerged as a risk factor for cardiovascular disease. 

Hcy measurement can also be useful in the diagnosis of B 12 

deficiency in untreated 

patients. This study examines the performance of an user defined reagent for the 

measurement of Hcy on our two Beckman Coulter AU5822s (AU1, AU2) to replace 

previous measurement on the Beckman Coulter DxC800. 

Methods: Diazyme’s Homocysteine 2 enzymatic assay assesses a co-substrate 

conversion product instead of assessing a co-substrate or a Hcy conversion product. 

Homocysteine is reacted with a co-substrate, S-adenosylmethionine (SAM) to 

form methionine and S-adenosylhomocysteine (SAH) in a reaction catalyzed by 

Hcy S-methyltransferase. SAH hydrolyzed into adenosine (Ado) and Hcy by SAH 

hydrolase. The formed Ado is hydrolyzed into inosine and ammonia, which reacts 

with glutamate dehydrogenase, concomitantly converting NADH to NAD+, with the 

change in absorbance monitored at 340nm. The concentration of Hcy is indirectly 

proportional to the amount of NADH converted. 

Results: Within run precision CVs (n=20) using two levels of controls were on 1.7% 

and 3.0% on AU1 and 2.4% and 2.2% on AU2. Between run precision (20 days) was 

6.1% and 2.5% on AU1 and 2.1% and 2.4% on AU2. The assay showed good linearity 

with 5 point calibrators across a range of 2.0-50 μmol/L with a slope of 0.999 and an 

intercept of -0.01 on AU1 and a slope of 0.978 and an intercept of -0.13 on AU2. The 

assay analytical sensitivity was 0.09 μmol/L on AU1 and 0.08 μmol/L on AU2 with a 

manufacturer stated sensitivity of 0.4 μmol/L. Method comparison results with patient 

samples (n=46, 5.8 to 24.6 μmol/L) to the DXC800 homocysteine gave Deming 

regression: AU1 = 0.957[DxC] + (-0.01) and AU2 = 1.068[DXC800] + (-0.98). 

Conclusion: The Diazyme’s Homocysteine 2 method on the AU5822 shows 

acceptable analytical performance. 

B-282 

Performance Evaluation of β-hydroxybutyrate on Beckman Coulter 

AU5822 Analyzer 

P. A. Vollmer 1 , M. K. Zimmerman 2 . 1 

Indiana University Health, 

Indianapolis, IN, 2 Indiana University School of Medicine, Indianapolis, IN 

Background: Ketosis can be seen in starvation, diabetes mellitus, acute 

illnesses as well as a normal biological response. When associated with a lifethreatening 

metabolic acidosis, the degree of ketosis can be assessed by measuring 

β-hydroxybutyrate(BOHB). It is a better measure of the degree of ketoacidosis 

than the other ketone bodies, acetoacetate and acetone. This study examines the 

performance of an user defined reagent for the measurement of BOH on our two 

Beckman Coulter AU5822s (AU1, AU2) to replace previous measurement on the 

Beckman Coulter DxC800. 

Methods: Stanbio Laboratory’s β-hydroxybutyrate LiquiColor® assay is 

enzymatically quantitates BOHB byusing D-3-hydroxybutyrate dehydrogenase 

to convert BOHB and NAD to acetoacetate and NADH. NADH reacts with INT 

(oxidized) in the presence of diaphorase to produce a colored product that is measured 

at 505 nm. 

Results: Within run precision CVs (n=20) using two levels of controls were on 0.0% 

and 0.8% on AU1 and 0.0% and 0.4% on AU2. Between run precision (20 days) was 

6.3% and 1.1% on AU1 and 1.3% and 0.8% on AU2. The assay showed good linearity 

with 7 point calibrators across a range of 0.02-8.00 mmol/L with a slope of 0.990 

and an intercept of -0.001 on AU1 and a slope of 1.065 and an intercept of -0.011 on 

AU2. The assay analytical sensitivity was 0.001 mmol/L on AU1 and 0.003 mmol/L 

on AU2 with a manufacturer stated sensitivity of 0.18 mmol/L. Method comparison 

results with patient samples (n=46, 0.05 to 11.25 mmol/L) to the DXC800 BOH gave 

Deming regression: AU1 = 1.005[DxC] + (-0.034) and AU2 = 1.022[DXC800] + 

(-0.046). 

Conclusion: Stanbio aboratories β-hydroxybutyrate LiquiColor® method on the 

AU5822 shows acceptable analytical performance. 


A255



B-283 

Spiked Samples Respond Differently in Two Bilirubin Methods after 

In Vitro Irradiation - Vanadate vs. Diazo Methods 

P. Datta, J. Dai. Siemens Healthcare Diagnostics, Tarrytown, NY 

Background: Serum total bilirubin (TBIL) can be measured by Diazo (measured 

at 552 nm) and Vanadate methods (measured at 451 nm). The Vanadate method 

used by the Siemens ADVIA® ChemistryTBIL_2 assay, has less interference from 

hemoglobin (λ max 

541 nm) than some of the Diazo methods. Bilirubin, when irradiated 

at 450 nm, undergoes conversion to photobilirubins (PBIL). PBIL can form in vitro or 

in vivo. The presence of PBIL in samples may impact the bilirubin measurement. We 

investigated the responses of 2 bilirubin methods to the presence of PBIL in native and 

spiked human serum samples. 

Methods: 

The Diazo reference bilirubin method was performed according to literature (Clin 

Chem 31:1779). The Vanadate method was performed on the ADVIA 1650 system 

using ADVIA Chemistry TBIL_2 reagents. Five serum samples spiked with 

unconjugated bilirubin ranging from 13.3-25.4 mg/dL and six native individual 

patient serum samples with bilirubin concentrations ranging from 7.8-25 mg/dL, were 

irradiated in vitro (on ice) at 450nm for 0, 10, and 30 minutes, and then assayed 

immediately by 1)Diazo reference method, 2)ADVIA Chemistry TBIL_2 method, and 

3)wavelength scan on NanoDrop instrument to monitor the photobilirubin formation. 

Results: There is a good correlation between the reductions of bilirubin results with 

both methods vs. the percent reduction in sample absorbance at 455 nm (bilirubin 

peak) due to irradiation. With native patient samples without in vitro irradiation, 

the Vanadate method correlated well with the Diazo reference method. With spiked 

samples, differences in bilirubin results between these two methods were observed. 

The difference is more obvious for spiked samples after irradiation: 

Irradiation Time (Min) 

Regression Equations (Y: Vanadate method; X: Diazo method) 

Native Sample 

Spiked Sample 

0 Y=1.0266x-0.268(r^2=0.9958) Y= 0.9892x+2.795(r^2=0.9982) 

10 Y=1.0622x+0.1412(r^2=0.9944) Y=1.1152x+2.648(r^2=0.9123) 

30 Y=1.1069x+0.5179(r^2=0.9828) Y=1.6102x-0.949(r^2=0.9918) 

Conclusion: Without in vitro irradiation, both Vanadate and Diazo methods measure 

bilirubin equivalently for the native samples; spiked bilirubin samples showed bias 

with Vanadate method. In vitro irradiation leads to higher impact on spiked samples 

than native samples in terms of the difference between the Vanadate and Diazo 

methods. 


Pediatric/Fetal Clinical Chemistry 


B-284 




Biological Variation and Quality Specifications for 38 Biochemical 

Markers in a Pediatric Population 

V. Bevilacqua, D. Bailey, D. A. Colantonio, M. D. Pasic, M. Chan, K. 

Adeli. Clinical Biochemistry, The Hospital for Sick Children, University of 

Toronto, Toronto, ON, Canada 

Background: Studies of biological variation provide insight into the physiological 

changes that occur within- and between-subjects for a given analyte. In a clinical 

context, values obtained from such investigations are especially crucial for patient 

monitoring and follow up processes. Furthermore, this information can be used to 

establish quality specifications. Specifically, in order to ensure appropriate clinical 

interpretation of lab test results, analytical error must be significantly lower than 

biological variation seen in an individual or population. A consensus statement 

published in the Scandinavian Journal of Clinical and Laboratory Investigation 

states that basing quality specifications on biological variation is the preferred model, 

second only to determining quality specifications based on the effect of analytical 

performance on specific clinical decision making, an exceptionally difficult and time 

consuming approach. 

Purpose: This study aimed to evaluate the short-term biological variation of 38 

chemistry, lipid, enzyme and protein analytes in a pediatric population (N=29) and 

to assess the effect of age-specific partitions on interindividual variation. In addition, 

quality specifications for precision, bias, and total allowable error were calculated 

from the biological variation values. Finally, differences in biological variation 

between pediatric and adult populations were assessed. 

Methods: Within a 10-hour period, four plasma samples were obtained from each of 

29 healthy children (52% males) aged 4-18. Samples were drawn after an overnight 

fast, mid-morning after breakfast, within 2h after lunch and in the late afternoon. 

Samples were stored at -80-degrees and analyzed in three batches, with 9-10 subjects 

per batch, in order to quantify all analytes without introducing additional freeze-thaw 

cycles. Intra-individual and inter-individual biological variation were established 

using nested analysis of variance after exclusion of outliers using Tukey outlier test. 

Analytical quality specifications were established using the method outlined by Fraser. 

Results: Biological variation and analytical variation coefficients as well as analytical 

goals (precision, bias, total allowable error) were established using a pediatric 

population for 38 chemistry, lipid, enzyme and protein assays. Age-partitioning was 

required for six analytes (alkaline phosphatase, AST, creatinine, LDH, phosphate, and 

uric acid). Most results, with the exception of CRP and iron, were in line with adult 

values found in the Westgard database on biological variation. In addition, biological 

variation and analytical goals for two previously unreported analytes, unconguated 

bilirubin and soluble transferrin receptor, were established. 

Conclusion: This study is the first to examine biological variation and to establish 

analytical quality specifications based on biological variation for common assays in 

a pediatric population. These results provide insight into pediatric physiology, are of 

use for reference change value calculations, clarify the appropriateness of reference 

interval use, and aid in the development of quality management strategies specific to 

pediatric laboratories. 

B-285 

CLSI-based Transference of the CALIPER Database of Pediatric 

Reference Intervals: Direct Validation Using Reference Samples from 

the CALIPER Cohort 

M. Estey 1 , A. Cohen 1 , D. Colantonio 1 , M. Chan 1 , T. Binesh Marvasti 1 , E. 

Randell 2 , E. Delvin 3 , J. Cousineau 3 , V. Grey 4 , D. Greenway 5 , Q. Meng 6 , 

B. Jung 7 , J. Bhuiyan 7 , D. Seccombe 8 , K. Adeli 1 . 1 The Hospital for Sick 

Children, Toronto, ON, Canada, 2 Eastern Health, St. John’s, NL, Canada, 

3 

Sainte-Justine Hospital, Montreal, QC, Canada, 4 McMaster Children 

Hospital, Hamilton, ON, Canada, 5 The Ottawa Hospital, Ottawa, ON, 

Canada, 6 Royal University Hospital, Saskatoon, SK, Canada, 7 BC 

Children’s Hospital, Vancouver, BC, Canada, 8 CEQAL, Vancouver, BC, 

Canada 

Objectives: The CALIPER program recently established a comprehensive database 

of age- and sex-stratified pediatric reference intervals for fourty biochemical markers. 

However, this database was only directly applicable for Abbott ARCHITECT assays. 

We therefore sought to expand the applicability of this database to biochemical 

assays from other major manufacturers, allowing for a much wider application of the 

CALIPER database. 

Methodology: Based on CLSI C28-A3 and EP9-A2 guidelines, CALIPER reference 

intervals were transferred (using specific statistical criteria) to assays performed 

on four other commonly used clinical chemistry platforms including the Beckman 

Coulter DxC800, Ortho Vitros 5600, Roche Cobas 6000, and Siemens Vista 1500 

analyzers. The resulting reference intervals were subjected to a thorough validation 

using 100 reference specimens (healthy community children and adolescents) from 

the CALIPER bio-bank, and all testing centres participated in an external quality 

assessment (EQA) evaluation. 

Results: In general, the transferred pediatric reference intervals were similar to those 

established in our previous study. However, assay-specific differences in reference 

limits were observed for many analytes, and in some instances were considerable. 

The results of the EQA evaluation generally mimicked the similarities and differences 

in reference limits amongst the five manufacturer’s assays. In addition, the majority 

of transferred reference intervals were validated through the analysis of CALIPER 

reference samples. 

Conclusions and relevance: This study greatly extends the utility of the CALIPER 

reference interval database, which is now directly applicable for assays performed on 

five major analytical platforms in clinical use. The expanded database should permit 

the worldwide application of CALIPER pediatric reference intervals. 

B-287 

Excellent Diagnostic Performance of the Quanta-Flash® Celiac 

Disease Assays in the Pediatric Population 

P. Martis 1 , R. Burlingame 1 , P. Carrion 1 , M. Alessio 2 , G. Previtali 2 , G. Lakos 1 . 

1 

INOVA Diagnostics, Inc., San Diego, CA, 2 Dipartimento di Patologia 

Clinica, Laboratorio Analisi, AO Papa Giovanni XXIII, Bergamo, Italy 

Background: The diagnosis of celiac disease (CD) has traditionally depended upon 

intestinal biopsies, but serological markers such as endomysial antibodies (EMA), 

anti -tissue transglutaminase (tTG) antibodies, and more recently, anti-deamidated 

gliadin petide (DGP) antibodies have been gaining a lot of attention and significance. 

Recently, the European Society for Pediatric Gastroenterology, Hepatology, and 

Nutrition (ESPGHAN) published guidelines allowing the diagnosis of CD without a 

biopsy in some situations. Consequently, more weight is placed on serological tests. 

The QUANTA-Flash® h-tTG IgA and 

IgG, and DGP IgA and IgG are new, fully automated microparticle chemiluminescent 

immunoassays (CIA) for the measurement of CD antibodies. Our goal was to evaluate 

the diagnostic performance of these assays in the pediatric population. 

Methods: One hundred-seventy four to 232 pediatric samples (depending on the 

type of the assay) were tested with the CD specific tests. The cohorts included CD 

patients and controls who sought medical attention because of various CD-suggestive 

symptoms, but in whom CD was excluded based on physical exam and diagnostic 

tests. Diagnostic sensitivity and specificity of each assay were calculated, and 

compared to characteristics obtained on an adult population of altogether 476 to 556 

patients and controls. 


A257



Results: 

CD patients and controls were divided into age groups (infant, child and adolescent) 

according to the recommendation of the FDA. Clinical sensitivity and specificity of 

the individual antibody assays were calculated for the three age groups separately, and 

also for the total pediatric population. Sensitivity values for tTG IgA, tTG IgG, DGP 

IgA and DGP IgG antibodies ranged from 66.7% to 100%, from 44.4% 

to 62.7%, from 50.0% to 66.7% and from 66.7% to 95.6%, for the above mentioned 

assays in the three separate age groups. Specificity values ranged from 96.6% to 100% 

and from 94.6% to 100% for tTG IgA and DGP IgG, and were 100% in each age group 

for tTG IgG and DGP IgA, respectively. Diagnostic sensitivity in the total pediatric 

population was 96.0%, 58.5%, 63.5% and 88.9% for tTG IgA, tTG 

IgG, DGP IgA and DGP IgG antibodies. Specificity was 97.3 and 96.4% for tTG 

IgA and DGP IgG, and 100% for tTG IgG and DGP IgA assays, respectively. In 

comparison, the sensitivity values were 94.3%, 43.9%, 77.4% and 89.4 % for the four 

assays in the adult population, and specificity was 98.7% for the tTG IgA, tTG IgG, 

and DGP IgG assays, and 99.6% for the DGP IgA assay. 

Conclusion: 

Diagnosis of celiac disease in children is critical, but the performance of serological 

assays in this population is often suboptimal. The new QUANTA Flash assays for the 

diagnosis of CD have similar, and in some cases better diagnostic performance in the 

pediatric population as that seen in the adult population. 

B-288 

Development of an Immunoassay for Alpha-Fetoprotein (AFP) for the 

ARCHITECT® i2000 and i2000SR Analyzers 

S. Moore 1 , D. O’Donnell 1 , S. Sullivan 1 , W. Castellani 2 , J. Straseski 3 , 

F. Apple 4 , M. Petruso 5 , J. Yen 1 , S. Du 1 , B. Renley 1 , M. Paradowski 1 . 

1 

Abbott, Abbott Park, IL, 2 Hershey Medical Center, Hershey, PA, 3 ARUP 

Laboratories, Salt Lake City, UT, 4 Hennepin County Medical Center and 

Minneapolis Medical Research Foundation, Minneapolis, MN, 5 Nationwide 

Laboratory Services, Fort Lauderdale, FL 

Introduction: An automated assay for the quantitative detection of AFP in human 

serum, plasma and amniotic fluid, with a measuring interval up to 2000ng/mL, has 

been developed for the US on the Abbott ARCHITECT i2000, i2000SR and i1000SR 

systems. The ARCHITECT AFP assay is based on paramagnetic microparticle 

chemiluminescent technology and uses the CHEMIFLEX ® technology allowing for 

excellent precision, sensitivity, and accuracy. The assay is intended for use in prenatal 

testing to aid in the detection of open neural tube defects (NTD) and in monitoring 

disease progression during the course of disease and treatment of patients with 

nonseminomatous testicular cancer. Note: This assay is not currently approved in the 

US for use on the ARCHITECT i1000SR system. 

Methods: The purpose of this study was to evaluate the clinical and analytical 

performance of the ARCHITECT AFP assay. Clinical evaluation included total 

imprecision, determination of expected values, and sensitivity and specificity for 

open NTD. For analytical evaluation, limit of detection (LoD), limit of quantitation 

(LoQ), linearity, recovery of the WHO 1 st international standard 72/225, interference 

from potential substances, and correlation to the currently marketed FDA approved 

AxSYM AFP assay were assessed. 

Results: The within-laboratory (total) imprecision (%CV) across three clinical testing 

sites for the ARCHITECT AFP assay ranged from 3.8 to 5.4 %CV. Clinical sensitivity 

across calculated MoM values for open NTD was between 95.45% and 99.71% for 

maternal serum and 98.65% and 99.55% for amniotic fluid. Clinical specificity across 

calculated MoM values for open NTD was between 71.43% and 95.24% for maternal 

serum and 94.74% and 100% for amniotic fluid. The observed LoD was 0.04 ng/mL 

and the observed LoQ was 0.5 ng/mL. The AFP assay demonstrated linearity from 

0.91 ng/mL to 2487.76 ng/mL. For serum specimens, the mean percent recovery of 

WHO was 103.1% (range 99.5% to 108.6%) and for amniotic fluid specimens, the 

mean percent recovery was 101.2% (range 95.1% to 107.3%). Interference was less 

than 10% for those tested. Method comparison with the Abbott AxSYM AFP, using 

the Deming Regression method, had a correlation coefficient of 0.998 and a slope of 

0.92. 

Conclusion: These results demonstrate that the ARCHITECT AFP assay offers 

a sensitive, precise, and accurate assay (as demonstrated by linearity and WHO 

recovery) with good clinical sensitivity and specificity for open NTD. Running the 

assay on the ARCHITECT platform allows for the benefits of rapid results and highthroughput 

automation as a diagnostic tool for the detection of AFP. 


B-289 

Complex biological pattern of fertility hormones in children and 

adolescents: A study of healthy children from the CALIPER cohort 

and establishment of pediatric reference intervals 

J. L. Shea 1 , D. Konforte 2 , L. Kyriakopoulou 3 , D. Colantonio 3 , A. Cohen 1 , 

J. Shaw 4 , D. Bailey 1 , M. Chan 3 , D. Armbruster 5 , K. Adeli 3 . 1 University of 

Toronto, Toronto, ON, Canada, 2 LifeLabs, Toronto, ON, Canada, 3 Hospital 

for Sick Children, Toronto, ON, Canada, 4 The Ottawa Hospital, Ottawa, 

ON, Canada, 5 Abbott Diagnostics, Chicago, IL 

Background: Pediatric endocrinopathies are commonly diagnosed and monitored 

by measuring hormones of the hypothalamic-pituitary-gonadal axis. As growth 

and development can markedly influence normal circulating concentrations of 

fertility hormones, accurate reference intervals established based on a healthy, nonhospitalized 

pediatric population and that reflect age-, gender-, and pubertal stagespecific 

changes are essential for test result interpretation. 

Methods: Healthy children and adolescents (n = 1234) were recruited from a multiethnic 

population as part of the CALIPER Study. After written, informed parental 

consent was obtained, participants filled out a questionnaire including demographic 

and pubertal development information (assessed by self-reported Tanner stage) 

and provided a blood sample. Measurement of seven fertility hormones including 

estradiol, testosterone (2nd generation), progesterone, SHBG, prolactin, FSH, and LH 

was performed on the Abbott ARCHITECT i2000 analyzer. These data were then used 

to calculate age-, gender-, and Tanner stage-specific reference intervals according to 

CLSI C28-A3 guidelines. 

Results: We observed a complex pattern of change in each analyte concentration from 

the neonatal period to adolescence. Consequently, many age and gender partitions 

were required to cover the changes in most fertility hormones over this period. An 

exception to this was prolactin, for which no gender partition and only three age 

partitions were necessary. 

Conclusions: This comprehensive database of pediatric reference intervals for fertility 

hormones will be of global benefit and should lead to improved diagnosis of pediatric 

endocrinopathies. The new database will need to be validated in local populations and 

for other immunoassay platforms as recommended by CLSI. 

B-290 

Marked Biological Variance in Endocrine and Biochemical Markers 

in Childhood: Establishment of Pediatric Reference Intervals using 

Healthy Community Children from the CALIPER Cohort 

D. Colantonio 1 , D. Bailey 1 , L. Kyriakopoulou 1 , A. Cohen 1 , M. Chan 1 , D. 

Armbruster 2 , K. Adeli 1 . 1 The Hospital for Sick Children, Toronto, ON, 

Canada, 2 Abbott Diagnostics, Chicago, IL 

Background: Reference intervals are indispensable in evaluating laboratory test 

results yet appropriately partitioned pediatric reference values are not readily 

available. The CALIPER program is aimed at establishing the influence of age, 

gender, ethnicity, and BMI on biochemical markers and developing a comprehensive 

database of pediatric reference intervals using an a posteriori approach. 

Methods: A total of 1482 samples were collected from ethnically diverse healthy 

children aged two days to 18 years and analyzed on the Abbott Architect i2000. 

Following the CLSI C28-A3 guidelines, age- and sex-specific partitioning was 

determined for each analyte. Non-parametric and robust methods were used to 

establish the 2.5th and 97.5th percentiles for the reference intervals as well as the 90% 

confidence intervals. 

Results: New pediatric reference intervals were generated for 15 biomarkers 

including alpha-fetoprotein, cobalamin (vitamin B12), folate, homocysteine, ferritin, 

cortisol, insulin, troponin I, 25(OH)D, intact PTH, TSH, total T4, total T3, free T4, 

and free T3. The influence of ethnicity and body-mass index percentile (BMIP) on 

reference values was also examined showing a significant BMIP effect for insulin 

and statistically significant ethnic differences for FT4, TT3, TT4, cobalamin, ferritin, 

iPTH, and 25(OH)D. 

Conclusions: This study establishes comprehensive pediatric reference intervals 

for a number of common endocrine and special chemistry biomarkers obtained in a 

large cohort of healthy children. The new database will be of global benefit ensuring 

appropriate interpretation of pediatric disease biomarkers, but would need to be 

further validated for specific immunoassay platforms and in local populations as 

recommended by CLSI. 




B-291 

Clinical Impact of the BuBc Slide Recalibration by Ortho Clinical 

Diagnostics 

A. M. Ferguson, T. Nguyen, U. Garg. Children’s Mercy Hospitals and 

Clinics, Kansas Ctiy, MO 

Introduction: Ortho Clinical Diagnostics’ method of measuring bilirubin is unique 

when compared to other commonly used methods. The difference between the 

methods is the way different bilirubin fractions are measured or calculated. Total 

bilirubin is measured with the TBIL slide that measures both conjugated (including 

bilirubin covalently bound to albumin called delta bilirubin) and unconjugated 

bilirubin species. Most other methods calculate the concentration of unconjugated 

bilirubin by subtracting the direct reacting fraction containing the conjugated species 

from the total value of bilirubin. Ortho platforms use a separate slide, BuBc, that 

directly measures both conjugated (excluding delta bilirubin) and unconjugated 

fractions. Another advantage of the BuBc slide is that it has an ultrafiltration layer that 

excludes large molecules, such as hemoglobin, which minimizes the interference from 

hemolysis. The ultrafiltration layer also excludes albumin, which is why the BuBc 

slide does not measure delta bilirubin, but it allows the calculation of delta bilirubin 

(TBIL-BuBc). In May of 2012, Ortho notified customers that due to complaints 

about a positive bias in proficiency testing results, there would be an adjustment in 

the calibrator values for the BuBc slides. There was no accompanying change to the 

TBIL slides. 

Objective: To describe the clinical impact the recalibration of the BuBc slides had 

on a pediatric hospital. 

Results and Conclusions: Since bilirubin concentrations can be measured using both 

the TBIL and BuBc slides, there are different options for how values are reported. To 

match with other bilirubin methods, our institution reported the total bilirubin value 

from the TBIL slide, the unconjugated bilirubin value from the BuBc slide, and a 

calculated conjugated value derived from subtracting the unconjugated value from the 

total. This allows any delta bilirubin that may be present in the patient to be accounted 

for in the conjugated value. After the recalibration of the BuBc slides, we began 

receiving calls from clinicians stating that they were seeing an increase in patients, 

especially neonates, with elevated conjugated bilirubins that necessitated consults 

with gastrointestinal specialists to rule out conditions such as biliary atresia. The 

week prior to the recalibration, 3.8% of conjugated bilirubin results were elevated, 

but the week after recalibration, the rate increased to 35%. It was determined that 

these calculated values were falsely elevated due to the lowering of the values from 

the BuBc slide with no change in the values reported from the TBIL slide. During 

our investigation and consultation with Ortho Diagnostics, the laboratory began to 

report out all measured values from the two slides. The new reporting strategy led 

to concerns from our hepatology team, since delta bilirubin was no longer included 

with the conjugated bilirubin value, and this complicated the interpretation of longstanding 

patient values. Working together with both the neonatologists and the 

gastroenterologists, the laboratory devised a new reporting scheme for bilirubin 

results based on the age of the patient. We have also continued to share data with 

Ortho Diagnostics to determine if the recalibrated BuBc slides had been adjusted too 

much. 

B-292 

Analysis of urinary succinylacetone by UPLC-MS/MS for monitoring 

of patients with tyrosinemia type I. 

A. Liu 1 , M. Alston 2 , R. Guymon 2 , N. Longo 3 , M. Pasquali 3 . 1 ARUP Instute 

for Clinical and Experimental Pathology, Salt Lake City, UT, 2 ARUP 

Laboratories, Salt Lake City, UT, 3 University of Utah Health Sciences 

Center, Salt Lake City, UT 

Background: Tyrosinemia Type I (Tyr-I) is an autosomal recessive disorder 

caused by deficiency of fumarylacetoacetate hydrolase in the catabolic pathway 

of tyrosine. Patients present with progressive liver diseases, neurological crises, 

and hypophosphatemic rickets. Untreated patients with Tyr-I excrete large amount 

of succinylacetoacetate (SAA), succinylacetone (SUAC), and 5-aminolevulinic 

acid (5-ALA). Nitisinone (NTBC) therapy prevents formation of succinylacetone 

and dramatically improves liver and kidney functions. Long term therapy requires 

monitoring of SUAC and 5-ALA in addition to plasma amino acids. This assay is 

designed for accurate measurement of low concentrations of SUAC and 5-ALA in 

urine to evaluate compliance and efficacy of therapy. 

Method: Total SUAC (SAA + SUAC) and 5-ALA were measured by external 

calibration using stable isotope labeled SUAC as internal standard with Ultra 

Performance Liquid Chromatography (UPLC) separation and tandem mass 

spectrometry MS/MS detection. The sample preparation included high temperature 

incubation with hydrazine solution in acidic condition to convert both SAA and SUAC 

into SUAC hydrazone and subsequent butylation to form SUAC hydrazone and 

5-ALA butyl esters. The analytes were separated by reverse phase chromatography 

and detected by tandem mass spectrometry. The assay was performed on Acquity 

UPLC / Xevo TQ system. 

Results: This assay is linear from 0.010 to 100 mmol/mole creatinine for both, SUAC 

and 5-ALA. The SUAC signal to noise ratio at the limit of detection, 0.005 mmol/ 

mole creatinine, was greater than 10. The within run and between run imprecision was 

evaluated at 5 different concentrations for each analyte within the respective linear 

range, and was less than 5.0% for SUAC and less than 8.7% for 5-ALA, except at the 

sensitivity limit where it was less than 9.5%. With this assay, we have measured the 

excretion of total succinylacetone in normal controls 0-17 years of age and in patients 

with Tyr-I before and after therapy with NTBC. The normal range for SUAC was < 

0.30 mmol/mol creatinine. Patients with Tyr-I had a markedly increased excretion of 

total SUAC, which rapidly returned to normal level with initiation of NTBC therapy. 

Conclusion: This method is suitable for monitoring 5-ALA and SUAC levels in 

patients with Tyr-I. 

B-293 

Stability Testing of a Noninvasive Prenatal Test (NIPT) in a Clinical 

Setting - the MaterniT21 PLUS Laboratory-Developed Test 

R. C. Tim 1 , J. A. Tynan 2 , T. J. Jensen 1 , L. Cagasan 1 , V. Lu 1 , L. Liu 1 , S. 

Sovath 1 , M. Riviere 1 , P. Oeth 1 , M. Ehrich 2 . 1 Sequenom Center for Molecular 

Medicine, San Diego, CA, 2 Sequenom, Inc., San Diego, CA 

Background: Excellent clinical performance of a noninvasive test for fetal 

aneuploidies using next-generation sequencing has been demonstrated by several 

laboratories. This study demonstrates the robustness of the processes involved 

in one such assay, the MaterniT21 PLUS laboratory-developed test, focusing on 

reproducibility and stability of the results. 

Methods: The study was divided into two portions to determine the robustness 

of the MaterniT21 PLUS test. The first was designed to measure repeatability and 

reproducibility of chromosomal representation in a pool of plasma DNA isolated 

from women at increased risk for fetal aneuploidy with a known euploid fetus as 

determined by fetal karyotyping. For these experiments, plasma DNA obtained from 

1000 women was combined and used to prepare over 1000 libraries. These libraries 

were sequenced and analyzed for variability of chromosomal representation. The 

second portion of the study was designed to investigate the stability of the post-PCR 

workflow processes. For this part of the study, a set of libraries was generated for 

use throughout the entire series of experiments, comprised of 44 known euploid and 

44 known trisomy 21 samples. For each experimental subset, all factors were kept 

constant, including operator, reagent lots, and instruments, except for the particular 

variable of interest. All flow cells from both portions of the study were clustered on 

the Illumina cBOT in 12-plex and sequenced on the HiSeq® 2000 (Illumina®, San 

Diego, California). Sequencing reads were de-multiplexed, aligned to the human 

genome with Bowtie2 and chromosomal representations were determined. 

Results: Results demonstrate that while library concentrations and raw aligned counts 

may be variable from plate to plate, chromosomal representation is remarkably stable 

for the pooled maternal plasma DNA samples processed by multiple operators, across 

library batches, and measured on multiple sequencing instruments. One-way ANOVA 

p-values were found to be 0.37, 0.69 and 0.16 across operators, library batches and 

sequencers, respectively. From the second part of this study, no significant differences 

in classification z-score values were found across flow cells as a function of library 

storage time, flow cell storage time, reagent lot, or sequencing instrument. One-way 

ANOVA p-values were 0.44, 0.38, 0.89 and 0.87 for library storage time, flow cell 

storage time, reagent lot and sequencer, respectively. Both sensitivity and specificity 

for each of these experimental subsets were determined to be nearly 100%. 

Conclusion: This study demonstrates the stability for use of the MaterniT21 PLUS 

test across operators and instruments and reveals the low variability for discrete 

process steps of the assay. 


A259



B-294 

Serum Total Calcium Concentrations in the Vitamin D-replete 

Pediatric Population 

J. D. Roizen 1 , M. A. Levine 1 , V. Shah 2 , D. C. Carlow 2 . 1 Children’s Hospital 

of Philadelphia, Division of Endocrinology and Diabetes, Philadelphia, 

PA, 2 Children’s Hospital of Philadelphia, Department of Pathology and 

Laboratory Medicine, Philadelphia, PA, 

Introduction: Widespread vitamin D insufficiency in pediatric and adult populations 

raises doubts about the credibility of current reference values for serum calcium, 

which have been determined using uncharacterized “normal subjects.” 

Objective: We therefore sought to determine age-adjusted normal ranges for serum 

total calcium concentrations in pediatric subjects with normal (20 – 80 ng/mL) serum 

levels of 25(OH)D. 

Methods: We reviewed clinical and laboratory data of inpatient and outpatients 

subjects (n = 5868) ranging from full term newborns to greater than 19 years who 

had a serum levels of total calcium and 25(OH)D measured in the CHOP clinical 

chemistry lab. Serum calcium was measured using a colorimetric assay (VITROS 5, 1 

FS automated chemistry system) and serum total 25(OH)D was determined by LS/MS/ 

MS (analytical sensitivity of 4 ng/mL for 25(OH)D 2 

and 25(OH)D 3 

). After excluding 

patients with renal or endocrine disease or who had been managed in the endocrine 

clinic or a critical care unit, we ascertained 4628 subjects who had serum 25(OH)D 

levels that were 20-80 ng/mL within 30 days of their serum calcium measurement. We 

used EP Evaluator v9 software (Data Innovations, Inc) in accordance with National 

Committee for Clinical Laboratory Standards (NCCLS) guidelines to analyze the data. 

Results: Parametric analysis generated age-specific reference intervals for serum total 

calcium: 0-90 day-old infants (7.8-11.3 mg/dL); 91-180 day old infants (8.8-11.2 mg/ 

dL), 181-365 day old children (8.8-11.4 mg/dL), 1-3 year old children (8.8-11.1 mg/ 

dL), 4-11 year old children (8.8-10.7 mg/dL), 12-19 year old children (8.5-10.6 mg/ 

dL), patients under 19 years of age (8.6-10.9 mg/dL) and patients greater than 19 

years old (8.6-10.9 mg/dL). Non-parametric analyses yielded ranges that were within 

5% of the values obtained by parametric analyses. Two-way ANOVA with Tukey’s 

correction for multiple post-tests showed significant differences between the lower 

limits of normal (p



B-297 

A Novel Rapid and Flexible Blood Lead Testing System: Evaluation 

Versus the Reference Method 

R. Morse, R. Feeney, M. West. Magellan Diagnostics, North Billerica, MA 

Background: According to the CDC and the WHO, approximately 500,000 US 

children have elevated blood lead levels and 120 million people are exposed 

worldwide, the vast majority in developing countries. Because most individuals have 

no overt clinical symptoms, the only way to determine exposure is through a blood 

lead test. We evaluated the performance of the LeadCare ® Ultra System, a new 

blood lead testing system designed for use in the clinical laboratory.* 

Methods: The accuracy of LeadCare Ultra was determined by a method comparison 

study conducted over five days at two hospital laboratory sites, each of which analyzed 

100 whole blood samples with both LeadCare Ultra and GFAAS. The precision of 

the LeadCare Ultra System was determined by testing samples at four concentration 

levels over twenty days. 

Results: The method comparison study produced a regression of y = 0.970x + 0.813, 

R 2 = 0.993. Table 1 summarizes the precision of the LeadCare Ultra system at 4 

clinical decision points. 

Table 1: Precision of LeadCare Ultra 

Conc. Total SD (ug/dL) Within Run SD (ug/dL) 

5 ug/dL 0.81 0.65 

10 ug/dL 0.90 0.79 

25 ug/dL 1.43 1.20 

45 ug/dL 1.62 1.55 

Conclusion: The LeadCare Ultra System is designed to be a quantitative blood 

lead testing system, clinically equivalent to GFAAS. According to the results of this 

study, the system met these specifications.*At the time of abstract submission, this 

system is under review and pending 510(k) clearance from the US Food and Drug 

Administration. 

B-299 

Effect of nephrotoxic drug and pathologies of preterm infants on 

cystatin C values at birth 

C. Bermudo Guitarte, J. Garcia de Veas Silva, S. Caparrós Cánovas, L. 

Bardallo Cruzado, E. Perez González, V. Perna Rodriguez, P. Menéndez 

Valladares, C. Gonzalez Rodriguez. HOSPITAL UNIVERSITARIO 

VIRGEN MACARENA, SEVILLE, Spain 

Background: Cystatin C (Cys) is a single chain unglycosylated basic protein of low 

molecular weight (13.360 kD) with 120 aminoacids and two disulfide bridges. Cys is 

produced at a constant rate in all nucleated cells and less influenced by muscle mass, 

gender or age than creatinine (Cr) so this protein is a good marker of renal function 

in newborn infants. 

Objectives: the objetives of the present study are two: 

1.To measure Cystatin C values in preterm infants (PI) in the first week of life (birth, 

48-72 hours and a 7 days of life) 

2.To determine if the values of Cystatin C are affected by pathologies of preterm 

infants and nephrotoxic drugs (antibiotics, antifungals and ibuprofen) 

Methods: Blood samples of 110 children were collected at birth (from umbilical 

cord), at 48-72 hours of life and seven days of life. The period of study was two 

years. Cys was measured by nephelometry (BNII Siemens) and Cr by photometry. 

The variables studied were weight, respiratory disease, nephrotoxic drugs and 

hypotensive/normotensive status. Data were expressed as mean ± standard errors. The 

statistical analysis was performed with the IBM SPSS Statistics 20 using Chi-square 

test and one way repeated measures ANOVA with a statistical significance of p1500 g (N=73) 1,63±0,48 1,46±0,58 1,56±0,52 

Preterm with respiratory disease (N=46) 1,49±0,25 1,25±0,24 1,43±0,33 

Preterm without respiratory disease (N=62) 1,63±0,51 1,54±0,60 1,62±0,55 

Preterm with nephrotoxic treatment (N=74) 1,54±0,48 1,38±0,56 1,55±0,57 

Preterm without nephrotoxic treatment (N=34) 1,63±0,27 1,48±0,34 1,51±0,19 

Hypotensive preterm (N=12) 1,42±0,33 1,14±0,15 1,35±0,30 

Normotensive preterm (N=96) 1,59±0,44 1,45±0,52 1,56±0,49 

B-300 

Amniotic fluid glucose provides superior sensitivity in identifying 

subclinical intra-amniotic infection compared with gram stain and 

bacterial culture 

J. W. Meeusen, L. J. Ouverson, N. A. Baumann, D. R. Block. Mayo Clinic, 

Rochester, MN 

Background: Intra-amniotic infection (IAI) can be a life-threatening complication 

and is estimated to occur in as many as 13% of all pregnancies. Patients present 

with uterine tenderness, fever, leukocytosis, and tachycardia (maternal or fetal) 

often in the context of pre-term labor necessitating a rapid decision on whether 

to proceed with delivery to prevent sepsis at the cost of increased fetal morbidity/ 

mortality. Amniocentesis is performed to identify infection within the maternal-fetal 

compartment. Bacterial culture of amniotic fluid is the gold standard for diagnosing 

IAI, however, glucose is often used as a surrogate with initiation of treatment if the 

glucose concentration is low (



B-301 

Increased Pregnancy Associated Plasma Protein A (PAPP-A) and 

free beta-human chorionic gonadotrophin (Fb-hCG) values due to 

sample transportation. Impact on calculated risk for chromosomal 


A. Haliassos 1 , C. Tsafaras 1 , M. Rizou 1 , K. Makris 2 , D. Rizos 3 . 1 Diamedica 

SA, Athens, Greece, 2 Clinical Biochemistry Department, KAT General 

Hospital, Kifissia, Greece, 3 Hormone Laboratory, 2nd Dept of Obstetrics 

& Gynecology, Medical School University of Athens, Aretaieion Hospital, 

Athens, Greece 

Pregnancy-associated plasma protein-A (PAPP-A) and free beta-subunit of human 

chorionic gonadotrophin (Fb-hCG) are the two established biochemical markers that 

are used, along with the ultrasound marker nuchal translucency, in the routine prenatal 

screening for chromosomal abnormalities in the first trimester of pregnancy. For 

practical and economical reasons, samples (separated sera) for these measurements 

very often travel long distances between the sampling points (specialized prenatal 

screening centers, small clinics and laboratories) and core laboratories, sometimes 

exposed at high temperatures. 

The aim of our study was to evaluate the preanalytical influence of sample stay at 

room temperatures (modeling real transport conditions) on PAPP-A and Fb-hCG 

concentrations and the possible impact on the calculated risk for chromosomal 


We evaluated 31 serum samples measured on Kryptor (Brahms Gmbh, Berlin- 

Germany) or Elecsys (Roche Diagnostics Gmbh, Mannheim-Germany) analyzers. We 

measured the PAPP-A and Fb-hCG concentration of the samples just after sampling 

(0h), 24 and 48 hours later, keeping the samples at room temperature (20-22 o C i.e. 

68-72 o F) and in the freezer (-20 o C i.e. -4 o F) as reference. In 10 of the samples we also 

calculated the risk for trisomy-21 with an in-house software, using the markers’ values 

at 0, 24 and 48 hours. 

Our results are presented in the following Table: 

Percent (%) Increase (median-range) 

Duration/analyzer Fb-hCG PAPP-A 

24h / Kryptor 

13.5% (2.8 - 17.7) 

10.2% (4.6-19.3) 

24h / Elecsys 

6.2% (-1.2 - 23.0) 

7.8% (2.9-15.3) 

Total 24h 10.0% (-1.2 - 23.0) 10.0% (2.9 -19.3) 

48h / Kryptor 

29.5% (17.4 - 44.8) 20.8% (10.6 - 35.7) 

48h / Elecsys 

15.6% (2.0 - 40.8) 

13.3% (6.1 - 31.4) 

Total 48 h 25.2% (2.0 - 44.8) 20.2% (6.1 - 35.7) 

We observed a median increase of 10% for both Fb-hCG and PAPP-A at 24h and 25.2% 

for Fb-hCG and 20.2% increase for PAPP-A at 48h, but not for the freezed samples 

(PAPP-A: +1,25% and FbhCG: +1,68%). Measurements with Kryptor showed higher 

increases for both markers at 24h and 48h. The increase was statistically significant 

for Fb-hCG. The increase was also independent of the initial concentration for both 

markers. 

The calculated risk for trisomy-21 remained practically unchanged at 0, 24 and 48 

hours, probably due to the opposite effects that the increase of PAPP-A and Fb-hCG 

has on the risk magnitude. 

B-302 

Evaluation of cardiac markers in children undergoing hematopoietic 

stem cell transplant 

G. Ozturk 1 , B. Tavil 2 , M. Ozguner 3 , Z. Ginis 1 , G. Erden 1 , B. Tunc 4 , F. Azik 4 , 

D. Uckan 2 , N. Delibas 1 . 1 Diskapi Yildirim Beyazit Education and Research 

Hospital,Department of Clinical Biochemistry, Ankara, Turkey, 2 Hacettepe 

University,Faculty of Medicine, Department of Pediatric Hematology, 

Ankara, Turkey, 3 Ankara Children’s Hematology and Oncology Hospital, 

Ankara, Turkey, 4 Ankara Children’s Hematology and Oncology Hospital, 

Department of Pediatric Hematology, Ankara, Turkey 

Background: Hematopoietic stem cell transplantation (HSCT) is presently the 

only proven curative treatment choice for defined malignant and non-malignant 

haematological disorders, solid tumors, and autoimmune disorders in children. It is a 

complex therapeutic procedure involving administration of high-dose chemotherapy, 

immunosuppressive therapy, and/or radiotherapy, followed by intravenous infusion 

of hematopoietic stem cells to re-establish marrow function. The main drawbacks 

of HSCT are early transplant-related mortality and late complications, which 

interfere with patient outcome, health status and quality of life. Early life-threatening 

cardiotoxicity and cardiac death have been reported after HSCT. The aim of the 

current study was to evaluate cardiac toxicity of conventional chemotherapy followed 

by HSCT with cardiac markers: heart-type fatty acid binding protein (H-FABP), 

glycogen phosphorylase BB (GPBB),high sensitive C reactive protein (hsCRP) 

cardiac troponin I, (cTnI), creatine kinase MB (CK-MB mass) and myoglobin. 

Methods: A total of 20 children(6 girls and 14 boys) who underwent HSCT for 

malignant (n:12, 60%) and non-malignant diseases (n:8, 40%) between the ages of 

1-20 years at Ankara Children’s Hematology and Oncology Hospital. All children 

included in this study had completed their 100 days after transplantation. Blood 

samples were collected from all patients in 0.,7. and 21.day for evaluating H-FABP, 

GPBB, hsCRP , cTnI, CK-MB mass and myoglobin. Measurements of H-FABP( 

Hycult biotech, Netherlands), GPBB (Cusabio biotech, China) and hsCRP (DRG 

International Inc.,USA) were performed using the commercially available enzymelinked 

immunosorbent assay (ELISA) kit in accordance with the manufactures’ 

instructions. CK-MB mass, Troponin I and myoglobin were analyzed by using an 

automated immunoassay method (ADVIA Centaur CP System Siemens Healthcare 

Diagnostics Inc.,USA ). The patients’ echocardiography was assessed before and after 

one-month of HSCT. 

Results: 21.day serum HFABP level was significantly higher when compared with 

the 0. day HFABP level (p



B-305 

Maternal serum Matrix MetaloProteinase-9 levels in pregnancies 

complicated with pre-eclampsia or had small for gestational age 

infants. 

G. Karampas 1 , M. Rizou 2 , A. Haliassos 2 , M. Eleftheriades 3 , D. Hassiakos 4 , C. 

Panoulis 4 , N. Vitoratos 4 , D. Rizos 5 . 1 Obstetrics & Gynecology Department, 

“Konstantopoulio” General Hospital, N. Ionia, Greece, 2 Diamedica SA, 

Athens, Greece, 3 Embryo Care, Fetal Medicine Unit, Athens, Greece, 4 2nd 

Dept of Obstetrics & Gynecology, Medical School, University of Athens, 

Aretaieio Hospital, Athens, Greece, 5 Hormone Laboratory, 2nd Dept of 

Obstetrics & Gynecology, Medical School, University of Athens, Aretaieio 

Hospital, Athens, Greece 

Matrix metalloproteinase 9 (MMP-9) belongs to the Matrix Metalloproteinases 

(MMPs) family which can be produced by numerous cell types. MMPs have the 

ability to break down several proteins of the extracellular matrix and they actively 

participate in remodeling the extracellular matrix by degrading important matrix 

scaffold macromolecules. Injuries and pregnancy can elevate their protein deposition. 

In several studies maternal serum MMP-9 levels have been reported elevated in preeclampsia 

(PE) compared to normal pregnancies. On the contrary, there are fewer 

studies on MMP-9 in pregnancies that had a small for gestational age infant (SGA). 

In our study we examined 32 normal pregnancies, 12 pregnancies that developed PE 

and 15 pregnancies that had SGA infant (defined by birth weight



RDS, using clinical, laboratory and radiographic findings. Using these data, logistic 

regression (Stata Corp, College Station, TX) was used to predict the risk of RDS at 

each week of gestation based upon the LBC. 

Results: 357 patients were included in the analysis. The mean GA at time of sample 

was 36 6/7 weeks gestation (SD 2.0). The median time between sample collection 

and delivery was 1 day (IQR 1-6). 31.4% of patients had preexisting or gestational 

diabetes, 10.6% had polyhydramnios and 62.2% were born via cesarean section. 

There were 18 cases (5%) of RDS. The predicted risk of RDS based upon LBC for 

GA is summarized in Table 1. 

Conclusion: Gestational age-specific predicted risk of RDS using LBC provides a 

statistical model which can aid clinicians in individually counseling patients regarding 

the absolute risk of their newborn developing RDS. This information will be especially 

useful for those whose laboratories utilize the Advia 120 for the measurement of LBC. 

Table 1: Predicted Risk of RDS based on Lamellar Body Count(LBC) and Gestational Age 

LBC (counts/uL) 30 wks 32 wks 33 wks 34 wks 35 wks 36 wks 37 wks 38 wks 40 wks 

10000-14999 56.3% 36.7% 28.0% 20.6% 14.8% 10.5% 7.3% 5.0% 2.3% 

15000-19999 51.4% 32.2% 24.1% 17.6% 12.5% 8.7% 6.0% 4.1% 1.9% 

20000-24999 46.5% 28.1% 20.7% 14.9% 10.5% 7.3% 5.0% 3.4% 1.5% 

25000-29999 41.6% 24.2% 17.7% 12.6% 8.8% 6.1% 4.2% 2.8% 1.2% 

30000-34999 36.9% 20.8% 15.0% 10.6% 7.3% 5.0% 3.4% 2.3% 1.0% 

35000-39999 32.4% 17.7% 12.6% 8.8% 6.1% 4.2% 2.8% 1.9% 0.8% 

40000-44999 28.3% 15.0% 10.6% 7.4% 5.1% 3.4% 2.3% 1.6% 0.7% 

45000-49999 24.4% 12.7% 8.9% 6.1% 4.2% 2.8% 1.9% 1.3% 0.5% 

50000-54999 21.0% 10.6% 7.4% 5.1% 3.5% 2.4% 1.6% 1.1% 0.4% 

55000-59999 17.9% 8.9% 6.2% 4.2% 2.9% 1.9% 1.3% 0.9% 0.4% 

60000-64999 15.2% 7.4% 5.1% 3.5% 2.4% 1.6% 1.1% 0.7% 0.3% 

65000-69999 12.8% 6.2% 4.2% 2.9% 1.9% 1.3% 0.9% 0.6% 0.2% 

70000-74999 10.7% 5.1% 3.5% 2.4% 1.6% 1.1% 0.7% 0.5% 0.2% 

>75000 9.0% 4.2% 2.9% 2.0% 1.3% 0.9% 0.6% 0.4% 0.1% 

B-309 

Sweating the small stuff: Determinants of adequacy and accuracy in 

sweat chloride determination 

M. L. DeMarco, D. J. Dietzen, S. M. Brown. Washington University, St 

Louis, MO 

Background: Sweat chloride testing is the primary diagnostic test for cystic fibrosis 

(CF) and recently its role has expanded to include monitoring the therapeutic response 

to CFTR modulating drugs. The minimum sweat rate currently required for valid 

chloride analysis is 75 mg over 30 minutes following pilocarpine iontophoresis. 

Neonatal patients frequently do not generate adequate sweat for testing. Our objectives 

were to: 1) describe variables that determine sweat rate; 2) determine the analytic and 

diagnostic capacity of sweat chloride analysis across the range of observed sweat 

rates; and 3) determine the biologic variability of sweat chloride concentration in our 

predominantly pediatric population. 

Methods: Sweat was collected on gauze and chloride determined using a 

Biodynamics LyteTek titrator. A retrospective analysis was performed using data from 

all sweat chloride tests performed at St. Louis Children’s Hospital over a 21-month 

period (January, 2011 to September, 2012). A total of 1398 sweat chloride tests (1155 

sufficient, 243 QNS based on the 75 mg cutoff), were performed on 904 individuals. 

Variables included in the data analysis were: (1) age, (2) sweat site (arm v. leg), (3) 

patient location (outpatient v. inpatient), (4) sweat weight, (5) sweat chloride result, 

and (6) genetic testing for CF. Functional sensitivity of chloride determination was 

evaluated by adding known amounts of NaCl in solution (0.1, 1, 2, 3, and 4 μmoles of 

chloride) to gauze and testing in duplicate for 5 consecutive days. 

Results: Of the 1398 sweat collections, 243 (17.4%) were < 75 mg. Eleven percent of 

patient encounters resulted in no valid sweat collection. The sweat weight collected 

from arms was statistically greater than that collected from legs (P 75 mg was 13.1% (95% CI: 11.3-14.9%; range 

0-88%) yielding a reference change value of 36%. There were 69 patients with 

independent sweat collections considered sufficient or insufficient using the 75 mg 

collection requirement. Among these 69 patients there were 89 sufficient and 95 

insufficient collections. Using 60 mM as the diagnostic chloride cutoff and employing 

a sweat weight requirement of only 20 mg, there were no discrepancies in qualitative 

diagnostic classification. 

Conclusions: 1) Collection of sweat from arms is preferable to legs, particularly 

in very young infants in whom sweat collection is often difficult; 2) sweat chloride 

concentrations are not highly dependent upon sweat rate; 3) a change in sweat chloride 

concentration exceeding 36% may be considered a clinically significant response to 

CFTR targeted therapy, and 4) sweat collections of less than 75 mg may provide 

clinically relevant information despite current recommendations. 

B-310 

Reference interval of metabolic analytes from healthy Brazilian 

children and adolescents from Cuiabá, Mato Grosso, Brazil 

N. Slhessarenko 1 , A. Andriolo 2 , R. Azevedo 3 , C. Pereira 4 , G. Novak 5 , A. 

Vieira 5 , C. Jacob 2 . 1 DASA, Cuiabá, Brazil, 2 Universidade Federal de São 

Paulo, São Paulo, Brazil, 3 USP, São Paulo, Brazil, 4 DASA, São Paulo, 

Brazil, 5 Universidade Federal de Mato Grosso, Cuiabá, Brazil 

Background: The definition of Reference Intervals (RIs) of biological analytes 

in paediatric patients is a hard task, mainly by the definition of RIs interval and 

difficulties of blood collection in healthy children. In Brazil, the RIs commonly used 

are poorly defined and not uniformly determined. Moreover, due to the peculiarities 

of Brazilian population, probably the analytes values should be different from those of 

other countries, point out the necessity to determine them for this specific population. 

Objective: The aim of this study was to determine the RI of some metabolic analytes 

(glucose, total cholesterol and fractions, triglycerides, serum insulin and vitamin D) 

of healthy children and adolescents from Cuiabá, Brazil. 

Method: The sample was composed by healthy participants aged from 1y to 12 y 11 

m and 29 days, from schools and nurseries from Cuiabá. The inclusion criteria were: 

absence of chronic diseases and regular usage of drugs, besides the parental consent. 

A questionnaire about the health status of participants was applied to parents and 

after, all participants were submitted to physical examination and blood collection. 

All blood samples were identified and prepared until analysis. The RIs were generated 

according to the statistical analysis included the following tests: Bartlett, multivariance 

analysis, Kruskal Wallis and Bonferroni post hoc test. 

Results: After statistical analysis, the age groups were divided into different groups 

according to the analyte evaluated. It has been proposed reference ranges for each 

of these analytes. For total cholesterol were proposed: 1 year (84 to 91 mg/dL), 02 

to 05 years (97-202 mg/dL) and 6 to 12 years (103 to 207 mg/dL). For triglycerides, 

age ranges and reference intervals were proposed: 01 years (23 to 177 mg/dL), 02-03 

years (26 to 140 mg/dL) and 04 to 12 years (19 to 131 mg/dL). For glucose, age ranges 

and reference intervals were proposed: 01 years (52 to 85 mg/dL), 02-03 years (57-88 

mg/dL), 04 to 06 years (60 to 92 mg/dL) , 07 to 10 years (66 to 93 mg/dL) and 11 to 12 

(67 to 100 mg/dL).For insulin, age ranges and reference intervals were proposed: 01 

to 04 years (up to 7.4 microUI/mL), 05 to 08 years (up to 11.6 microUI/mL), 09 to 10 

years (up to 16,4 microUI/mL), 11 to 12 years (up to 26,7 microUI/mL). For Vitamin 

D age ranges and references intervals were proposed: 01 to 04 years (21 a 60 ng/mL) 

and 05 to 12 years (19 to 57 ng/mL). 

Conclusion: The tracks proposals and the values obtained were similar to those 

found in other studies around the world involving children and adolescents but 

other analytes would be evaluated regarding to establishment the RI in the Brazilian 

Paediatric Population. 

B-312 

Implementation of a Quality Improvement Program to Improve Sweat 

test performance in a Pediatric Hospital 

B. AQIL 1 , A. WEST 2 , M. DOWLIN 2 , E. TAM 2 , C. NORDSTROM 2 , G. 

BUFFONE 1 , S. DEVARAJ 1 . 1 BAYLOR COLLEGE OF MEDICINE, 

HOUSTON, TX, 2 TEXAS CHILDRENS HOSPITAL, HOUSTON, TX 

Background: All positive screening of newborns for Cystic fibrosis using the driedblood 

spot 2-tiered immunoreactive trypsinogen/DNA method require subsequent 

sweat chloride testing for confirmation. Obtaining an adequate volume of sweat to 

measure chloride is a challenge for many cystic fibrosis centers across the nation. 

The standard for patients older than 3 months is a less than 5% quantity not sufficient 

(QNS) rate and for less than 3 months is less than 10% QNS. 

Objective: Using the Wescor Macroduct method, at our hospital laboratory QNS rate 

was more than double of what is recommended for CF centers and thus, the objective 

was to set up a quality improvement (QI) program for sweat testing to improve QNS 

rates. 

Results: Quantity not sufficient rates were evaluated for 4 months before and 8 

months after implementation for patients aged 3 months or younger and those older 

than 3 months. The QI program included changes in technician training, in service, 




site of collection, mode of collection, weekly review and forms to screen patients for 

medications that may alter sweat production. A marked improvement was observed in 

the rates of QNS which declined considerably from 16.7 to 8.5% (< 3 months old) and 

from 9.3 to 2.2% (> 3 months old) after implementation of the QI program initiative 

in both age categories. 

Conclusion: This report demonstrates the effectiveness of the QI program in 

significantly improving QNS rates in sweat chloride testing in a pediatric hospital. 

B-313 

The urine sediment: so much for so little 

G. Pérez-Moya, A. I. Alvarez-Rios, B. Pineda-Navarro, M. Ariza, J. M. 

Guerrero. Hospital Universitario Virgen del Rocío, Sevilla, Spain 

Background: Cystinuria is an autosomal recessive hereditary disease, caused by 

a defect in intestinal and renal tubular transport of cystine, lysine, ornithine and 

arginine. Increased urinary excretion of cystine associated to an acidic pH promotes 

the formation of crystals and causes the formation of kidney and bladder stones, 

usually bilateral. It is the cause of approximately 6-10% stones in children. Clinically 

manifested by recurrent urolithiasis symptoms and complications that flow from it. 

Medical treatment has limited effectiveness and often need to resort to surgery. 

We present a case in which the first diagnostic finding was the observation of crystals 

of cystine in the urinary sediment. 

Methods: A one year child was admitted for study of febrile syndrome with urinary 

symptoms. We performed a renal ultrasound and observed a small nephrolithiasis 

without hydronephrosis secondary to obstruction. No family history refers 

nephrolithiasis, paternal grandfather was diagnosed with bladder cancer. No relevant 

medical history. 

We initiated nephrolithiasis metabolic study. The first thing was to analyze urinary 

sediment with analyzer Max-Sedimax Aution (Menarini). Hexagonal and plans 

crystals are observed, consistent with cystine crystals. Subsequently Brand test is 

performed, a qualitative determination of cystine concentration in urine, and it was 

positive. Dietary measures were recommended, oral fluids to ensure a copious urine 

volume and sodium restriction. Medical treatment consisted of urine alkalinization 

with potassium citrate which improves cystine solubility and a cystine chelator, 

captopril. Successful cystinuria´s treatment required monitoring of compliance very 

closely in order to prevent complications. 

Six months after the diagnosis we could analyze the renal stone, for infrared 

spectrometry (Nicolet 200 GO) confirmed the cystine (95 %) and carboxiapatita (5 

%) composition. 

The patient had a favorable outcome until now. He is two years old. 

Results: In this case the first diagnosis finding was hexagonal plans crystals of the 

urine sediment, which are patognomonic of cystinuria. According to the literature 

available, we find them only in 25% of pediatric patients 

Conclusion: Overall, urinary sediment examination is the most widely requested 

biological test among the medical profession. Its value is undeniable when properly 

performed and accurately assessed. However, experience shows that recent mass 

testing has detracted from the care required to perform a proper urine sediment 

examination. 

Cystinuria is a complex kidney disease. We would like to emphasize the importance 

of early diagnosis and closely monitoring of disease development as well as the 

complicated treatments in these patients. They have an increased risk of developing 

progressive Kidney failure and need dialysis or a kidney transplant. 

Treatment for cystinuria have advanced little in the past 30 years, alkalinization and 

thiol therapy with tiotropin, D- penicillamine, bucilamina y captopril are appropiate. 

Other pharmacologic therapies are in development, the new inhibitors of cystine 

crystallizaton. 


A265


Lipids/Lipoproteins 

B-316 




Performance Evaluation of an Automated Assay for Lipoprotein- 

Associated Phospholipase A2 (Lp-PLA2) Activity 

H. Callanan, A. S. Jaffe, A. K. Saenger. Mayo Clinic, Rochester, MN 

Background: Lipoprotein-associated phospholipase A 2 

(Lp-PLA 2 

) is a serine lipase 

produced by macrophages and lymphocytes which circulates bound primarily to 

LDL and Lp(a) and cleaves oxidized lipids from apoB-100 containing lipoproteins. 

Inhibition of Lp-PLA 2 

activity with darapladib has been shown to reduce atherosclerotic 

lesion size and assessment of enzyme activity has potential value for predicting risk 

of future cardiovascular events. Due to known pre- and post-analytical problems 

with the automated and manual Lp-PLA 2 

mass assays, we collaboratively developed 

and validated an automated Lp-PLA 2 

activity assay (diaDexus, San Francisco, CA) 

suitable for high-throughput testing. Objective: establish the analytical performance 

characteristics of the Lp-PLA 2 

activity assay on the Roche Cobas 6000/c501. 

Methods: Specific test parameters for Lp-PLA 2 

activity were determined using an open 

user-defined channel on the Cobas 6000/c501 (Roche Diagnostics, Indianapolis, IN). 

Activity is determined by spectrophotometrically monitoring the rate of 4-nitrophenol 

formed and calibration is achieved using a 5-point calibration curve (0-400 nmol/ 

min/mL). Analytical performance was established for the following parameters: 

specimen type, stability, precision, linearity, accuracy/recovery, analytical sensitivity, 

method comparison (Beckman AU400 vs. Cobas), reference range, reagent lot-to-lot 

comparison, on-board reagent stability and analytical specificity. 

Results: EDTA plasma is the historic preferred specimen type and used as the 

comparator. Serum yielded similar results to EDTA plasma with a mean difference 

of -1.2% and -0.5% for red top and SST tubes, respectively. Sample stability was 

established for serum and plasma and acceptable for ambient (≤ 4 hours), refrigerated 

(≤ 31 days) and frozen at -20 and -70°C (≤ 31 days) temperatures, with a mean 

difference of ≤ 3.6% over a range of activity values (122-225 nmol/min/mL). Multiple 

freeze/thaw cycles had minimal influence (range: 0.2-7.8%), a significant improvement 

over our prior studies with the mass assay. Intra- and inter-assay precision (n = 20) 

studies with three serum pools yielded within-run precision of 0.4-0.7% (range: 

114-310 nmol/min/mL) and between-assay precision of 1.5-1.7% (range: 125-246 

nmol/min/mL). Assay linearity is between 10-400 nmol/min/mL (LoQ: 2.8% at 7.8 

nmol/min/mL) and accuracy was proven with mean recoveries between 96-103%. 

Method comparison between the AU400 and Cobas for serum Lp-PLA 2 

activity 

(range: 4.8-369 nmol/min/mL, n = 40) demonstrated highly correlated results with 

minimal bias (y = 0.9911x + 0.926, r 2 = 0.999). Reference intervals were established 

using pre-screened normal donors without traditional risk factors for atherosclerotic 

disease (n = 256, 117 males and 139 females, age: 23-86). A statistically significant 

relationship exists between Lp-PLA 2 

activity and gender (p20%) with hemoglobin at 0.25 g/dL, bilirubin at 10 mg/ 

dL and triglycerides at 750 mg/dL. 

Conclusion: We have collaboratively developed an Lp-PLA 2 

activity assay with 

accurate and precise performance characteristics on the Cobas c501 automated 

platform. The assay is analytically robust, allowing for adoption of Lp-PLA 2 

activity 

in clinical practice. 

B-317 

Specific and High-throughput Enzyme Combination Assay to Measure 

Sphingomyelin in Serum 

T. Kimura 1 , H. Kuwata 2 , K. Miyauchi 2 , Y. Katayama 2 , N. Kayahara 1 , H. 

Sugiuchi 3 , Y. Ishitsuka 4 , M. Irikura 4 , T. Irie 4 . 1 Kyowa Medex Co., Ltd., 

Tokyo, Japan, 2 Kyowa Medex Co., Ltd., Shizuoka, Japan, 3 Kumamoto 

Health Science University, Kumamoto, Japan, 4 Graduate School of 

Pharmaceutical Sciences, Kumamoto University, Kumamoto, Japan 

Background: Serum sphingomyelin (SM) has a predictive value in the development 

of coronary arterial diseases. Furthermore, interest in the quantification of SM has 

broadened because of the fact that SM plays important roles including maintenance of 

the cell membrane structure, control of signal transduction pathways, and formation 

of lipid rafts. However, no convenient and specific assay for measuring SM in serum 

is available for routine laboratory practice. 

Methods: Reaction specificities of 6 enzymes toward choline-containing 

phospholipids (PL) were investigated. Based on the differential specificity of the 

enzymes, we developed a two-step enzymatic assay to measure SM, and evaluated 

its performance with the Hitachi-7170 autoanalyzer, using human sera from healthy 

individuals and the isolated lipoprotein fractions. 

Results: Of the enzymes tested, phospholipase D from Streptomyces species had 

a high specificity for phosphatidylcholine (PC), while monoglycerolipase from 

Bacillus species was specific to lysophosphatidylcholine (LPC). Utilizing the 

differential specificity of the enzymes, we developed a two-step enzymatic assay 

to measure SM in serum. In the first step of the proposed assay, PC and LPC were 

completely eliminated by 10 KU/L of phospholipase D from Streptomyces species 

and 1 KU/L of monoglycerolipase from Bacillus species, respectively. In the second 

step, the remaining SM was converted into choline by 4 KU/L of phospholipase D 

from Streptomyces chromofuscus that had broad specificity to PL, and was measured 

spectrophotometrically at dual wavelength measurements [600 nm (main) and 700 nm 

(subsidiary)]. The assay results of the serially diluted SM standard solution showed 

excellent linearity up to ~1 g/L (1.42 mmol/L), with a lower detection limit of 1 mg/L 

(1.42 μmol/L). Within-run coefficients of variation (CVs) for the proposed assay were 

0.88 and 0.79% at 0.333 and 0.709 g/L (0.473 and 0.994 mmol/L) in pooled sera. 

The run-to-run CVs were 3.17 and 1.58% at 0.555 and 0.598 g/L (0.788 and 0.849 

mmol/L), as determined by assaying the same sample on 4 different days. We found 

a high correlation between the proposed SM assay results and the theoretical SM 

values in sera from healthy individuals [y = 0.944x - 0.003, r = 0.940 (n = 127)], 

where the theoretical SM values in serum were estimated by subtracting the levels of 

PC and LPC from that of the total PL, the levels of which were determined by using 

enzymatic methods established previously. There was a weak correlation between SM 

and PL in serum [y = 0.112x + 22.02, r = 0.493 (n = 127)]. The normal reference 

range for SM in serum obtained by the proposed assay was 0.42±0.05 g/L (0.60±0.08 

mmol/L) for 127 healthy individuals. The proposed assay is also applicable to the SM 

measurement in isolated serum lipoprotein fractions. The proposed assay does not 

require any pretreatment and uses 2.5 μL of the sample, with the assay taking only 10 

min on the autoanalyzer. Conclusion: The proposed high-throughput enzymatic assay 

can measure SM in serum with the required specificity, and is applicable to routine 

laboratory practice. 

B-318 

Qualitative Determination of Triacylglycerol Hydroperoxide in VLDL, 

Intermediate Density Lipoprotein and Human Plasma using Orbitrap 

Mass Spectrometer 

R. Shrestha, S. P. Hui, T. Sakurai, Y. Takahashi, F. Ohkawa, R. Miyazaki, 

N. Xiao, S. Takeda, S. Jin, H. Fuda, H. Chiba. Faculty of Health Sciences, 

Hokkaido University, Sapporo, Japan 

Background: Oxidative modification, including peroxidation of lipid contents 

in lipoproteins is believed to play crucial role in development of atherosclerosis. 

Peroxidation of triacylglycerol carried by triglyceride (TG) rich lipoprotein may add 

risk for the disease. Though several methods had been put forward for detection of 

lipid hydroperoxides in biological sample, most of them were focused in cholesteryl 

ester hydroperoxide and phospholipid hydroperoxide. TG hydroperoxide (TGOOH) 

has not been detected and identified in human lipoprotein samples and plasma. We 

aimed to developed method for detection TGOOH in plasma and TG rich lipoproteins, 

and identified several molecular species of TGOOH. 




Methods: We developed a novel approach for identification and characterization of 

TGOOH from the lipid extract of plasma and lipoprotein fractions, using reversedphase 

liquid chromatography with a hybrid linear ion trap-Orbitrap mass spectrometer 

(LC-LTQ Orbitrap). The identification of molecular species of TGOOH was achieved 

by use of high-mass-accuracy mass spectrometric data obtained by using the 

spectrometer in Fourier-transform mode. We used in-house synthesized TGOOH 

standards namely- 1-oleoyl-2-linoleoyl-3-palmitoylglycerol monohydroperoxide 

(TGOOH 18:1/18:2/16:0), 1,2-dioleoyl-3-palmitoylglycerol monohydroperoxide 

(TGOOH 18:1/18:1/16:0), and triolein monohydroperoxide (TGOOH 18:1/18:1/18:1) 

for identification. VLDL and intermediate density lipoprotein (IDL) was isolated 

using sequential ultracentrifugation from EDTA Plasma. The purity of isolated 

VLDL and IDL were ensured by determining its chemical composition, characteristic 

motility in polyacrylamide gel disc electrophoresis and apolipoprotein study by SDS- 

PAGE. Fasting EDTA plasma was collected from 9 healthy volunteer and stored at 

-80 °C until use. Total lipids were extracted from plasma and lipoprotein sample, and 

subjected for the LC-LTQ Orbitrap analysis. TGOOH was detected as the [M+NH4]+ 

ion. Extracted ion chromatograms were drawn with the mass tolerance set at 5.0 ppm. 

Results: We identified all together 11 molecular species of TGOOH in either of 

VLDL, IDL or plasma based on their specific elemental composition and m/z on 

mass spectra. All plasma contain TGOOH 18:1/18:1/16:0 and 16:0/18:2/16:0, 

while TGOOH 16:0/22:6/18:1 was not detected in plasma. TGOOH 18:1/18:2/16:0, 

TGOOH 18:1/18:1/18:1, TGOOH 16:0/18:2/16:0, TGOOH 18:1/18:2/18:1, TGOOH 

16:0/20:4/16:0, TGOOH 16:0/20:5/18:1, TGOOH 16:0/22:4/18:1 and TGOOH 

16:0/22:6/18:1 were present in all native VLDL and IDL fractions. TGOOH 

16:0/18:1/16:0 was not detected in the lipoprotein fractions. In contrast, the TGOOH 

16:0/18:1/16:0 was detected in 4 out of 9 of our plasma samples. 

Conclusion: We detected and characterized 11 molecular species of TGOOH in 

human plasma, VLDL and IDL using simple technique of LC-LTQ Orbitrap with 

analytical sensitivity of 0.1 pmol. Further work is needed to find association of these 

TGOOH in atherosclerotic process and possible role of its quantitative determination 

in human plasma to assess cardiovascular risk. 

B-319 

A commutability study coupled to a multicentric analysis of accuracy 

of total cholesterol, LDL-C, HDL-C and total glycerides assays 

M. Heuillet, B. Lalere, S. Vaslin-Reimann, V. Delatour. LNE Paris, paris, 

France 

Background: Reliable measurements in medical biology are essential for early 

screening and appropriate follow-up of patients. Ensuring metrological traceability 

of clinical measurements enables to obtain comparable results over time and between 

different laboratories that could use different methods to quantify the same biomarker. 

To assess and improve comparability of clinical measurements, our laboratory 

recently produced a candidate certified reference material (CRM) for glucose, 

creatinine, total cholesterol, HDL-cholesterol, LDL-cholesterol and total glycerides. 

To assess commutability of the candidate CRM and other PT samples, we organized 

a commutability study that also allowed to assess accuracy of routine methods. We 

especially focused on lipid profile, which is currently the main diagnostic test to assess 

the risk to develop cardiovascular disease. 

Methods: The candidate CRM was produced according to NCCLS C37A guidelines 

and consists in 2 levels of frozen human serum. Target values were assigned with IDMS 

reference methods for total cholesterol, glucose, creatinine and total glycerides, and 

with beta-quantification for LDL-cholesterol and HDL-cholesterol. Commutability of 

the candidate CRM and 8 PT samples (4 lyophilized and 4 frozen human serums, with 

or without spiking with pure glucose and creatinine) was assessed for the 6 analytes 

according to CLSI C53A guidelines. The study involved 38 clinical laboratories 

coupled by pairs and selected to represent the most popular methods. More than 15000 

clinical measurements were performed and accuracy of field methods was assessed 

with commutable materials. 

Results: The candidate CRM and most of the frozen sera appeared to be commutable 

for glucose, creatinine and total glycerides, even those spiked with pure compounds to 

reach pathological concentrations. For TCh, HDL-C and LDL-C, very few lyophilized 

samples appeared to be commutable, in contrary to frozen samples prepared according 

to C37A guidelines. For example, for total cholesterol measured with a non-phenolic 

chromogen with spectrophotometric detection, mean bias on commutable sera 

was -4.4% ± 1.1% whereas bias on lyophilized serum was -10.2% ± 2.8%. We 

also observed a wide dispersion of the results obtained in clinical laboratories for 

LDL-cholesterol measurement (bias from -7.6% to 17.7%) and HDL-cholesterol 

measurement (bias from -9.6% to +13.0%). Discrepant results were also obtained on 

the same analyser but using different reagent lots (up to 10.3 %). 

Conclusion: This study provides further evidence that most PT samples are not 

commutable and are not suitable to rigorously assess accuracy of field methods used 

in clinical laboratories. Our results highlight that lot to lot variations can introduce 

significant fluctuations in terms of method performance, suggesting that methods 

should be re-validated with commutable samples when changing reagents lots. 

Our data also indicate that adjusting analyte concentration by spiking with pure 

compounds could be possible for small molecules and metabolites like glucose 

and creatinine without affecting materials commutability. Regarding HDL-C and 

LDL-C, significant inter-method variability was observed: it could be hypothesized 

that methods do not exactly measure cholesterol associated to the same lipoprotein 

sub-fractions. To rigorously evaluate what methods really measure, new reference 

methods and standards are needed to perform advanced lipoprotein testing and have 

comparable results. 

B-320 

Improved Reference Measurement Procedures for Total Glycerides 

and Free-Glycerol Assures the Accuracy of Triglyceride measurements 

in Laboratory Medicine 

S. H. Edwards 1 , S. L. Stribling 2 , D. M. Pierre 1 , H. W. Vesper 1 . 1 Centers for 

Disease Control and Prevention, Atlanta, GA, 2 Battelle Memorial Institute, 

Atlanta, GA 

Background: The use of routine measurements that are in agreement with validated 

reference measurement procedures (RMPs) for serum glycerides is critical for 

application of NCEP guidelines in assessment and diagnosis of hypertriglyceridemia 

and detection of increased cardiovascular disease risk. Stable RMPs serves as an 

essential tool for assuring accurate determination of triglycerides (TG) and free 

glycerol (FG) concentrations in human serum. The common routine methods are based 

on enzymatic chemistries with non-specificity for the various glycerol-containing 

species (tri-, di-, mono-glycerides and free glycerol) in serum and detect glycerol 

from all species including free glycerol. Since both glycerol-blanked and non-blanked 

enzymatic assays are still being used routinely for TG measurements in patient care it 

is essential for these methods to be traceable to a relevant accuracy point. The CDC 

TG and FG isotope dilution mass-spectrometry (ID/GC/MS) reference measurement 

procedures permit transfer of accuracy from stable, validated procedures to routine 

clinical measurements and provides a mechanism for assuring traceability of test 

results obtained from free-glycerol blanked assays and those without glycerol 

blanking. 

Methods: The total glycerides and free-glycerol in serum specimens and quality 

control materials prepared according to CLSI-37A standardized protocol were 

analyzed by ID/GC/MS according to CDC’s reference measurement procedures. 

In brief, aliquots of the serum specimens were fortified with [ 13 C 3 

]-glycerol as an 

internal standard and homogenized by mixing. The glycerol occurring as free unesterified 

glycerol and glycerol hydrolyzed from fatty acid esters were extracted by 

liquid extraction and the extracts were evaporated under nitrogen then derivatized 

with trisil-BSA and acetic acid/pyridine, respectively. The derivatized products were 

subsequently analyzed by mass spectrometry and the free-glycerol and total glycerides 

were determined from a linear regression of the ratios of ion intensities obtained from 

increasing glycerol concentration of the calibrator solutions. 

Results: The total glycerides concentration in the serum pools ranged from 82 mg/ 

dL to 266 mg/dL and the free glycerol concentration for the same pools ranged from 

2.89 mg/dL to 16.0 mg/dL. The net triglycerides which are calculated as the difference 

between total and free-glycerol concentration ranged from 75 mg/dL to 252 mg/dL. 

The accuracy of the FG method was determined from serum specimens that were 

spiked in with unlabeled glycerol at 0.9 mg/dL, 3.6 mg/dl and 9.01 mg/dL and the 

percent recovery ranged from 89% to 117% for free glycerol. The accuracy of the total 

glyceride method was evaluated by analyzing SRM 1951b, level 2 and the bias from 

the certified reference value was determined. The relative biases 1.6% 

Conclusion: The CDC TG and FG RMPs permits standardization of TG measurements 

and ensure that both glycerol-blanked and non-blanked routine measurements of TG 

and FG are traceable to common accuracy bases. These methods have demonstrated 

the level of accuracy and precision that is now routinely expected for RMPs. 


A267



B-321 

Reagent and Procedure for Immunoprecipitation of Apo B-containing 

Lipoproteins 

R. Nguyen, J. H. Contois. Sun Diagnostics, LLC, New Gloucester, ME 

Background: Immunoprecipitation (IP) with antisera provides the most specific 

method available for separation of lipoproteins. IP is simple to perform, does not 

alter lipoprotein particle composition and allows for more robust precipitation than 

chemical methods. Here, we describe an IP reagent and procedure for isolation of 

HDL particles in human sera. 

Methods: IP reagent was delipidated and stabilized goat anti-apo B antisera. Doseresponse 

study indicated that equal volumes of sample and reagent completely 

precipitated all apo-B containing lipoproteins to 300 mg/dL with no effect on HDL 

(Figure). Incubation time (1 – 60 min), centrifugation speed (8,000-14,000 rpm) 

and centrifugation time (5 – 15 min) had little effect on results. For subsequent 

experiments 200 or 250 μL of reagent was added to an equal volume of sample and 

vortexed for 10 seconds, incubated for 10 minutes at RT, and centrifuged at 12,000 

rpm for 10 minutes. Precision was assessed by IP of 10 replicates of a serum pool. 

HDL-C results for 25 serum samples with apo B concentrations from 45-138 mg/ 

dL were determined by IP and dextran sulfate/MgCl 2 

precipitation. Specificity was 

determined by measuring apos AI and B in 25 sera before and after IP. 

Results: Total imprecision was 5.0%. Analytical imprecision, determined by 

combining supernatants after IP and measuring apo AI in the supernatant pool 10 

times, was 2.8%. By difference, the imprecision attributable to IP was 2.2%. HDL-C 

by IP (Y) gave excellent agreement to dextran sulfate/MgCl 2 

precipitation (Figure). 

The mean recovery of apos AI and B after IP was 98.3% and 1.0%, respectively; all 

apo B results were < LOD. 

Conclusion: The IP reagent and protocol is a simple, effective and highly specific tool 

for isolating HDL particles in human serum. 

B-322 

Galectin-3 in Urine is a Promising Biomarker in Renal Fibrosis: 

Assessment of Analytical Performance and Establishment of Reference 

Intervals Using Iothalamate Clearance Testing 

A. V. Gray, M. A. V. Willrich, A. D. Rule, J. C. Lieske, A. S. Jaffe, A. K. 

Saenger. Mayo Clinic, Rochester, MN 

Background: Nephrosclerosis is a common finding on kidney biopsies and among 

those with renal disease remains an important indicator of adverse prognosis. The 

invasive nature of the biopsy remains a barrier to obtaining consent for initial or 

follow-up procedures. A biomarker indicative of ongoing or progressive renal fibrosis 

would be valuable for identifying individuals harboring the greatest risk for loss of 

future kidney function and may be useful to guide therapeutic response. Galectin-3 

(gal-3) is a β-galactoside-binding lectin (MW ~30kDa) upregulated during fibrotic 

reactions within a diverse array of tissues, including the kidney. The purpose of this 

study was to determine the performance characteristics of the galectin-3 assay in urine 

and establish reference intervals using rigorous assessment of healthy kidney donors. 

Methods: Urine gal-3 was validated using a quantitative 2-site manual ELISA 

(BG Medicine, Waltham, MA). Residual waste urine was utilized for the validation 

which included evaluation of stability, precision, accuracy, linearity, measurable and 

reportable ranges, and specificity. Non-parametric reference intervals were established 

with a cohort of healthy kidney donors defined using stringent criteria for normal 

renal function assessed by iothalamate clearance (n=455). Gal-3 was analyzed against 

other kidney function tests, CKD risk factors, renal biopsy findings, kidney volumes 

and other novel inflammatory markers. Urine specimens from 80 diabetic subjects 

comprised the diseased cohort for comparison to normals. Gal-3 concentrations were 

normalized to urine creatinine (ng/mg cr). 

Results: Urine gal-3 is stable when stored up to 7 days ambient, refrigerate (2-8°C) 

or frozen (-70°C) and up to 3 freeze/thaw cycles. Significant gal-3 differences were 

noted between centrifuged versus non-centrifuged urine specimens following a 

freeze/thaw cycle, likely indicative of gal-3 release following cell membrane lysis. 

Intra- and inter-assay precision (n = 20) studies with low and high gal-3 urine pools 

yielded within-run precision between 3.4-6% (range: 6.4-94 ng/mL) and betweenrun 

precision of 10-11% (range: 6.2-82 ng/mL). Linearity was assessed through 

mixing studies and acceptable between 3.8-100 ng/mL (y = 1.02x + 1.42, r 2 = 0.992). 

Urine dilutions were acceptable (x 4), extending the reportable range up to 400 ng/ 

mL. Interference studies established no significant bias (>20%) with conjugated 

bilirubin (



Results: The TC and HDL tests demonstrated linearity up to 20 mmol/L and 6 

mmol/L, respectively. For TC, the within-run coefficients of variation (CV) were less 

than 2.6%, and the total CVs were less than 2.7%. For HDL, the within-run CVs were 

less than 1.5%, and the total CVs were less than 2.1%. No significant interference 

(



CA, USA). Briefly, 25μL of serum sample and 300μL of loading gel were applied to 

an 8.0% polyacrylamide gel tube and mixed well. The sample was photopolymerized 

at room temperature for 30 minutes and then electrophoresed for 50 minutes (3mA/ 

gel tube). The sample was then left standing for 30 minutes to prevent dehydration of 

the gel and fading of the bands. All of the HDL subfractions were calculated based 

on a flotation rate (Rf) between the very low-density lipoprotein (VLDL) fraction and 

low-density lipoprotein (LDL) fraction of Rf = 0.0, and the albumin fraction of =1.0. 

Subfractions HDL1-3 was defined as large-sized HDL, HDL4-7 as middle-HDL, and 

HDL8-10 as small-sized HDL. 

Results: After treatment, total cholesterol and LDL-cholesterol levels were 

significantly decreased by 21.4% (from 7.14±1.27 to 5.61±0.88 mmol/L, p



use extensive sample preparation, which is generally needed in order to extract the 

variety of lipid classes of interest in cardiovascular disease research. We aimed to 

develop a simplified LC-MS/MS assay capable of simultaneously quantifying five 

lipid classes (SM, CER, GluCer, LacCer and PC). 

Methods: We identified a solvent formulation that facilitates one-step extraction 

of all five lipid classes. We also compiled a comprehensive database of MRM 

transitions of all biologically known and plausible non-isobaric members of these 

lipids classes. To 10 μL of sample, 190 μL of an extraction solvent [MTBE, methanol 

and isopropanol] containing 400 ng/mL of internal standard was added, vortexed for 

5 min and centrifuged at 17,000g for 10 min. 5 μL of the supernatant was directly 

injected into the LC column (Agilent Polaris Amide C18; 2X100X5μm) and analyzed 

using a triple quadruple tandem mass spectrometer (Thermo TSQ-Vantage). Data was 

analyzed using Pinpoint software. For PC and SM, MRM transitions were generated 

from protonated parent molecules and the fragment containing the choline head group 

(m/z 184) while for CER, GluCer and LacCer, three transitions were generated with 

protonated parent molecule and three fragments (m/z 256, 264 and 284). 

Results: Average within-day and between-day imprecision for over 60 non-isobaric 

lipids targeted by this approach were 12% and 16% for plasma and 8% and 16% 

erythrocytes, respectively. Using this extraction approach, we were able to recover 

lipids spiked directly into serum (88-102% recovery), which has not been previously 

reported to our knowledge. In plasma, within-individual variability of lipids ranged 

from 1% to 15% and between-individual variability ranged from 5% to 29%. The 

assay was used to demonstrate that lipid species in erythrocyte membranes are not 

different between pre- and post-mortem non-human primate samples. In a small 

pilot study, specific erythrocyte membrane lipid species were higher in patients with 

sudden cardiac arrest than in healthy study subjects. 

Conclusion: We have developed a one-step sample preparation that efficiently 

extracts a panel of lipid classes. The method is ideally suited for the simultaneous 

relative quantitation of clinically relevant lipid markers, including phosphatidyl 

cholines, sphingomyelins, and ceramides and glycated ceramides. 

B-331 

Development of a LC-MS/MS Method to Quantitate Total and 

Fractionated Fecal Bile Acids 

A. J. Lueke, L. J. Donato, A. S. Jaffe, M. Camilleri, A. K. Saenger. Mayo 

Clinic Rochester, Rochester, MN 

Introduction: Bile acid malabsorption (BAM) is a disorder associated with 

symptomatic chronic diarrhea. It is frequently misdiagnosed as irritable bowel 

syndrome (IBS). A definitive diagnosis of BAM can be made by demonstrating 

elevated concentrations of primary fecal bile acids (chenodeoxycholic acid, CDCA; 

cholic acid, CA) leading to bile acid sequesterant therapy. Lithocholic acid (LCA) 

and deoxycholic acid (DCA) are the secondary bile acids and predominant in normal 

human feces. We have developed a LC-MS/MS assay which quantitates the major 

unconjugated bile acids present in stool, which can assist in differentiation between 

BAM and IBS. 

Methods: Timed stool collections (48 hr) from healthy volunteers and IBS patients 

were weighed, homogenized with water and acidified with ACN. Specimens were 

vortexed and centrifuged following precipitation with ammonium sulfate and final 

extraction was achieved by performing a 1:10 (ACN:MeOH) dilution. Deuterated 

internal standards of the unconjugated fecal bile acids were added and isolated by 

solid phase extraction (Oasis HLB SPE) cartridges. Following elution with MeOH, 

fecal bile acids were chromatographically separated on an analytical column 

(Poroshell C18 RP, 2.1 x 50mm, 2.7 μM) using a MeOH/20 mM ammonium acetate/ 

H2O gradient. Analytes were monitored in negative MRM mode (AB Sciex API 

5000) using the following transitions: CA 407.25/407.25; CDCA: 391.2/391.2; 

DCA: 391.2/391.2; LCA 375.3/375.3; UDCA: 391.3/391.3; separation was achieved 

chromatographically to optimize operation time (total analysis time=13 min, 8.5 min 

window on MS/MS). A single stool homogenate was used for the standard curve, 

spiking in a fixed amount of each individual bile acid (500, 200, 100, 50, 20, 5 and 

0 μM). Final results were calculated as μM of bile acid/g solid stool, with the solid 

stool extract weight determined by NMR. Each individual bile acid is then reported 

as a percentage of the total. 

Results: Intra-assay precision (% CV) data was determined using 5 aliquots extracted 

from two individual stools. The precision on the extracts was ≤1.0% for LCA and 

DCA (40% and 60% of total; normal profile) and between 4.1-12.4% for the other 

bile acids (0.03-0.4% of total bile acids). UDCA and DCA precision was between 5.5- 

26.5% for CDCA, CA, LCA, DCA and UDCA, respectively and when run side by side 

and gave %CV data ranging from 5.5% to 26.2% (Concentrations ranged from 692 to 

0.26 mcM) . %CV data beyond 10% was observed for two analytes, both under 0.5 

mcM in concentration, suggesting this as the LOQ for the assay. Inter-assay precision 

was assessed using a control consisting of a stool extract with identical weight. The 

control demonstrated imprecision ranging from 9-19% for all five bile acids (absolute 

concentration range: 1-475 mcM). The average recovery assessed through multiple 

spiking studies was 81.4% (r 2 between 0.979-0.996). 

Conclusions: We have developed a sensitive, accurate and precise LC-MS/MS 

method to fractionate and quantitate unconjugated bile acids in feces to aid in the 

diagnosis of BAM in patients with chronic diarrhea by identifying a reversible cause 

of IBS. Additional clinical validation studies are warranted to derive an appropriate 

interpretive or therapeutic range for fecal bile acids. 

B-332 

To Fast or Not To Fast: That Is the Question 

K. Rodriguez-Capote 1 , T. N. Higgins 1 , G. S. Cembrowski 2 . 1 DynaLIFEDX, 

Edmonton, AB, Canada, 2 University of Alberta Hospital, Edmonton, AB, 

Canada 

Background:Following a study on fasting and non-fasting lipid values from a 

reference laboratory (Sidhu et al. Arch.Int.Med, 2012), the requirement for the 12 

hour fast for lipid testing in Alberta was questioned. Objective: to determine the effect 

of non-fasting lipid values on the calculation of LDL-cholesterol and the Framingham 

risk score. 

Methods:Representative sets of lipid data from 298 fasting patients were adjusted 

upward by up to 64% for triglyceride, and downward by up to 4% for HDL-cholesterol 

and 2% for total cholesterol in a Monte Carlo simulation with 5000 runs to validate 

the use of non-fasting lipid values using the Friedwald equation and the effect on the 

10-year risk Coronary Heart Disease Framingham score. 

Results: Calculated LDLs were falsely decreased for the non fasting state resulting 

in a 10-15% left shift in the frequency distribution (Figure), potentially leading to 

inappropriate therapy. To evaluate the possible change in risk classification in 

screening; two extreme scenarios were initially evaluated: worst case: 75 years old 

male smoker, with diabetes and hypertension and best case: 23 years old non-smoking 

female without diabetes and normal blood pressure. In the first case the Framingham 

score went from 31 to 32 (high risk) whereas in the second case from 0 to 1 (low risk) 

with no change in classification of risk. Variation in LDL-cholesterol from 3.37 to 

4.92 mmol/L produced a change in risk score of 1. Other scenarios produced similar 

outcomes in the risk score. 

Conclusion: If initial lipid screening requires just the knowledge of the Framingham 

risk score, patients need not fast. However, the 12 hour fast is mandatory when 

significant hyperlipidemia is discovered and serial, calculated LDL-cholesterol levels 

need to be assessed for treatment efficacy. 

B-333 

Low Density Lipoprotein Particle Assay Validation and Comparison 

Study 

D. E. Kelsey 1 , J. L. Toher 1 , M. T. Foster 2 , J. A. Boulanger 2 , M. A. Cervinski 2 . 

1 

Maine Standards Company, Windham, ME, 2 

Dartmouth-Hitchcock 

Medical Center, Lebanon, NH 

Background:Risk assessment for coronary heart disease (CHD) relies upon 

measurement of total cholesterol, high-density (HDL) cholesterol and either 

calculated or measured low-density (LDL) cholesterol in association with patient 

risk factors and risk equivalents. However lipid concentrations alone do not explain 

the development and progression of atherosclerotic plaques and studies have 


A271



demonstrated that atherosclerosis is also an inflammatory disease. This inflammation 

is mediated by foam cells generated from subendothelial macrophages following 

receptor-mediated endocytosis of oxidized LDL cholesterol. Foam cells secrete 

various proinflammatory cytokines and matrix metalloproteinases that may lead to 

plaque instability and rupture. Diet,exercise and a regimen of cholesterol lowering 

drugs reduce circulating LDL and thus the production of oxidized LDL, foam cells 

and atherosclerotic disease progression. However, low concentrations of LDL 

cholesterol may still be associated with LDL particles of varying size. Small, dense 

LDL particles have a greater potential than large buoyant particles for promoting the 

formation and expansion of the atherosclerotic plaques. The addition of an assay that 

can quantify the concentration of LDL particles in plasma may add to traditional lipid 

measurements in assessing a patient’s future risk for CHD. 

Objective: The objective of this study was to perform a laboratory validation of the 

Maine Standards ® (Windham, ME) Investigational Use Only (IUO) LDL-Particle 

(LDL-P) assay including comparison of the LDL-P concentration to calculated and 

measured LDL cholesterol values. 

Methods: Two levels of quality control (QC) material were run ten times within a 

single day and once daily for twenty non-consecutive days on a Cobas 6000 analyzer 

to assess within-run and day-to-day imprecision. In addition, 300 remnant plasma 

samples collected for physician ordered lipid profile analysis were analyzed via 

the LDL-P assay. The LDL-P concentration was compared to the LDL cholesterol 

concentration determined via the Friedewald equation and direct-LDL assay. The 

LDL-P, total cholesterol, HDL, triglyceride and direct-LDL assays were performed 

on the Roche Cobas 6000 or Modular analyzer (Roche Diagnostics, Indianapolis, IN). 

Results: The LDL-P within-run imprecision on the Cobas 6000 analyzer was 2.3% 

at 62 mg/dL (1127 nmol/L) and 2.2% at 109 mg/dL (1982 nmol/L). The withinlaboratory 

imprecision was 9.7% at 57 mg/dL (1036 nmol/L) and 6.1% at 104 

mg/dL (1891 nmol/L). The patient sample comparison demonstrated that LDL-P 

concentration deviated significantly from both the calculated LDL and direct-LDL 

cholesterol concentration. Linear regression analysis of LDL-P vs. calculated or 

direct-LDL cholesterol resulted in equations of LDL-P (mg/dL)=0.5825*(LDL)+49.3, 

r=0.9091 and LDL-P (mg/dL)=0.5897*(LDL)+40.5, r=0.9431, respectively. Bias plot 

analysis revealed that at low LDL cholesterol concentrations there was a tendency for 

a higher than anticipated LDL-P concentrations. 

Conclusion:This laboratory validation demonstrates that the IUO LDL-Particle 

assay from Maine Standards is a precise automated assay. Comparison of the LDL 

cholesterol to the LDL-Particle concentration demonstrates that even at low LDL 

cholesterol concentrations that there may be residual risk of CHD due to increased 

concentrations of small dense LDL particles. However assessment of this residual risk 

was not analyzed in this study and further prospective studies monitoring the LDL-P 

concentration and progression to CHD are needed. 

B-336 

Can the Range of the Freidewald Type Equation (FTE) be Extended? 

E. S. Pearlman 1 , M. Kempe 2 , C. Hoang 1 , J. Layden 1 . 1 Veterans Affairs 

Medical Center, Memphis, TN, 2 University of Tennessee Health Sciences 

Center, Memphis, TN 

Background: For triglyceride concentrations TGC



B-339 

Multicenter Evaluation of the Tina-quant® Lipoprotein (a) Gen.2 

Assay on Roche Clinical Chemistry Analyzers 

D. Dot Bach 1 , M. J. Castro Castro 1 , G. M. Fiedler 2 , J. Müller 2 , O. Probst 2 , 

J. Hoffmann 3 , S. Westphal 3 , D. Plonné 4 , C. Seemann 4 , M. Schmid 4 , S. 

Eckle 4 , E. Naumann 4 , C. Stein 5 , B. Loehr 5 . 1 Labioratori Clínic, Hospital 

Universitari de Bellvitge, Barcelona, Spain, 2 Center of Laboratory 

Medicine, University Institute of Clinical Chemistry, Inselspital - University 

Hospital, Bern, Switzerland, 3 Otto-von-Guericke-Universität Magdeburg, 

Institut für Klinische Chemie und Pathobiochemie, Magdeburg, Germany, 

4 

Labor Dr. Gärtner & Kollegen, Ravensburg, Germany, 5 Roche Diagnostics 

GmbH, Mannheim, Germany 

Background: Several prospective studies have demonstrated that Lipoprotein (a) 

is an independent risk factor for coronary heart disease. In clinical and commercial 

laboratories the Lp(a) mass is usually determined, which often have poor 

comparability between different Lp(a) methods due to the lack of standardization. 

The immunoreactivity of different samples is also affected by the apo(a) size 

polymorphism. 

The new Roche assay Tina-quant ® Lipoprotein (a) Gen.2 is traceable to the WHO/IFCC 

reference material SRM2B. This standardization results in accurate measurements of 

Lp(a) concentration independently from the apo(a) size. The analytical performance 

of the new assay was evaluated in four laboratories using Roche/Hitachi MODULAR 

ANALYTICS , COBAS INTEGRA ® 800 and cobas c 501 analyzers. 

Methods: Lp(a) concentration was measured turbidimetrically by a particle enhanced 

immunoassay standardized against the WHO/IFCC reference material SRM2B [unit 

nmol/L]. The analytical performance of the new assay was investigated under routine 

laboratory conditions using samples covering the complete measuring range (7 - 

240 nmol/L). The assessment included precision, recovery of controls and ring trial 

samples, and method comparison. The recovery was measured using three different 

calibrator lots in three independent runs with three determinations for each sample 

material. The precision and method comparison experiments were designed in 

compliance with CLSI recommendations EP05-A2 and EP09-A3, respectively. 

Results: Within-run precision was checked with two controls and three human sample 

pools (one run, n = 21 replicates per sample) covering a concentration range from 11.7 

to 220 nmol/L. CV’s were determined to be below 2.3 % with control materials and 

below 4.8 % with pooled samples. The CV of one sample with an Lp(a) concentration 

near to the decision limit of 75 nmol/L was 0.5 %. 

Investigating the same samples in precision experiments according to CLSI EP05-A2, 

the CV for the repeatability was below 3.3 %, and for intermediate precision the CV 

was below 5.8 % (95 %confidence interval) on all systems. 

The recovery of the Roche controls was well acceptable (control N: 95.1 - 105.9 

%; control AN: 98.3 - 106.8 %), thereby indicating a robust standardization process. 

The recovery was well comparable between different system platforms. Due to new 

standardization the recovery in ring trial samples was lower compared to the Lp(a) 

Gen.1 reagent of Roche Diagnostics. 

For comparison reasons the values of the samples measured in nmol/L were recalculated 

by the factor 0.4167 (Marcovina et al., Clin Chem 2000, 46(12), 1956ff). 

Statistical Passing/Bablok analysis of method comparison against the Roche Lp(a) 

generation 1 assay yielded correlation coefficients > 0.96, slopes between 0.73 and 

0.88, and intercepts from -0.067 to -0.027 g/L Lp(a) using > 119 routine samples. 

Conclusion: Our study demonstrated that the new Roche Tina-quant ® Lipoprotein 

(a) Gen. 2 assay has reliable and precise analytical performance. Good correlation 

was found between the different Roche analyzer platforms. Differences in method 

comparison to the Lp(a) Gen.1 assay can be accounted for by the traceability of the 

Gen. 2 assay to the WHO/IFCC reference material SRM2B which eliminate the 

impact of apo(a) size. 

COBAS, COBAS C, COBAS INTEGRA, MODULAR and TINA-QUANT are 

trademarks of Roche. 

B-340 

Development of a Novel Homogeneous Assay for Remnant Lipoprotein- 

Cholesterol 

Y. Hirao 1 , Y. Ito 1 , K. Nakajima 2 , H. Sumino 3 , T. Machida 3 , M. Murakami 3 . 

1 

Research and Development Department, Denka Seiken Co., Ltd., Niigata, 

Japan, 2 Graduate School of Health Sciences, Gunma University, Gunma, 

Japan, 3 Department of Clinical Laboratory Medicine, Gunma University 

Graduate School of Medicine, Gunma, Japan 

Background: Remnant lipoproteins (RLP), one of the lipoprotein subclasses, have 

been known as an atherogenic lipoprotein. Many epidemiological and clinical studies 

have shown that RLP-cholesterol (C) is an independent risk factor of coronary heart 

disease (CHD) and a specific marker for Type III hyperlipidemia. It is also known as 

a marker for postprandial hyperlipidemia. We here report the development of a fully 

automated homogeneous assay for RLP-C quantification which does not require any 

off-line sample pretreatment. 

Methods: We screened enzymes and surfactants for the establishment of 

homogeneous RLP-C assay, using CM-VLDL, LDL and HDL fractions isolated by 

ultracentrifugation, and RLP fractions isolated by immunoaffinity gels fixed with 

anti-apoA-I and apoB-100 antibodies. All data were generated on automated clinical 

chemistry analyzers from Hitachi. 

Results: We have found that a cholesterol esterase with no subunits of less than 40 

kDa (H Mol CHE) reacted lipoproteins except for RLP, whereas an enzyme with a 

subunit of less than 40 kDa (L Mol CHE) reacted with RLP. We then employed the H 

Mol CHE for the 1st step reaction to dissociate non-RLP lipoproteins and degraded 

non-RLP-cholesterol to water and oxygen under the presence of cholesterol oxidase 

and catalase. For the 2nd step, we applied the L Mol CHE to release cholesterol from 

RLP, and then determined the released RLP-C in the standard cholesterol oxidase and 

peroxidase system. 

We used the following 2 reagents to measure RLP-C. Reagent-1 consisted of H 

Mol CHE, cholesterol oxidase, catalase, N-ethyl-N-(2-hydroxy-3-sulfopropyl)-3- 

methylaniline, sodium salt, dehydrate (TOOS), and detergent in PIPES buffer (pH 

6.8). Reagent-2 consisted of L Mol CHE, peroxidase, 4-aminoantipyrine, sodium 

azide, and detergent in PIPES buffer (pH 6.8). A 210 uL aliquot of Reagent-1 was 

added to 4 uL sample serum or plasma, and the solution was incubated at 37 oC for 

5 min (1st step). Next, 70 uL of Reagent-2 was added, and the reaction mixture was 

incubated at 37 oC for 5 min (2nd step). 

Our new homogeneous assay exhibited a good correlation with the current RLP-C 

method using anti-apoA and apoB affinity gel (r>0.9). The correlation coefficient 

between TG and homogeneous RLP-C was less than 0.90. Higher correlation between 

TG and homogeneous RLP-C was observed in the postprandial plasma than that in the 

fasting plasma. RLP-C levels in pregnant plasma samples were comparatively low in 

spite of high TG levels. Significantly higher RLP-C levels were found in cases with 

metabolic syndrome and diabetes than in normal controls. 

Conclusions: Our new homogeneous assay method can determine serum or plasma 

RLP-C levels in 10 min in a fully automated manner and can allow the analysis of 

large number of samples in routine laboratories. 

B-341 

Evaluation of a New Generation Homogenous HDL Cholesterol Assay 

on Beckman Coulter Unicel® DxC Synchron® Clinical Chemistry 

Systems* 

L. Murphy, A. Considine, S. Frost, M. Coughlan, C. Moellers. Beckman 

Coulter Inc, Co, Clare, Ireland 

Background: High density lipoprotein-cholesterol (HDL-c) is an important predictor 

of cardiovascular risk. The current HDL-c reagent available on the Synchron systems 

contains a specific detergent and polyanion in the R1 reagent which binds to all 

non-HDL containing lipoproteins. The cholesterol in HDL particles in measured on 

addition of the R2. The objective of this study was to evaluate the performance of 

a next generation homogenous HDL-c reagent on UniCel DxC Systems. The new 

formulation is based on solubilising free cholesterol in non-HDL lipoproteins in the 

R1 phase, which is then consumed in a colourless reaction. HDL particles are then 

solubilised in the R2 phase to release HDL cholesterol for reaction with cholesterol 

esterase, cholesterol oxidase and the chromogen system. This next generation HDL-c 

reagent is already available in the US on the AU® analyser platforms. 


A273



Methods: Precision studies were carried out on a DxC 600 and DxC 800 over 20 days 

(N=80) following Clinical and Laboratory Standards Institute (formerly NCCLS) 

EP5-A2 procedure. Within run and total imprecision were evaluated using three serum 

pools with mean concentrations of around 30mg/dL, 54mg/dL and 118mg/dL. Method 

comparison was evaluated against the same assay on the Beckman Coulter AU680 

analyser and against the current Homogenous HDL assay on the DxC 800 analyser 

following CLSI EP09-A2 guideline. Interference studies were carried out on a DxC 

600 and DxC 800 following CLSI EP7-A2 dose response guidelines using pooled 

patient samples. Pools were spiked with either Bilirubin, Hemolysate, Ascorbate, 

Intralipid**, Gamma Globulin or Human Triglyceride. 

Results: In development studies within run precision was ≤ 1% CV and total 

imprecision was ≤ 2% CV, respectively. Method comparison (Deming regression) 

against the same assay on the Beckman Coulter AU680 (x-axis) yielded y=0.986x 

+1.191, r=0.998, n=119 and versus the existing Homogenous HDL on the DxC 800 

(x-axis) yielded y=0.917x +3.094, r=0.997, n=121. The effect of interference on the 

new assay was minimal with 0.05). 

Conclusion:Our findings have suggested that oxidative status increases in patients 

with coronary artery disease and antioxidant status increases as a compansatuary 

mechanism against this situation. The reason there was no significiant change in 

PON activity was due to stable lipid peroxide levels. The low Arylesterase activity 

is associated to HDL-Cholesterol levels. Also this study has demonstrated that 

arylesterase activity is decreased related to HDL and arylyesterase is more affected 

than paraoxonase activity in etiopatogenesis of coronary artery disease. In addition, 

this study has shown that there is no relation between coronary artery disease and 

PON1 Q/R phenotyping. 




B-345 

Association Of Serum Adipocyte Fatty Acid Binding Protein And 

Insulin Resistance In Egyptians Infected With Hepatitis C Virus 

S. H. Gomaa, A. M. Zaki, W. A. Refaaay. Medical Researh Institute, Alex, 

Egypt 

Background: Egypt has the highest prevalence of hepatitis C virus (HCV) infection 

in the world (13% of Egyptians in all age groups). Epidemiological studies have 

suggested that HCV infection is associated with an increased risk of development 

of insulin resistance (IR) and type 2 diabetes mellitus (DM). Adipocyte fatty acid 

binding protein (AFABP) is a low molecular weight protein expressed abundantly 

in the adipocytes and macrophages. It has been recognized to play an important role 

in the development of insulin resistance and metabolic syndrome. This study was 

conducted to investigate whether there is an association between AFABP and HCV 

infection or not, and if it is associated with insulin resistance in chronic hepatitis 

C(CHC) patients. 

Subjects: 80 male subjects were included in the present (as females were reported 

to have significantly higher serum levels than males).They were divided into 3 main 

groups: control group (n=15), DM group (n=15) and CHC group (n=50) divided as 13 

patients with no IR, 26 patients with IR and 11 patients with DM according to their 

Homeostasis Model for Assessment of insulin resistance (HOMA-IR). 

Methods: Fasting blood samples were obtained in plain tubes from all subjects. 

serum was immediately separated into four aliquots, one for the determination of the 

concentrations and activities of routine analytes including creatinine, urea, bilirubin 

(total and direct), total cholesterol, high density lipoprotein- cholesterol (HDL-C), 

low density lipoprotein- cholesterol (LDL-C) and triglycerides(TG) on the autoanalyzer 

OLYMPUS AU400. Non esterified fatty acids (NEFA) was determined by 

Dole’s method. Other aliquots were stored at – 20ºC for the assay of AFABP using 

ELIZA kit and insulin using chemiluminescent enzyme immunometric assay (CLIA) 

by the Immulite 1000 Automated Analyzer. HOMA-IR was calculated. Statistical 

analysis was done using the SPSS software package to obtain the median, the range 

and for comparison between the different groups involved in this study using Mann- 

Whitney test for abnormal distribution between two groups. 

Results: found to range from 9.2-19.0 ng/ml in normal male subjects.Serum AFABP 

levels in the CHC group with insulin resistance (with and without DM2) were 

significantly higher than that of the control group(p=˂0.001, p=

AUTHOR INDEX TO ABSTRACTS OF SCIENTIFIC POSTERS, AACC MEETING, 2013 

(Numbers refer to Poster Numbers; see pages A2 to A275) 

A 

Abbadi, A. A-544, A-545 

Abdalla, L. A-101, A-122, 

A-123, B-111 

Abdalla, L. B-118 

Abdel Hadi, A. B-223 

Abdella, N. A. A-309, A-338 

Abdou, S. A-89 

Abe, A. B-102 

Abel, G. A-225, A-538 

Abreu, D. A-419 

Abreu, F. A-67 

Abreu, F. Marques. A-148 

Acıkgoz, S. A-381 

Ackles, K. B-240 

Acosta-Delgado, D. A-348 

Adelberger, K. A-83 

Adeli, K. B-189, B-284, 

B-285, B-289, B-290 

Adie, L. A-19 

Afzal, Z. A-51, A-270 

Agıllı, M. B-07 

Aggarwal, S. A-371 

Aggoune, T. A-542 

Agmon-Levin, N. A-260 

Agostinelli, R. A-528 

Aguiar, F. A-333 

Ahmad, I. A-71, A-508 

Ahn, J. A-379 

Ahn, S. B-177 

Ahrens, M. A-05 

Ahuja, P. B-78 

Ajongwen, P. B-241 

Akahane, M. A-410 

Akbas, H. A-393 

Akbas, N. A-380 

Akbiyik, F. A-286 

Akinloye, O. A-339 

Akiyama, D. C. C. A-148 

Akl, P. A-99 

Aksoy, N. A-360 

Aksoy, S. N. B-344 

Al Mulla, F. A-338 

Al-Hertani, W. A-541 

Al-Turkmani, M. R. 

A-397, 

A-398 

Alamo, J. M. A-521 

Alastico, V. A-68, A-421 

Alatoum, M. A. A-02 

Albayrak, M. A-381 

Alcaide, M. J. B-260 

Alderton, W. A-10 

Alegre, E. A-66 

Alessio, M. B-287 

Alfieri, A. B-127 

Algeciras-Schimnich, A. A-43, 

A-380 

Allen, R. A-99 

Allen, T. 

A-479, A-501, 

A-502, A-503 

Allen Jr., R. B-233 

Allwood, M. B-189 

Almeida, E. V. A-427 

Almeida, I. A-68 

Almeida, I. C. A-421 

Almeida, L. B-39, B-143 

Almeida, S. S. A-268 

Alonzo, T. B-45 

Alp, B. F. B-07 

Alston, M. B-292 

Altemus, M. A-324 

Álvarez Menéndez, F. V. B-153 

Alvarez-Rios, A. I. A-94, 

A-313, A-348, A-514, 

A-521, B-43, B-57, B-313 

Alves, B. B-97 

Alves, N. B. B-96, B-149 

Alvi, A. J. A-248, A-272, A-275 

Amaral, M. B. A-190, A-192 

Amaral-Valentim, C. A. A-520 

Ambacher, R. A-397, A-398 

Amin, S. A-278 

Amole, F. A-435 

Amukele, T. A-367 

Andag, R. A-93 

Anderson, D. A. A-400 

Anderson, D. J. B-163 

Ando, T. A-340 

Andrade, L. E. A-404 

Andrade, L. E. C. A-422 

Andrade, M. M. P. A-355 

Andres, S. A. A-02 

Andrews, P. A. A-430 

Andriolo, A. B-310 

Anelli, M. A-47 

Angelos, P. A-183 

Antipova, O. B-234 

Anwar, F. B-123 

Aoyagi, K. A-340 

Apostolidou, S. A-10 

Apple, F. B-288 

Apple, F. S. B-182, B-194, 

B-207, B-208 

Apte, P. B-92 

Aqil, B. B-312 

Araújo, C. A. B-96 

Araújo, C. M. A-144, A-145 

Araujo, C. S. P. B-126 

Araújo, M. R. B. B-149 

Arboleda, V. E. A-291 

Arce Matute, F. A-74, A-124 

Archibald, I. B-47 

Arias-Stella, J. A-320, A-445 

Ariza, M. B-313 

Armbruster, D. B-289, B-290 

Armbruster, D. A. A-433 

Armbruster, F. A-293, 

Armstrong, P. 

B-185, B-306 

A-532, B-109, 

B-212, B-231 

Arpa, M. A-187, A-314 

Arslan, M. S. A-326 

Arzuhal, A. E. A-353 

Asencio, A. A-289 

Asirvatham, J. R. A-528 

Aslan, B. A-487, B-65 

Assi, L. K. A-231, A-232 

Assunção, L. G. de S. 

A-334, 

A-72 

Astion, M. L. B-11 

Aston-Abbott, L. W. A-276 

Attaelmannan, M. A-284, A-285 

Attar, N. A-378 

Auger, S. A-161, A-191, A-193 

Augusto, P. A. J. B-41 

Aulbach, A. D. B-05 

Avdoshina, S. B-234 

Averbuch, S. B-241 

Aw, T. B-211 

Aydın, F. Nuri. B-07 

Aydın, I. B-07 

Aydemir, B. A-381 

Ayinbuomwan, E. B-157 

Ayinbuomwan, S. B-157 

Azevedo, G. A-525 

Azevedo, R. B-310 

Azik, F. B-302 

B 

Babic, N. A-184, A-459 

Baburina, I. A-446, B-240, 

B-241 

Badciong, J. B-193 

Badciong, J. C. B-183, B-194 

Bagheri, M. B-83 

Bai, Y. A-241, A-263 

Bailén-García, M. A-376 

Bailey, B. A-294 

Bailey, D. B-284, B-289, B-290 

Baird, G. S. A-457 

Baker, W. A-12 

Baldo, D. C. A-422 

Balev, S. A-132 

Balherini, R. A-87 

Bali, D. B-72 

Balion, C. M. B-75 

Balko, J. B-162 

Balko, J. A. A-378 

Ball, G. A-429 

Balzer, S. A-93 

Ban, M. A-323, A-551, 

B-214, B-263 

Ban, R. W. B-343 

Bandeira, T. J. P. G. A-296, 

B-125, B-126 

Banerjee, S. A-102 

Baños, A. A-313 

Baoxiu, G. A-392 

Barakauskas, V. E. B-24 

Baral, N. A-337 

Barassi, A. A-154, A-473 

Barbi, R. C. M. A-552 

Barbosa, P. S. A-145 

Barclay, K. B-47 

Bardallo Cruzado, L. B-299 

Barden, S. A-294 

Bargeon, J. A-440 

Barinas-Mitchell, E. B-326 

Barlogie, B. A-258 

Barnes, G. A-11 

Barnes, J. A-10 

Barnidge, D. A-221 

Barnidge, D. R. A-163 

Barra, G. 

A-101, A-122, 

A-123, B-111, B-118 

Barrero, L. A-521 

Barron, J. A-535 

Barros, D. H. A-145 

Barta, T. A-112 

Bashir, T. A-29, B-123 

Basso, R. C. A-328 

Basu, S. A-19 

Batool, H. B-123 

Batruch, I. B-329 

Baugher, B. W. A-433 

Bauman, C. A-82 

Baumann, N. A. A-298, A-380, 

B-251, B-277, B-300 

Baumgaertner, J. B-71 

Baxter, C. B-47 

Bayachou, M. A-116, A-483 

Baycheva, V. A-499 

Baykan, H. A-187 

Baykan, O. A-187, A-314 

Beamon, C. B-308 

Beattie, J. A-481, B-220 

Beaulieu, D. B-116, B-138, 

B-139 

Beck, J. A-93 

Becker, F. A-85 

Becker, J. A-16 

Begcevic, I. B-153, B-329 

Beketova, E. V. B-06 

Belenky, A. B-84 

Belkheir, A. A-472 

Bellini, S. A-319 

Benchikh, M. E. A-441 

Bendet, I. B-119 

Benson, C. B-69 

Berenson, J. R. A-04 

Bereznikova, A. B-234 

Bergmeijer, T. O. B-76 

Berlanga, O. A-22 

Berlitz, F. A. A-512 

Berman, M. A-433 

Bermudo Guitarte, C. A-36, 

A-60, A-63, B-299 

Bertin, P. A-05 

Bertini, A. A-91 

Bertini, A. R. A-86 

Bevilacqua, V. B-284 

Bhandal, A. A-100 

Bhattacharya, C. A-368 

Bhuiyan, J. B-285 

Bi, C. A-558 

Bicalho, P. H. N. B-96, B-149 

Bickman, S. B-69 

Bierau, S. A-93 

Bilello, L. A-92, A-528 

Bin, W. A-392 

Binesh Marvasti, T. B-285 

Birkmeyer, K. B-170 

Birsan, A. A-161, A-191 

Bizon, P. B-56 

Bjornson, L. K. A-92, A-527, 

Blachon, G. 

A-528 

A-161, A-191, 

A-193 

Blair, H. A-52 

Blanchette, V. A-125, B-121 

Blasutig, I. M. A-345 

Blidner, R. B-54 

Block, D. R. A-298, A-380, 

B-242, B-251, B-277, B-300 

Bluestein, B. I. B-47, B-84 

Blunder, S. A-266 

Blyskal, B. A-233 

Boaretti, F. A-190, A-192 

Bock, J. H. B-03 

Bockhold, J. B-270 

Bodor, G. S. A-146 

Boise, L. A-484 

Boisen, M. B-54 

Bomberger, T. A-116 

Bonaca, M. P. B-175, B-178 

Bonilla, D. A-233 

Bonnefont-Rousselot, D. A-89 

Bonney, S. A-51, A-270 

Bookalam, S. B-252 

Bordash, F. R. A-522 

Bornhorst, J. A-258 

Borzacov, L. A-422 

Bose, T. A-116 

Botelho, J. A-332 

Botelho, J. C. A-279, A-351 

Botz, C. B-77 

Boudry, P. B-215 

Boulanger, J. A. B-333 

Bourque, I. A-125, B-116 

Bousso, A. B-143 

Boutin, M. B-121 

Bouvier-Borg, G. A-493 

Boyadzhyan, B. A-202 

276



Boyle, M. E. A-399 

Bracco, D. A-479, A-501, 

A-502, A-503, A-504 

Bradshaw, T. A. B-24 

Brady, J. B-193 

Braga, M. A-502, A-504 

Bragato, G. A-423 

Brana-Mulero, C. B-40 

Brandler, T. A-527 

Brandler, T. C. A-92 

Brar, S. S. B-74 

Braunwald, E. B-175 

Breaud, A. A-444 

Brennan, E. B-47 

Brito, F. A. A-239 

Brocco, G. A-536 

Brochu, V. A-125 

Brockbank, S. B-160 

Brotherton, D. A-399 

Brown, C. A-82 

Brown, L. A-177 

Brown, M. C. B-243 

Brown, P. I. A-468 

Brown, S. M. B-309 

Browne, M. B-151 

Buchner, C. A-407 

Bücker, D. H. B-117 

Budak, D. A-393 

Budd, C. A-243 

Budd, J. R. A-380 

Budd, R. A-243 

Buffone, G. B-312 

Bujold, E. A-138 

Bull, A. G. B-04 

Bulut, E. A-76 

Bunch, D. R. A-158, A-174, 

A-179 

Buno, A. B-260 

Buño Soto, A. B-195 

Burlingame, R. B-287 

Burmeister, A. A-232 

Burns, L. B-241 

Burrus, J. A-184 

Burssens, G. A-83 

Busby, B. A-448 

Butch, A. B-83 

Butler, E. C. A-38 

Byrne, D. B-240 

C 

Cabral, R. C. M. B-124 

Cagasan, L. B-293 

Cai, B. A-241, A-265, 

B-99, B-110 

Cai, J. A-311, B-323 

Caixeta, M. B-111, B-118 

Calero-Ruiz, M. A-376 

Callanan, H. B-316 

Callewaert, N. A-14 

Calton, L. A-458 

Calton, L. J. A-208, A-454 

Camara, J. E. B-269 

Camargo, J. M. A-422 

Cambern, S. J. B-242 

Cameron, A. B-170 

Camilleri, M. B-331 

Camilo, m. J. A-419 

Campagnoli, M. P. A-358, 

B-146, B-147 

Campana, P. G. B-56 

Campbell, J. A-51, A-270, 

A-532, B-109, B-212, B-231 

Campelo, M. D. R. A-520 

Campos, F. A-404 

Campos, L. M. A-267 

Campos, M. L. A-196, A-211, 

A-212 

Campos, M. L. de A-197 

Canales, M. B-195 

Cañavate Solano, C. A-74, 

A-124 

Cannon, C. P. B-175 

Cao, H. A-223 

Cao, Y. A-30 

Caparrós Cánovas, S. B-299 

Caputo, L. A-129, A-408 

Carayannopoulos, M. O. A-437 

Carbonell, L. B-264 

Carey, J. B-30 

Carle, A. A-555 

Carlisi, A. A-280, A-304, 

A-318, A-347 

Carlisle, H. A-431 

Carlisle, H. J. A-201 

Carlotto, G. B-38 

Carlow, D. C. B-294 

Carlson, L. B-308 

Carlson, T. H. A-542 

Carmona, M. A-521 

Carney, B. M. B-86 

Carr, K. A-165 

Carr-Smith, H. A-03, A-44 

Carr-Smith, H. D. 

A-20, 

A-253, A-273 

Carraher, D. B-01 

Carraro, P. A-423 

Carrillo-Vico, A. A-94 

Carrion, P. B-287 

Carroll, W. A-177 

Carter, K. A-550 

Caruso, N. A-481 

Caruso, N. B-220 

Carvalho, L. G. S. A-91, A-256, 

A-328, A-552, 

B-133, B-145 

Carvalho, N. M. B. A-267 

Casey, J. P. B-10 

Cassiano, D. M. A-196, 

A-211, A-212 

Castellani, W. A-399, B-288 

Castellani, W. J. B-182, B-194 

Castelo, M. G. A-296, B-125, 

B-126 

Castiglioni, M. A-154 

Castilho, A. A-419 

Castro Castro, M. J. B-339 

Catalona, W. J. A-05 

Cate, F. B-89 

Cavalcanti, R. A. A-87 

Cavalier, E. 

A-280, A-304, 

A-318, A-347 

Cavenagh, J. A-22 

Caxito, F. A. A-62 

Caxito, F. de A. B-140 

Caycı, T. B-07 

Ceabra, C. B-127 

Celi, F. S. A-307 

Çelik, H. T. A-372 

Cembrowski, G. B-239 

Cembrowski, G. S. A-531, 

B-17, B-210, B-332 

Cervera, J. B-68, B-280 

Cervinski, M. A. B-333 

Chae, S. B-98 

Chakraborty, S. A-368 

Chamba, A. A-51, A-270 

Chambers, E. A-471 

Chambers, R. B-243 

Champetier, S. B-116, B-138, 

B-139 

Chan, M. B-284, B-285, 

B-289, B-290 

Chan, P. A-254, B-176 

Chandler, D. W. A-170, 

A-305, A-329 

Chang, H. A-415 

Chang, J. B-70 

Chang, J. K. B-172 

Chang, K. C. N. B-259 

Chang, L. B-219 

Chang, P.-Y. B-21 

Chang, W. B-264 

Chang, Y.-T. B-21 

Charbonneau, A. B-121 

Chard, M. B-88 

Chau, B. T. H. B-129 

Chaudhary, N. G. A-343 

Che, Y. A-17 

Chebabo, A. B-112 

Chelsky, D. A-165 

Chen, C. B-168 

Chen, D. A-30, A-507 

Chen, H. A-04 

Chen, J. A-259, B-99, B-135 

Chen, L. A-97, A-259 

Chen, M. A-541 

Chen, Y. B-219 

Chen, Y. M. A-415 

Cheng, X. B-166 

Cherian, S. A-88 

Cherry, M. A-99 

Cheryk, L. A. A-152 

Chezick, P. A. A-482 

Chianca, C. A-101, A-122, 

A-123, B-111 

Chiba, H. A-186, B-318 

Chilingirian, A. A-173 

Chin, D. B-17 

Chindarkar, N. A-180 

Cho, D. A-530 

Cho, J. B-44 

Cho, S. A-510, B-101 

Choi, E. B-172 

Choi, H.-J. 

A-140, A-230, 

A-242, B-95 

Choi, J.-H. A-242 

Chong, M. A-295, B-85 

Chou, P. P. A-26 

Chowdhury, S. B-120 

Choy, J. B-210 

Christensen, P. B-01 

Christenson, R. H. 

A-229, 

B-196 

Christopher, J. B-219 

Chrusciak, T. F. A-256 

Chuang, R. A-97 

Chun, M.-R.R. A-366 

Chung, B. B-40 

Chung, C. B-70 

Chung, D. B-170 

Chung, J.-W. B-98 

Church, S. S. B-52 

Chusney, G. A-458 

Cicalese, L. A-27 

Cichonski, K. A-233 

Cigerli, S. A-420 

Cil, A. P. A-286 

Cintra, A. A-407 

Cintra, F. D. B-180 

Cintra, R. A-296 

Ciociola, F. A-154 

Citron, J. A-16 

Clark, L. B-220, B-235 

Clark, S. B-82 

Clarke, W. A-111, B-241 

Clarke, W. A. A-444 

Clemmensen, P. B-186 

Cline, D. B-276 

Clinton, S. A-21 

Clunie, I. A-469 

Cobacho, A. A-129, A-408 

Cobbold, M. A-51 

Cockwell, P. A-232 

Coeli, C. C. R. A-333 

Coffin, L. A-177 

Cohen, A. B-285, B-289, B-290 

Cohen, A. H. B-189 

Cohen, S. B-244 

Colangelo, J. A-176 

Colantonio, D. B-285, 

Colantonio, D. A. 

B-289, B-290 

A-474, 

B-189, B-284 

Cole, B. B-11 

Cole, D. E. C. A-110 

Coleman, J. A-480 

Coley, M. D. A-20, A-273 

Collinson, P. O. 

B-201, 

B-202, B-230 

Collymore, L. B-55 

Collymore, L. B-60 

Colón-Franco, J. B-89 

Colón-Franco, J. M. A-400 

Colpi, G. M. A-154 

Conde-Sánchez, M. B-307 

Connolly, S. A-537 

Conrad, M. B-219 

Conrad, M. J. B-175, B-178 

Considine, A. B-341 

Contestable, P. B-240, B-241 

Contois, J. H. B-321 

Cook, A. A-227 

Cormier, J. 

B-116, 

B-138, B-139 

Corsi, M. M. A-154 

Coşkun, F. A-372 

Cosman, M. A-320 

Costa, L. C. A-239 

Costa, S. A-101, A-122, 

A-123, B-111, B-118 

Costa, S. S. S. A-144, 

A-145, A-525 

Cote, L. A-199, A-200 

Cotta, C. V. A-181 

Cotten, S. W. A-460 

Cotzia, P. A-522 

Coughlan, M. B-341 

Countryman, S. A-141, A-143 

Courtney, J. B-240 

Courtney, J. B. A-446, B-241 

Cousineau, J. B-285 

Crews, B. O. B-50 

Crine, Y. A-280 

Cronin, C. A-546 

Crowley, J. A-258 

Cunha, I. A-269 

Curry, T. A-17 

Curtis, M. A-462 

Cury Neto, G. A-363 

Cusack, P. B-120 

Czerwensky, F. A-98 

D 

Dahlen, J. R. A-480 

277



Dahlen, J. R. B-74, B-76, B-80 

Dai, J. A-88, B-283 

Dainese, A. A-423 

Dallazuanna, H. S. A-363 

Daly, T. M. B-114 

Damele, C. A. L. A-473 

Damião, L. B-97 

Danaceau, J. A-471 

Das, K. B-51 

Das, S. B-198 

Dasgupta, A. A-433 

Datta, P. B-283 

Davis, A. A-555 

Davis, K. Wayne. A-244, B-171 

Davis-Fleischer, K. A-233 

Dayrit, G. B. A-416 

De Abreu, F. B. A-118, A-130 

de Aquino Daher, A. L. B-33 

de Lemos, J. A. B-87 

de los Rios, S. B-174 

De Martino, M. C. B-56 

Dean, K. B-47 

Debiève, F. A-346 

Deckers, C. A-200 

DeCorso, K. A-04 

DeFrance, A. A-90 

Deirmengian, C. B-170 

del Castillo Figueruelo, B. 

A-344 

Delanaye, P. A-304 

Delaney, S. R. B-189 

Delanghe, J. R. A-14 

Delatour, V. B-319 

Delibas, N. A-76, B-302 

Delibası, T. A-326, A-353 

Delijani, K. A-04 

Della Bartola, L. B-59 

Dellavance, A. A-404, A-422 

DelRosso, R. A-152 

Delvin, E. A-541, B-285 

DeMarco, M. L. B-309 

Dembowski, S. B-193 

Deniz Yildiz, Z. A-395 

Denardin, O. 

A-68, A-129, 

A-407, A-408, 

A-421, B-127, B-144 

Denardin, O. V. P. A-268, B-39, 

B-124, B-142 

Denner, L. A-27 

Dennis, A. A-550 

Depoix, C. A-346 

Destra, A. L. B-39 

Devaraj, S. B-55, B-60, B-312 

Devereaux, P. J. B-179 

Dhaliwal, S. K. A-275 

Dholariya, S. A-71 

Diamandis, A. B-329 

Diamandis, E. P. B-153, B-329 

Dias, C. A. G. A-197 

Dias, V. C. A-474 

Díaz, C. T. S. A-267 

Diaz, I. B-185 

Diaz, R. A-97 

Dickerson, J. A. A-448, B-11 

Diejomaoh, M. F. A-312 

Dierksen, J. E. A-433 

Dietzen, D. J. B-49, B-309 

Dima, F. A-536 

DiMagno, L. B-240, B-241 

Dineva, D. A-499 

Dionne, N. B-121 

Divakar, K. A-53 

Dixon, R. B. A-425, B-244 

Dlott, R. S. A-291 

Dockery, E. A. B-262 

Dogan, S. A-362 

Dogliotti, G. A-154 

Doherty, S. B-109 

Dohnal, J. A-151, B-227 

Dokus, B. J. A-131 

Dominguez, J. R. A-289 

Domínguez-Pascual, I. A-344, 

A-348 

Don-Wauchope, A. A-73, 

A-481, B-220 

Donate, J. A-373 

Donato, L. J. B-331 

Donayre Medina, P. C. A-560 

Dorion, P. A-486 

Dorizzi, R. M. A-319 

Doroudian, R. A-100 

Doseck, S. A-460 

Dot Bach, D. B-339 

Dowd, J. A-446 

Dowlin, M. B-312 

Dowty, D. A-233 

Doyle, R. A-199 

Doyle, R. M. 

A-166, A-167, 

A-168, A-195, 

A-198, A-217, A-219 

Dozio, E. A-154 

Drayson, M. A-51, A-270 

Drees, J. C. A-291 

Dschietzig, T. A-137, B-185 

Du, S. A-399, B-182, B-183, 

B-193, B-194, B-288 

Dudek, T. A-85 

Dueñas, J. L. B-296 

Dugourd, D. 

B-116, 

B-138, B-139 

Duitsman, K. A-288 

Dumitrascu, V. A-96 

Dunlop, A. J. A-469 

Dunn, C. A-538 

Dunn, J. A-164 

Dunn, S. A-99 

Dupont, W. B-89 

Dupont, W. D. A-400 

Dupret-Carruel, J. A-153 

Duran, M. M. B-156 

Düzgün, A. P. A-372 

E 

Eastwood, M. P. A-208, 

A-454, A-458 

Eckhardt, A. B-72 

Eckle, S. B-339 

Edwards, R. B-55 

Edwards, R. M. B-60 

Edwards, S. H. B-320 

Egea-Guerrero, J. B-161 

Egi, V. N. J. A-211 

Ehrich, M. B-293 

Eibl, J. A-246 

El Awamy, H. M. A-472 

El Gierari, E. M. A-189 

El Kouhen, R. B-193, B-194 

El Shanawani, F. M. A-33, 

A-375, A-424, B-223 

El-Khoury, J. M. A-158, A-172, 

A-174, A-175, 

A-467, A-544, A-545 

Elbireer, A. A-367 

Eleftheriades, M. B-305 

Elfahal, M. M. A-225, A-538 

Elferink, C. A-27 

Elfrady, M. A-472 

Elias, A. N. A-342 

Elshaari, F. A-472 

Enamorado-Enamorado, J. 

B-161 

Epner, P. B-11 

Epps, N. A. B-275 

Erbağcı, A. B-344 

Erbagci, A. B. A-360 

Erden, G. 

A-76, A-290, 

A-317, A-326, A-353 

Erden, G. A-372 

Erden, G. B-302 

Erdogan, S. A-326 

Eren N. A-395, A-420 

Erickson, J. A-97 

Erickson, J. A. B-113 

Erman, H. A-325, A-354, A-381 

Erturk, N. A-64 

Esgi, G. B-344 

Estelha, P. A-269 

Estey, M. B-285 

Estis, J. B-196, B-209, B-218 

Everds, N. B-05 

F 

Fabiani, F. A-247, B-296 

Faggian, D. A-423 

Faint, J. A-257 

Faint, J. M. A-232 

Faix, J. D. A-189 

Faiz, M. A-29, B-123 

Fan, R. A-283 

Fantz, C. R. A-364, B-11 

Farace, M. D. A-72, A-334 

Faro, L. B. 

B-39, B-41, 

B-48, B-142, B-143 

Farooq, S. A-508 

Farris, C. M. B-150 

Farris, J. A-332 

Fasano, A. A-240 

Fathoom, E. A-472 

Faulhaber, A. C. L. A-427 

Feduszczak, T. A-73 

Feeney, R. B-297 

Felberg, J. B-218 

Feldkamp, C. 

A-320, 

A-445, B-30 

Feliu, J. B-195 

Feltis, T. B-16 

Fenelus, M. A-92, A-527 

Feng, W. A-265 

Fereck, C. A-486 

Feres, M. C. B-56 

Ferguson, A. M. A-455, B-291 

Fernandes, F. A-404 

Fernandes, F. F. A-422 

Fernandes, O. 

A-148, A-296, 

A-330, A-355, A-358, A-363, 

B-33, B-41, B-112, B-119, 

B-125, B-126, B-143, B-147 

Fernandez, B. 

A-323, A-551, 

B-214, B-263 

Fernandez-Calle, P. B-260 

Ferraro, J. Y. A-86 

Ferraz, M. L. A-404 

Ferraz, M. L. C. G. A-422 

Ferreira, C. E. S. A-427 

Ferreira, G. A. A-239 

Ferreira, R. C. B-37 

Ferreira, S. B. A-87 

Ferros, M. A-04 

fFeres, M. C. B-180 

Fiedler, G. M. B-339 

Figueiredo, F. A-404 

Figueiredo, M. L. N. B-41, 

B-142 

Filatov, V. B-234 

Filimon, N. A-96 

Filimonova, D. M. B-06 

Filson, L. B-40 

Fine, G. B-20 

Fínek, J. A-543 

Finnegan, K. A-494 

Fischler, M. B-53 

Fisher, M. A-10 

Fitt, W. A-486 

Fitzgerald, R. A-180 

Fitzgerald, S. P. A-441, A-532, 

B-109, B-151, B-152, B-158, 

B-159, B-160, B-191, B-212 

Fitzgerald, S. P. B-231 

Flaherty, B. B-219 

Flanagan, J. A-234, A-257 

Flores Toledo, S. M. A-560 

Flumian, F. A-407 

Flynn, A. A-10 

Flynn, C. A-538 

Foertsch, S. A-15, B-261 

Fonfrede, M. A-89 

Fonsceca, C. R. B-124 

Fonseca, S. F. A-525 

Fontes, R. A-330, A-333 

Fontes, T. A-535 

Foote, R. S. B-188 

Ford, L. B-235 

Fordstrom, P. B-05 

Forest, J.-C. A-138, A-297 

Foster, M. T. B-333 

Fountain, K. A-471 

Fox, D. B-139 

Fox, L. B-241 

Frampton, G. A-100 

Franco, M. B-118 

Freeman, J. A-136 

Freire, M. 

A-67, A-330, 

A-333, B-145 

Freire, M. Di C. A-327, A-356 

Freire, M. D. C. A-328, B-146 

Frew, J. A-441 

Friesen, L. R. B-262 

Frost, S. B-341 

Fu, K. B-60 

Fu, L. A-110 

Fu, Y. B-99, B-135 

Fuda, H. A-186, B-318 

Fuezery, A. K. A-444 

Fujiki, M. A-11 

Fujiyoshi, A. B-326 

Fukuoka, S. B-104 

Fuller, L. C. B-275 

G 

Gabler, J. A-158, A-159 

Gaburo, N. A-67, A-68, A-129, 

A-407, A-408, A-419, 

A-421, A-553, B-127, 

B-141, B-143, B-144 

Gadisseur, R. A-318, A-347 

Gaedcke, J. A-93 

Gaeler, K. A-474 

Galarneau, H. A-125 

Galoro, C. A. O. A-86, A-268 

Galunska, B. A-132 

Galuska, S. B-259 

Galvani, K. A. B-182 

Gambhir, J. K. A-371 

278



Gan, C. A-175, B-304 

Gandhi, A. A-147, A-452 

Gandhi, G. A-71 

Gandufe, F. A-67, A-129, B-144 

Gao, L. A-30 

Garber, C. A-558 

Garby, D. M. A-152 

Garcia, C. A-196, A-197, 

A-211, A-212 

Garcia, H. A-72, A-334 

Garcia, M. Lopes. B-41, B-143 

Garcia De La Torre, A. A-74, 

A-124 

García de Veas Silva, J. A-36, 

A-60, A-63, B-299 

García Hernández, P. B-153 

Garcia-Garcia, F. J. A-94 

Garcia-Perez, J. A-373 

Garcia-Saborido, M. C. A-348 

Gardel, M. B-219 

Garg, U. A-455, B-291 

Garrison, K. A-451 

Gaston, S. A-380 

Gatcombe, M. A-332 

Gautam, S. A-337 

Gautherot, E. A-493 

Gavin, I. B-79 

Gaze, D. B-202, B-230 

Gaze, D. C. B-201 

Geacintov, C. E. A-85 

Gearhart, M. B-308 

Gelal, B. A-337 

Gelisgen, R. 

A-325, 

A-354, A-381 

Genta, V. M. B-52, B-276 

Gentry- Maharaj, A. A-10 

Gentzer, W. K. A-229 

Georganopoulou, D. A-05 

Gerin, F. A-187, A-314 

Gerova, D. A-132 

Geyer, R. A-83, B-256 

Ghadessi, M. 

A-323, A-551, 

B-214, B-263 

Ghilardi, F. A-473 

Gialouri, E. A-365 

Giampietro, O. B-59 

Giannoutsos, S. A-438 

Gibson, B. B-114 

Giesen, C. D. A-386, B-242 

Giguère, Y. A-138, A-297 

Gil, G.-C. A-165 

Gilburd, B. A-260 

Gilman, N. L. A-275 

Gilmanov, A. A-287 

Gimenez, M. B-127 

Ginis, Z. 

A-76, A-290, A-317, 

A-326, A-353, B-302 

Giovanelli, R. P. B-03, B-04 

Girouard, J. A-138 

Givens, M. B-69 

Glezakou, O. A-365 

Gloria, C. A-434 

Goba, A. B-54 

Gocheva, N. A-499 

Godefroy, C. A-493 

Godfraind, A. B-203 

Godfroy, J. B. B-90 

Godschalk, T. B-76 

Godwin, Z. B-270 

Goedert, E. B-48 

Goertz, D. B-325 

Goishi, K. A-340 

Gökcen, C. A-360 

Gokyigit, F. A-395 

Goldberg, B. J. A-228 

Goldberg, J. M. B-194 

Goldford, M. A-500 

Goldsmith, B. M. B-115 

Gollini, C. A-319 

Gomaa, S. H. A-117, B-345 

Gomes, F. S. A-520 

Gomes, M. O. B-125 

Gomez-Bravo, M. A. A-521 

Gomez-Rioja, R. B-260 

Gong, Q. A-391 

Gong, Y. B-252 

Gonzalez, A. A-66 

Gonzalez, C. A-518, B-296 

González Rodríguez, C. A-36, 

A-60, A-63, A-247, B-299 

Goodacre, S. B-230 

Goodall, M. A-51, A-270 

Goodenowe, D. A-206 

Gordillo-Escobar, E. B-161 

Gorsh, A. A-335 

Goto, M. B-102 

Gottlieb, S. S. B-196 

Goudy, K. A-06 

Gounden, V. 

A-75, 

A-173, A-307 

Graber, M. B-11 

Gradisse, J. A-239 

Graham, C. B-72 

Gramegna, M. A-47, B-250 

Grant, J. B-47 

Grasso, K. B-194 

Grasso, K. B. B-182 

Gratzl, M. B-78 

Graubner, D. B-52 

Graves, J. E. B-04 

Gray, A. V. B-222, B-322 

Greeley, N. B-66 

Green, D. M. A-131 

Green, G. B-240, B-241 

Greene, D. N. A-291 

Greeno, A. M. A-386 

Greenstein, M. B-264 

Greenway, D. B-285 

Greer, R. A-292 

Greer, R. W. A-316 

Greiber, D. B-276 

Grenache, D. G. 

A-21, 

B-113, B-247 

Grey, V. B-285 

Gribben, A. B-159 

Grieveson, R. E. A-277 

Grimmler, M. B-71 

Grogan, R. H. A-183 

Grondin, J. A-125 

Gronowski, A. M. B-50 

Groppa, S. A-148 

Gruson, D. 

A-346, 

B-177, B-203 

Gu, B. A-238 

Gu, J. A-173 

Guadix, P. B-296 

Gudaitis, D. A-147, A-452 

Gudaitis, P. A-147, A-452 

Guerrero, J. B-161 

Guerrero, J. M. A-94, A-313, 

A-348, A-514, A-521, 

B-43, B-57, B-307, B-313 

Guerrero-Montávez, J. M. 

A-344 

Guidi, G. A-520, A-536, A-554 

Guillot, M. B-121 

Guixing, L. A-392 

Gumpl, E. K. B-124 

Gun-Munro, J. B-65 

Gunasekera, B. A-483 

Gundogdu Celebi, L. A-395 

Guneyk, A. A-290, A-317 

Guntas Korkmaz, G. A-381 

Gupta, M. A-175 

Gupta, N. A-508 

Gupta, S. A-70, A-371, B-198 

Gurler, M. A-290 

Guru, S. A-71, A-508 

Gutierrez, D. A-112 

Gutierrez, M. B-12, B-29 

Gutiérrez-Romero, J. A-376 

Gutmann, E. J. A-131 

Guymon, R. B-292 

Gwosc, S. B-228 

Gyawali, P. B-237 

H 

Ha, J. A-108 

Ha, J.-S. A-109 

Ha, J. B-44 

Ha, S. B-101, B-101 

Hackeng, C. M. B-76 

Hackenmueller, S. A. A-432 

Haidacher, S. J. A-27 

Hainzinger, M. A-459 

Hajduk, T. A-288 

Haklar, G. A-187, A-314 

Haliassos, A. B-301, B-305 

Hamada, C. A-374 

Hamada, E. B-254, B-258 

Hamel, F. B-121 

Hammel, M. B-82 

Hammerstrom, T. B. B-24 

Hammett-Stabler, C. A. 

A-329, 

B-308 

Han, H. A-102 

Han, Q. B-217 

Han, S. B-70, B-172 

Han, Y. A-31 

Handa, S. A-19 

Haner, R. A-547 

Hanhoerster, L. M. 

A-214, 

A-220 

Hanley, M. M. B-242 

Hanlon, D. B-219 

Hannah, J. A-206 

Hansen, S. I. B-186 

Hanson, S. A-537 

Hansson, L.-O.A. B-164 

Hao, C. A-210 

Haolan, S. A-392 

Harding, S. A-258 

Harding, S. J. A-03, A-19, A-20, 

A-22, A-44, A-231, 

A-232, A-248, A-249, 

A-250, A-251, A-252, 

A-253, A-272, A-273, A-274, 

A-275, A-276, A-277, A-278 

Harley, E. A-243 

Harley, J. A-243 

Harris, K. M. B-196 

Harris, K. T. A-556 

Harrison, H. H. A-486 

Harvey, R. A-484 

Hasan, M. M. 

A-33, 

A-375, A-424 

Hashim, I. A. B-34, B-87, B-162 

Hashimoto, T. B-184, B-206 

Hassiakos, D. B-305 

Hatakeyama, Y. A-58 

Hatanaka, N. B-257 

Hathiramani, S. S. B-34 

Hausmann, M. A-153 

Havelka, A. M. B-164 

Hawk, A. B. A-131 

Hawkins, D. A-479, A-504 

Hayashi, F. A-410 

Hayashi, S. B-102 

Hayden, J. A. A-457 

He, H. A-321 

He, K. A-11 

He, Y. A-391 

Healey, J. R. A-548 

Heaney, J. A-51 

Heaphy, B. B-221 

Heideloff, C. A-171 

Heimann, J. B-97 

Heine, C. E. A-435 

Hektor, T. B-71 

Hellmich, R. A-85 

Helmer, G. A-100 

Henderson, I. A-540 

Henderson, M. P. B-252 

Henderson, M. P. A. 

A-549, 

B-67 

Hennecke, S. A-93 

Herberholz, E. B-30 

Herkert, M. A-85 

Herman, J. H. A-302 

Hernandez, J. B-26 

Herold, M. A-246, A-266 

Herrera-Rey, M. T. A-344 

Herrera-Rey, T. A-348 

Herzog, D. A-518 

Heuillet, M. B-319 

Hickman, P. E. B-190 

Hidaka, Y. A-410 

Higgins, J. M. A-485 

Higgins, T. A-537 

Higgins, T. N. B-332 

Hill, J. A-218, B-267 

Hill, S. B-179 

Hill, T. B-55, B-60 

Hinojosa, R. A-521 

Hirano, K. A-491 

Hirany, S. B-34, B-162 

Hirao, Y. B-340 

Hirbawi, J. A-506, B-154 

Hisahara, T. A-58 

Hoag, G. A-429 

Hoag, G. N. B-278 

Hoang, C. A-539, B-336 

Hocher, B. A-293, B-306 

Hodkinson, C. A-10 

Hoebeke, P. A-14 

Hoering, A. A-258 

Hoffman, B. R. A-345, B-64 

Hoffman, R. M. B-217 

Hoffmann, J. B-339 

Hofmann, M. B-185 

Hoke, C. A-291 

Holert, F. B-136, B-238 

Hollen, T. A-28 

Holmquist, B. A-170, A-305 

Holt, R. A-518 

Hong, J. A-28 

Honorio, L. B-112 

Hoofnagle, A. B-330 

Hoofnagle, A. N. A-457 

Horii, T. A-77, A-374, B-246 

Horne, B. D. B-233, B-275 

Hornstein, G. A-494 

Horton, K. A-502 

Hotte, S. A-48 

Householder, J. B-14 

279



Houston, J. B-105 

Howell, E. B-270 

Hrynkow, J. A-291 

Hsi, E. D. A-181 

Hualan, H. A-392 

Huang, H. A-321 

Huang, J. A-399, B-182 

Huang, K. A-291 

Huang, L. A-28, A-238 

Huang, P. A-31 

Huang, Y.-F. A-222 

Huang, Y.-C. A-222 

Hughes, R. A-03, A-44 

Hughes, R. G. A-231 

Huh, H. B-98 

Hui, S. P. A-186, B-318 

Hull, M. E. A-38 

Hutchinson, E. B-88 

Hutson, A. A-16 

Hyland, J. A-172 

Hynan, L. S. A-378 

I 

Iancu, D. M. A-16 

Iannaccaro, R. A-505 

Idei, M. A-374 

Idogun, S. E. B-157 

Ignjatovic, S. A-331 

Illarionova, V. K. B-06 

Inaba, C. B-254 

Inoue, H. B-337 

Inoue, N. A-410 

Io, H. A-374 

Ionemoto, H. B-143 

Irhibhogbe, P. E. B-157 

Irie, T. B-317 

Irikura, M. B-317 

Isenberg, D. A-231 

Ishfaq, M. A-29 

Ishige, T. A-34, A-46 

Ishii, J. B-184, B-206 

Ishii, K. A-77, A-374, B-246 

Ishii, S. A-389 

Ishikawa, T. B-184, B-206 

Ishitsuka, Y. B-317 

Ito, Y. B-167, B-173, B-340 

Itoga, S. A-09, A-34, A-46 

Iturzaeta, J. M. B-260 

Ivanova, I. A-132 

Iversen, K. B-186 

Ives, J. B-69 

Iwahara, K. B-254 

Iwatani, Y. A-410 

J 

Jack, R. M. A-448 

Jackson, R. M. B-277 

Jackson, S. B-240, B-241 

Jackson, T. K. A-430 

Jacob, A. A-19 

Jacob, C. B-310 

Jacobs, I. A-10 

Jacobson, R. A-88 

Jacomo, R. H. A-525 

Jaffe, A. S. 

A-507, 

B-179,B-222, 

B-316, B-322, B-331 

Jambor, L. G. A-202, A-203 

Jamtsho, R. B-18 

Jang, M.-J. A-242, A-530 

Jang, S. A-103 

Jannetto, P. J. B-242, B-277 

Jaques, L. L. A-87 

Jara Aguirre, J. C. A-560 

Jarolim, P. 

B-175, 

B-178, B-219 

Jarrari, A. M. A-472 

Jarvis, M. A-80, A-205, A-281 

Jarvis, M. J. Y. A-193, A-324 

Javid, J. A-71, A-508 

Jean, V. B-116, B-138, B-139 

Jeansson, S. B-137 

Jefferies, R. A-51, A-270 

Jekarl, D. B-70 

Jenkins, J. C. A-460 

Jenkins, S. M. A-386 

Jensen, T. J. B-293 

Jeon, D. A-108 

Jeon, D.-S. A-109 

Jeon, Y. A-510 

Jeong, J.-S. A-155 

Jeong, J. A-379 

Jesson, M. B-01 

Jia, J. A-477 

Jia, Y. A-496, A-498, A-515 

Jiang, H. A-477, A-496, A-498, 

A-515 

Jiang, Y. A-206, A-238 

Jin, C. B-84, B-94 

Jin, M. B-40 

Jin, S. A-186, B-318 

Jin, W. A-206, A-324 

Jo, M. B-204 

Joaquim, T. R. B-243 

Joe, G. B-101 

Jogiraju, H. B-163 

Johansson, C. B. B-164 

Johnson, H. A-252 

Johnson, S. R. B-45, B-58 

Johnson-Davis, K. L. A-191, 

A-468, B-24 

Johnston, H. B-231 

Jolliffe, C. A-210 

Jolly, B. B-155 

Jones, A. B-54 

Jones, J. A-486 

Jordan, N. B-105 

Jorgensen, M. B. B-103 

Jortani, H. A. A-436 

Jortani, S. A-470 

Jortani, S. A. A-436 

Jovicic, S. A-331 

Ju, H. A-27 

Juarez-Falgoust, P. A-38 

Juenke, J. M. A-468 

Jun, H. A-392 

Jung, B. B-285 

Junior, M. A. P. B-33 

Junior, N. L. R. A-256, B-133 

Juvent, V. B-215 

K 

Kırma, C. A-420 

Kadiric, E. B-121 

Kalafatis, M. A-506, B-154 

Kalbfleisch, T. S. A-02 

Kaleta, E. A-335, B-26 

Kallmes, D. F. A-377 

Kallner, A. A-78, A-561 

Kalra, B. A-349, A-350, B-09 

Kalra, O. A-371 

Kamada, M. A-58 

Kamihara, K. B-257 

Kampfrath, T. A-06, A-81, 

A-436, A-470 

Kanaly, A. A-99 

Kaneko, C. A-237 

Kaneva, R. A-499 

Kang, S.-H. A-103 

Kano, M. B-167 

Kantartzis, A. A-111 

Kanzow, P. A-93 

Kaplan, E. L. A-183 

Kaptein, J. S. A-228 

Kapur, B. M. A-456 

Kara, A. A-64, B-234 

Kara, A. N. B-06, B-192 

Karampas, G. B-305 

Karaszi, E. A-225 

Karayagmurlu, A. A-360 

Kardos, K. B-170 

Karon, B. B-77 

Karon, B. S. 

A-507, B-49, 

B-222, B-277 

Karpievitch, Y. A-165 

Karr, B. A-534, A-546 

Karras, R. A-221 

Karras, R. M. A-163 

Karrison, T. B-188 

Karunamurthy, A. A-438 

Karydi, A. B-213 

Kasuga, K. A-77 

Kataoka, H. A-58 

Katayama, Y. B-317 

Katrukha, A. B-234 

Katrukha, A. G. B-06, B-192 

Kattar, M. M. B-239 

Katzmann, J. A-221 

Kaufman, J. A-484 

Kaur, A. A-249, A-277 

Kausar, S. A-251, A-272 

Kavsak, P. 

A-48, A-402, 

B-179, B-220, B-235 

Kayahara, N. B-317 

Kazarian, G. B-170 

Kazmierczak, D. E. B-221 

Kazmierczak, S. C. B-221 

Keczem, L. E. A-548 

Kee, S.-J. 

A-230, A-242, 

A-530, B-95 

Keim, R. A-547 

Kellermann, G. B-94 

Kellermann, M. B-94 

Kellogg, M. D. A-164 

Kelly, K. B-83 

Kelly, M. F. B-158 

Kelly, W. B-30 

Kelsey, D. E. B-333 

Kempe, M. B-336 

Kenwell, K. B-152 

Kern, D. W. A-160 

Kerrigan, J. B-190 

Keter, D. B-243 

Kettlety, T. A-11 

Keutmann, S. A-561 

Khachatryan, S. A-284, A-285 

Khajuria, A. A-257, B-02 

Khan, N. A-517, A-519 

Khanal, M. P. B-237 

Kharitonov, A. V. B-192 

Khartabil, T. A-479 

Khoury, R. A-147, A-452 

Khupusup, K. B-15 

Kieffer, T. W. B-63 

Kiehl, B. B-137, B-150 

Kiernan, U. A. A-178 

Kil, M. B-101 

Killeen, A. A. B-273 

Killingsworth, L. B-325 

Kilmartin, P. B-170 

Kilpatrick, E. L. B-169 

Kim, C. B-84 

Kim, D. B-47 

Kim, D. K. A-366 

Kim, E. B-101 

Kim, H.-S. A-108, A-109 

Kim, H. B-44 

Kim, J. A-108 

Kim, J.-R. A-109 

Kim, J. B-44, B-84 

Kim, K. A-379 

Kim, M. A-379, A-510 

Kim, S.-K. A-155 

Kim, S.-H. A-155, A-530 

Kim, S. B-101 

Kim, S.-Y. B-204 

Kim, Y. B-70, B-204 

Kimmich, D. A-486 

Kimura, S. C. B-104 

Kimura, T. B-317 

King, C. A-542 

King, L. A-539 

Kingston, D. B-73 

Kitagawa, F. B-184, B-206 

Kitajima, I. 

A-491, B-102, 

B-205, B-337 

Kitamura, Y. A-340 

Kitpoka, P. B-15 

Kittanakom, S. A-73, B-75 

Kitto, A. A-04 

Kiyota, R. B. A-135 

Kiziler, A. A-381 

Klee, G. G. A-380 

Klimenko, A. B-234 

Kloke, K. M. A-482 

Klotz, W. A-246, A-266 

Knouse, W. A-547 

Ko, K. A-107 

Koch, C. D. A-507, B-49 

Koch, C. K. B-222 

Koch, D. D. A-315 

Koch, P. B-53 

Kochhar, D. A-494 

Koerbin, G. B-190 

Kolla, S. D. A-472 

Kollmar, O. A-93 

Konev, A. A. B-192 

Konforte, D. B-289 

Kong, L. A-53, A-69, A-70 

Koniari, K. A-365 

Konko, K. A-11 

Kopelman, R. A-17 

Kopnitsky, M. J. A-233 

Korbo, J. A-82 

Korpi-Steiner, N. A-559 

Korpi-Steiner, N. L. A-329 

Korzun, W. J. A-378 

Kosanam, H. B-153 

Kosewick, J. A-157 

Kotani, K. B-327, B-328 

Kotzev, I. A-132 

Koursopoulou, M. A-365 

Kozak, M. A-169 

Kozlovsky, S. V. B-06, B-192 

Kozo, D. B-240, B-241 

Krantz, D. S. B-196 

Krastins, B. A-178, A-183 

Kremitske, D. A-486 

Kroll, M. H. A-558 

Ku, C. B-84 

Kuchipudi, L. A-559 

Kuchipudi, L. S. B-19 

Kühbauch, M. B-76 

280



Kuhbauche, R. A-408 

Kuhn, D. A-261 

Kul, S. B-344 

Kumar, A. 

A-284, A-285, 

A-349, A-350, B-09 

Kunakorn, M. B-15 

Kuno, A. B-184, B-206 

Kunst, A. B-17 

Kuo, S.-F. B-106 

Kuramura, E. B-257 

Kuriki, K. H. A-212 

Kurt, N. A-64 

Kuru Pekcan, M. A-286 

Kushnir, M. M. A-292, A-316 

Kuth, R. A-15, B-261 

Kutscher, P. B-162 

Kuus, K. A-261 

Kuwata, H. B-317 

Kwon, H. B-204 

Kwon, M.-J. A-107 

Kyriakopoulou, L. A-345, 

B-289, B-290 

Kyriakopoulou, L. G. A-207 

L 

La, M. A-531 

La Motta, M. A-47 

La’ulu, S. L. A-244, A-271, 

A-292, A-316, B-171 

Labarbera, J. A-486 

Labay, L. A-533 

Labes, E. G. B-33 

Labourdette, R. A-125, B-116 

Lackner, K. B-216 

Lacoursiere, J. A-161, A-191 

Ladwig, P. A-221 

Ladwig, P. M. A-163 

Lai, P.-W. B-193 

Lakos, G. A-240, A-407, B-287 

Lalere, B. B-319 

Lama, R. A-35, B-148 

LaMarr, W. A-447 

Lamont, J. V. B-152 

Lamsal, M. A-337 

Landmark, J. D. A-302, A-464 

Lane, W. J. A-364 

Langston, A. A-484 

Lapointe, S. A-125 

Laposata, M. B-11 

LaRock, K. B-86 

Larouche, P.-L. B-116, 

B-138, B-139 

Latawiec, A. A-194 

Lauf, C. A-85 

Lavoie, S. B. A-138 

Law, T. A-164 

Lawson, S. E. A-467 

Layden, J. B-336 

Layne, J. A-141 

Lazo, E. A-435 

Le Goff, C. A-280 

Leamon, J. H. B-248 

Lebeau, L. B-215 

Leblang, A. A-53 

Lechner, J. M. B-51 

Leclerc, B. 

B-116, 

Ledgerwood, C. 

B-138, B-139 

B-151, B-152, 

B-158, B-160 

Ledue, T. B. A-229 

Lee, B. B-84 

Lee, B. Y. B-90 

Lee, C. B-70, B-172 

Lee, C. C. A-160, A-183 

Lee, H.-S. A-155 

Lee, H. A-510, B-204 

Lee, H.-K.K. A-430 

Lee, J. A-108 

Lee, J.-H. A-109, B-204 

Lee, M. A-173, A-233, A-510 

Lee, O. A-230, A-242, B-95 

Lee, S. B-70, B-172 

Lee, S.-Y. A-140, B-95 

Lee, S.-Y.Y. A-366 

Lee, W. A-108 

Lee, W.-M. A-109, A-378 

Lee, Y.-M. A-155 

Lee, Y. B-84 

Lefferts, J. A. A-130, A-131 

Lehman, C. M. B-24 

Lehmann, C. B-256 

Leite, T. T. B-126 

Leiva-Salinas, C. 

A-289, 

B-12, B-29 

Lemaitre, R. B-330 

Lembright, K. A-171 

Lembright, K. E. A-467 

Lenichek, P. B-214, B-263 

Lennartz, L. B-215, B-216 

León-García, C. B-307 

León-Justel, A. 

A-521, 

B-43, B-161 

Leonard, K. A-294 

Leonard, K. S. A-440 

Lepoutre, T. B-177, B-203 

Létourneau, S. A-125 

Leucht, S. A-98 

Leung, E. K. A-160, A-183, 

A-184, A-434, B-188 

Levine, M. A. B-294 

Levine, R. A-517, A-519 

Levine, R. A. B-103 

Levine, S. A-519 

Lewis, S. A-102 

Li, B. B-148 

Li, D. A-442 

Li, G. A-388, A-556 

Li, H. A-254, A-548 

Li, J. 

A-04, A-37, 

A-496, A-515 

Li, L. B-99 

Li, M. A-04 

Li, Q. A-31 

Li, S. A-37, A-69, A-106, 

A-141, A-143, B-100, B-217 

Li, W. A-223, A-265 

Li, X. A-97 

Li, Y. 

A-28, A-263, A-465, 

B-110, B-135, B-168 

Li, Z.-Q. A-11 

Liao, Y. A-465, B-110, B-135 

Libanori, G. B-56 

Liberal, V. B-174 

Lieske, J. C. 

A-386, 

B-242, B-322 

Lillo, R. B-12, B-29 

Lim, S.-J. A-140 

Lim, S.-W.W. A-366 

Lima, C. A. B-149 

Lima-Oliveira, G. 

A-520, 

A-536, A-554 

Lin, C.-N. A-222 

Lin, C.-K.E. A-228 

Lin, H. A-38 

Lin, H.-H. A-61 

Lin, H.-C. B-106 

Lin, J.-S. B-106 

Lin, K. A-141 

Lin, L. A-495 

Linder, J. A-479, A-501, 

A-502, A-503, A-504 

Linder, M. A-06 

Lindpaintner, K. B-243 

Lipke, B. H. A-38 

Lipowsky, C. A. B-193 

Lippé, C. B-116, B-138, B-139 

Lippi, G. A-520, A-536, A-554 

Lisnevskaia, L. A-231 

Lison, P. A-346 

Litt, S. A-400, B-89 

Litten, J. B-14 

Little, B. A-102 

Little, R. A-537 

Liu, A. B-292 

Liu, J. B-168 

Liu, L. A-299, A-438, B-293 

Liu, T. A-97 

Liu, W. A-206 

Liu, X. A-131 

Lo, K. A-492 

Lo, R. W. A-416 

Lobner, A. B-02 

Lobo, A. P. T. A-190, A-192 

Lochhead, M. B-69 

Lock, E. A-227 

Lockyer, M. G. B-60 

Loehr, B. B-339 

Logan, C. B-69 

Loitsch, S. M. A-137 

Lokinendi, R. V. A-559 

Longo, G. A-47 

Longo, N. B-292 

Lonial, S. A-484 

Lopatka, M. A-486 

Lopes, A. B-143 

Lopes, A. T. Q. A-525 

Lopez, M. A-178 

Lopez, M. F. A-183 

López Fernandez, T. B-195 

Lopez Garrigos, M. A-289, 

B-12, B-29 

Lopez-Ferrer, D. A-165 

López-Pelayo, I. A-376 

López-Penabad, L. A-289 

Lopez-Romero, J. L. A-521 

López-Sendon, J. B-195 

Lorey, F. A-100 

Lorey, T. S. A-291 

Lott, R. B-216 

Lotz, J. B-216 

Lou, A. A-177 

Lowbeer, C. A-359 

Lowry, P. 

A-441, B-159, 

B-160, B-191 

Lu, J. A-21, A-283, B-247 

Lu, J.-J. A-222 

Lu, V. B-293 

Lu, X. 

A-13, A-106, 

A-495, B-100 

Lucas, F. A-534, A-546 

Lucini, R. A-47 

Lucio, J. A-90 

Ludovico, G. A-91 

Lueke, A. J. B-222, B-331 

Lugo, J. A-289, B-12, B-29 

Lukacin, R. A-476 

Lukas, P. 

A-280, A-304, 

A-318, A-347 

Lumanga, S. V. A-416 

Lumen, N. A-14 

Lundell, G. D. A-446 

Lundquist, S. B-266 

Lunts, P. B-47 

Luo, L. A-176, A-241, 

A-265, B-135 

Luo, W. A-311, B-323 

Luo, Z. A-259 

Luzzi, V. A-229 

Luzzi, V. I. A-320, A-445, B-30 

Lv, R. B-100 

Lv, W. A-28 

Lykissa, E. D. A-450 

Lynch, B. A-16 

Lynch, K. L. A-461 

Lynch, M. P. A-41 

Lyon, M. E. B-272 

M 

Ma, J. A-30 

Macedo, P. A-553, B-141 

Macher, H. C. A-94, B-307 

Machida, T. B-340 

Maciel, J. A. D. A-91 

Macit, E. B-07 

Macwhannell, A. A-19 

Madanahally Divakar, K. A-69, 

A-70 

Maekawa, M. B-254, B-258 

Magari, R. A-492 

Magera, M. J. A-482 

Mahler, M. A-247 

Maine, G. A-294 

Mainenti, L. A-536 

Majhi, S. A-337 

Majkic-Singh, N. A-331 

Makris, K. 

A-365, 

B-152, B-301 

Malaman, S. A. B-41 

Malla, B. B-237 

Mallory, B. B-235 

Malta, F. S. B-140 

Malta, F. S. V. A-62 

Maluf, N. Z. 

A-87, 

A-197, A-269 

Mancini, J. A. A-38 

Maneemaroj, R. B-81 

Mangueira, C. L. P. A-126 

Manicke, N. E. A-189 

Mansouri, S. B-68, B-280 

Mansur, D. R. B. A-87 

Mantovani, M. F. A-256, A-356, 

B-133, B-145 

Mao, G. A-556 

Marani, R. A-212 

Marani, R. J. 

A-196, 

A-211, B-38 

Marassi, A. E. A-363 

Marcori, M. A-536 

Maries, O. R. A-224, A-245 

Markley, D. A-288 

Marotti, J. D. A-131 

Martín-Algarra, S. A-66 

Martinette, R. B-275 

Martínez-Broca, M. A. B-307 

Martinez-Couselo, S. B-53 

Martínez-Morillo, E. 

B-153, 

B-329 

Martins, G. R. A-144 

Martins, T. A-255, A-260 

Martins, V. B-112 

Martis, P. A-240, B-287 

Marton, M. J. B-259 

Marzinke, M. A. A-111 

Mason, D. A-471 

281



Masroor, M. A-71, A-508 

Massambu, C. B-20 

Massé, J. A-138, A-297 

Matějka, V. M. A-543 

Mateta, P. B-20 

Mathieu, R. A-215, B-325 

Matlin, H. L. A-308 

Matsui, S. B-184, B-206 

Matsuo, S. B-257 

Matsushita, K. A-09, A-34, A-46 

Matte, S. B-121 

Matters, D. J. 

A-20, A-250, 

A-253, A-273 

Matteucci, E. B-59 

Matthias, T. A-255, A-260 

Matyus, S. B-255 

Matzas, M. A-15, B-261 

Maymó, J. B-296 

Mbeunkui, F. A-425, B-244 

McCann, K. 

A-199, 

A-200, A-216 

McClintock, M. K. A-160 

McClintock, P. A-441, B-191 

McCloskey, L. J. A-302, A-303, 

A-308, A-439, 

A-464, A-522, B-10 

McClure, E. A-193 

McClure, K. B-20 

McConnell, R. I. A-441, 

B-151, B-152, B-158, 

B-159, B-160, B-191 

McCormick, B. M. A-38 

McCudden, C. R. A-549, B-252 

McDonald, J. S. A-377 

McDonald, R. J. A-377 

McEntree, D. G. A-273 

McGarrigle, M. B-325 

McGivern, P. B-212, B-231 

McIntyre, D. A-216 

McKeever, C. B-152 

McMillin, G. A. A-431 

McPhaul, M. J. B-34 

Meade, T. J. A-05 

Medrano-Campillo, P. A-94 

Meeusen, J. W. 

A-221, 

B-277, B-300 

Mehndiratta, M. A-371 

Meier, D. T. A-298, B-251 

Meikle, A. W. A-292 

Melanson, S. E. A-364 

Melguizo-Madrid, E. A-247 

Melito, S. A-437 

Mellado, P. A-521 

Mello-Fujita, L. B-180 

Melo, P. B-48 

Melzi d’Eril, G. A-154, A-473 

Ménard, C. 

B-116, 

B-138, B-139 

Mendez, M. A-373 

Mendonça, S. A-68, A-421 

Mendonça, S. A. A-148 

Menéndez Valladares, P. B-299 

Menezes, M. dos S. A-87 

Meng, Q. B-285 

Menon, U. A-10 

Mercier, K. A-411 

Merrigan, S. A-139 

Merx, S. A-233 

Meyer, R. B-219 

Meyer zum Büschenfelde, D. 

A-394 

Mgaya, V. Y. B-20 

Miida, T. A-77, A-374 

Milhorn, D. M. A-329 

Millar, E. B-220, B-235 

Miller, G. B-47 

Miller, J. A-81, B-166 

Miller, J. J. A-529, A-559 

Miller, M. B-200 

Miller, R. S. A-507 

Miller, V. A-447 

Millington, D. B-72 

Millner, L. A-06 

Mimura, T. B-257 

Minakawa, Y. B-173 

Minami, H. B-102 

Minnehan, K. B-219 

Miolo, M. A-423 

Mion, M. M. A-423, B-213 

Mir, A. A-71 

Mir, R. A-508 

Misch, C. A. B-295 

Mitchell, A. A-258 

Mitsis, P. A-517, A-519 

Miura, K. B-326 

Miyake, K. A-374 

Miyauchi, K. B-317 

Miyazaki, R. B-318 

Mizue, H. B-173 

Mochizuki, A. A-206 

Möckel, M. 

A-394, B-136, 

B-228, B-238 

Moellers, C. B-341 

Moffat, K. A-487 

Moiana, A. B-250 

Mojiminiyi, O. A. 

A-309, 

A-312, A-338 

Mokhtar, M. M. A-117 

Moley, K. H. B-50 

Molina, M. A-87 

Molina, M. A-552 

Molinaro, R. A-387, A-559 

Molinaro, R. J. 

A-302, 

A-303, A-364 

Molinero, P. A-94 

Monaghan, P. J. A-454 

Mondéjar-García, R. A-247 

Monica, F. A-553 

Montagnana, M. A-554 

Monteiro, J. 

A-190, 

A-192, B-124 

Montenegro, R. M. A-296 

Montenegro Jr, R. M. 

A-296, 

B-125 

Moon, B. A-449 

Moon, D.-S. A-103 

Moore, D. A-540 

Moore, F. B-02 

Moore, S. B-288 

Moore, W. A-99 

Mora, C. A-373 

Moran, T. B-67 

Morasse, S. B-138 

Moreau, E. A-153 

Moreno, P. A-399 

Moreno Garcia, M. I. A-74 

Mörer, O. A-93 

Morgan, D. A-547 

Mori, M. A-305, B-102 

Morrow, D. A. B-175, B-178 

Morse, R. B-297 

Moshin, J. A-205 

Mota, G. S. A-145 

Moura, B. Silva. A-72 

Moura, B. S. A-334 

Moutinho, L. A-72, A-334 

Mp, G. B-198 

Mu, X. B-42 

Muhariamova, K. B-234 

Müller, C. A-394, B-136 

Müller, J. B-339 

Muller, K. G. A-512 

Muller, R. B-174 

Muñiz, N. B-343 

Murakami, M. B-340 

Murakami, M. M. B-207, B-208 

Murillo-Cabezas, F. B-161 

Muros, M. A-373 

Murphy, F. 

A-250, A-251, 

A-252, A-274, 

A-276, A-278 

Murphy, L. B-341 

Murphy, S. A. B-175, B-178 

Murray, D. A-221 

Murray, D. L. A-163 

Murray, R. B-276 

Muser, J. B-53 

Musngi, S. A-323, B-214 

Musselman, B. A-462 

Mustafa, G. M. A-27 

Muto, N. H. A-126 

Mwasekaga, M. B-20 

N 

Na, M. A-506 

Naegelen, J. A-493 

Nagtalon, D. A-216 

Nair, H. B-330 

Nakajima, K. B-340 

Nakama, E. B-104 

Nakatsu, K. A-146 

Nam, H. B-44 

Napoleone, M. B-220 

Napolitano, C. A-480 

Naruse, H. B-184, B-206 

Narváez-García, C. A-344 

Naschberger, H. A-266 

Nassar, B. A-177 

Nauck, M. A-561 

Nault, D. K. A-38 

Naumann, E. B-339 

Navarro, J. A-373 

Navarro-González, E. B-307 

Naves, L. A. A-144, A-145 

Nedelkov, D. A-178 

Nelson, S. E. B-208 

Nelson, W. D. B-265, B-266 

Nene, S. A-216 

Neo, E. A-216 

Nepal, A. A-337 

Nery, L. F. A. 

A-144, 

A-145, A-525 

Neto, E. L. A-422 

Neto, G. C. A-328 

Neves, F. M. D. B-96 

Neves, S. P. F. A-239 

Ng, V. L. B-108 

Nguyen, B. A-165 

Nguyen, R.-A. B-321 

Nguyen, T. A-455, B-291 

Nice, A. B-262 

Nicoll, G. B-47 

Nie, W. A-112 

Niederkofler, E. E. A-178 

Niewiadonski, V. A-67, B-141 

Niimi, H. B-102 

Ning, H.-C. A-222, B-21 

Niravel, B. A-294 

Nishimura, J. A-237 

Nishimura, P. A-67 

Niu, H. A-516 

Niu, Q. A-477, A-496, A-515 

Nnachi, N. A-500 

Nnatuanya, I. N. A-301 

Noel, S. A-533 

Noguez, J. A-387 

Noguez, J. H. A-364 

Noji, K. B-258 

Nolling, J. A-53, A-70 

Nolte, F. S. B-275 

Nomura, F. A-09, A-34, A-46 

Nooka, A. A-484 

Noormahomed, E. B-69 

Nordstrom, C. B-312 

Norman, G. L. A-240 

Novak, G. B-310 

Noval-Padillo, J. A. 

A-521, 

B-57 

Novicki, T. A-234 

Nuñez, E. B-343 

O 

Oakervee, H. A-22 

O’Connell, T. A-411, B-245 

O’Donnell, D. B-288 

Oellerich, M. A-93 

Oeth, P. B-293 

Oh, S. A-449 

Ohkawa, F. B-318 

Ohman, T. A-431 

Ohman, T. L. A-201 

Ohsaka, A. A-77, A-374, B-246 

Ohto, H. B-104 

Okamura, T. B-326 

Okonski, J. B-37 

Okorodudu, A. O. B-35 

Okuhara, Y. A-58 

Okunieff, P. A-28, A-97 

Oliveira, A. A-269 

Oliveira, E. A-422 

Oliveira, E. M. A-87 

Oliveira, E. T. B-126 

Oliveira, F. 

A-553, 

B-141, B-144 

Oliveira, J. R. S. A-525 

Oliveira, V. C. A-62, B-140 

Oliveira, V. M. A-126 

Oliver, M. B-63 

Oliver, P. B-260 

Oliveras, L. B-67 

Olson, D. A-518 

Olyarnyk, B. A-82 

O’Malley, R. G. B-175 

Omar, A. B-90 

Omi, K. A-340 

ONeil, P. A-492, A-493 

Ong, L. A-295, B-85 

Onisk, D. V. B-243 

Opperman, G. B-265, B-266 

Ordonez-Llanos, J. B-53 

Oremek, G. A-137 

Oremus, M. B-179 

Orkmez, M. A-360 

Orluwene, C. G. A-301 

Oroskar, A. B-79 

Osegbe, I. D. A-300 

Osorio, P. S. B-145 

Osterfeld, S. B-264 

Otvos, J. A-411, B-245, B-255 

Ouverson, L. A-335 

Ouverson, L. J. B-251, B-300 

Overcash, D. A-90 

Ozaki, Y. B-184, B-206 

Ozbal, C. A-447 

282



Ozcan, A. B-07 

Ozdem, S. A-362 

Ozgeris, F. B. A-64 

Ozguner, M. B-302 

Ozkan, E. B-07 

Ozkanlar, S. A-64 

Oztosun, M. B-07 

Ozturk, G. A-76, A-290, A-317, 

A-326, A-353, A-372, B-302 

P 

Pachmann, K. A-15, B-261 

Padmore, R. A-487 

Pai, M. A-481 

Palacios Ramirez, A. A-560 

Palamalai, V. B-273 

Palmer, I. A-532 

Pamidi, P. V. A. B-279 

Pamula, V. B-72 

Pan, S. A-30, A-31, A-238 

Pandian, J. A-342 

Pandian, R. 

A-284, 

A-285, A-342 

Panisa, D. A-68, A-421 

Panoulis, C. B-305 

Pant, S. A-99 

Pante, E. A. B-133 

Paradowski, M. B-288 

Parente, F. A-541 

Parikh, J. A-539 

Parikh, N. A-447 

Park, B.-H. A-230, A-242, B-95 

Park, D. B-84 

Park, G. A-103 

Park, H. A-107, B-101 

Park, H.-I. B-70 

Park, K. B-44 

Park, M. A-379 

Park, P. A-379 

Park, S. A-108 

Park, S.-G. A-109 

Park, S.-R. A-155 

Park, T. A-510 

Park, Y.-S. A-140 

Partha, R. B-174 

Parvin, C. A. A-559, B-19 

Parvizi, J. B-170 

Pasic, M. D. B-284 

Paskaleva, I. A-499 

Pasquali, M. B-292 

Passig, S. A-85 

Pasternak, J. A-427 

Patel, A. A-147, B-40 

Patel, A. S. A-349, A-350, B-09 

Patel, H. A-485 

Patel, H. R. A-485 

Patel, J. B-26 

Patel, P. B-219 

Patel, P. S. A-274 

Patel, R. A-386 

Patel, S. B-84 

Patibandla, S. B-120 

Patterson, B. A-281, A-324 

Paul, W. B-88 

Pauly, D. B-265, B-266 

Pauly, K. B-265, B-266 

Payette, P. A-82 

Payne, D. A. A-38 

Payto, D. A. 

A-156, 

A-159, B-304 

Peake, R. W. A. A-164 

Pearce, L. A. B-207, B-208 

Pearlman, E. S. A-539, 

A-540, B-336 

Pearson, L. B-26 

Peck Palmer, O. A-52 

Pedada, K. K. B-163 

Pedrosa, W. A-239, B-97 

Peela, J. R. A-472 

Peeters, S. A-280 

Pelliccione, F. A-154 

Pellicier, J. B-233 

Peng, X. A-259 

Penman, J. B-278 

Penyige, A. A-225 

Pepkowitz, S. A-170, A-305 

Pepkowitz, S. H. A-329 

Pereira, C. A-86, A-91, 

A-505, B-310 

Pereira, C. F. A. A-196, A-211, 

A-212, A-214, A-220, 

A-256, A-552, B-37, 

B-38, B-48, B-133 

Pereira, C. F. De A. A-87, A-197 

Pereira, F. E. A-91 

Pereira, G. H. A-404 

Pereira, I. B-97 

Pereira, J. A-404 

Pereira, L. G. B-37 

Pereira, R. G. B-112 

Pérez, M. A. H. A-267 

Perez, R. A-404 

Perez, R. M. A-422 

Perez González, E. B-299 

Perez Ramos, S. A-74, A-124 

Pérez-Moya, G. 

A-514, 

B-43, B-313 

Pérez-Pérez, A. B-296 

Perkins, S. B-252 

Perkins, S. L. A-549, B-67 

Perna Rodríguez, M. 

A-36, 

A-60, A-63 

Perna Rodriguez, V. B-299 

Perregaux, D. B-248 

Perry, P. B-45 

Peshkova, M. B-78 

Pestel, C. A-288 

Peterman, S. A-178 

Petersen, A. B-02 

Petersen, J. A-12 

Petersen, J. R. A-27, B-35 

Petersmann, A. A-561 

Petrica, L. A-96 

Petrie, M. S. A-291 

Petroianu, A. A-524 

Petruso, M. 

A-399, 

B-194, B-288 

Petruso, M. T. B-182 

Pettersson, T. M. A-359 

Petty, N. A-258 

Petzold, A. A-255, A-260 

Pfeiffer, S. A-255 

Phanthalansy, C. B-04 

Phillips, D. A. A-178 

Phinney, K. W. B-269 

Phua, S.-K. B-211 

Picard, P. A-161, A-191, A-193 

Picarsic, J. A-52 

Picheth, G. 

A-520, 

A-536, A-554 

Pickersgill, R. B-220 

Picton, S. B-109 

Pierre, D. M. B-320 

Pignatari, A. C. C. B-39, B-143, 

B-124, B-142 

Pike, E. A-141, A-143 

Pike, J. B-58 

Pillow, D. B-87 

Pilotto, A. A-423 

Pinard-Lachapelle, J. B-116, 

B-138, B-139 

Pineda-Escribano, M. D. A-344 

Pineda-Navarro, B. A-313, 

A-514, B-57, B-313 

Pingle, P. B-92 

Pinho, J. R. R. A-126 

Pink, B. B-219 

Piscopo, A. A-319 

Pitangueira Mangueira, C. L. 

A-269 

Pitcher, T. J. A-436, A-529 

Pitta, M. B-248 

Pitts, K. B-54 

Plant, T. A-51, A-270 

Plebani, M. A-423, B-213 

Plonné, D. B-339 

Plummer, D. B-89 

Poggio, E. A-174 

Pomares, F. A-289 

Pond, G. A-48 

Ponte, C. M. M. 

A-296, 

B-125, B-126 

Ponte, G. A. B-125 

Ponte, L. M. O. B-126 

Ponte, P. M. B-125 

Popat, R. A-22 

Popescu, R. A-96 

Popoola, B. B. A-339 

Porras, M. A-521 

Porter, R. A. B-88 

Ports, B. A-517, A-519 

Postnikov, A. B. B-192 

Potter, J. M. B-190 

Pouleur, A.-C. B-177 

Poyares, D. B-56, B-180 

Prajogi, A. A-04 

Prakash, A. A-178 

Preece, J. B-160 

Preissner, C. M. A-43 

Prestigiacomo, T. A-223 

Previtali, G. B-287 

Price, J. A. B-139 

Price, M. J. B-80 

Prieto, F. B. A-148 

Prieto García, B. B-153 

Probst, O. B-339 

Pruthi, R. K. A-507 

Ptolemy, A. S. A-548 

Pudek, M. A-442 

Pulsipher, B. S. B-247 

Putnam, M. B-248 

Pyle, A. L. A-460 

Q 

Qi, Z. B-166 

Qian, C. B-166 

Qian, Q. B-277 

Qian, W. A-17 

Qiang, M. A-392 

Qiao, H. A-210 

Qin, X. A-529, B-166 

Qiu, L. B-166 

Qiu, Y. A-531 

Quadros, C. B-97 

R 

Raby, A. A-487 

Racek, J. A-543 

Radkey, R. B-54 

Rafique, S. B-123 

Rahman, A. A-231 

Rahmani, Y. E. A-351 

Raisch, K. A-28 

Raizman, J. E. A-345, B-64 

Rajdl, D. A-543 

Ramaiah, S. B-01 

Rambally, B. S. B-308 

Ramirez, C. A-493 

Ramirez, E. B-195 

Ramos-Chavez, A. B-84 

Ramsey, C. A-476 

Randell, E. B-285 

Rankin, J. D. B-262 

Rao, L. V. A-397, A-398, A-535 

Rapp, M. A-548 

Rasuck, C. G. A-62, B-140 

Ratcliffe, P. B-159, B-191 

Ratia, S. Z. B-05 

Rauch, D. A-04 

Ravago, E. B-276 

Rawlins, M. L. A-292, A-316 

Ray, J. A. A-292, A-316 

Ray, P. 

A-71, A-508, 

B-198 

Ray, U. B-105 

Raymond, K. M. A-482 

Raymond, N. B-68, B-280 

Reagan, W. J. B-03 

Reamer, C. R. A-291 

Rebuck, H. B-196 

Redel, S. B-17 

Reed, K. A-90 

Reedy, J. A-146 

Refaaay, W. A. B-345 

Regmi, P. B-237 

Rehan, M. A-481 

Reichetzeder, C. B-306 

Reis, G. O. A-211 

Remaley, A. T. A-75 

Renley, B. B-288 

Resende, V. A-524 

Reuter, K. A-137 

Revuelto-Rey, J. B-161 

Rezende, M. P. A-505 

Rezvanpour, A. B-235 

Rhea, J. M. A-559 

Ribera, A. A-279 

Ricchiuti, V. A-534, A-546 

Rice, T. B-89 

Rice, T. W. A-400 

Richardson, C. B-151, B-152 

Riedel, E. A-11 

Riley, C. A-215 

Riley, J. 

A-53, A-69, 

A-70, A-493 

Rimkus, M. B-17 

Ritchie, J. C. A-476 

Rivera, M. B-343 

Riviere, M. B-293 

Rizos, D. B-301, B-305 

Rizou, M. B-301, B-305 

Rizzi, C. F. B-180 

Roberts, W. L. A-316 

Robeson, B. B-02 

Robinson, J. K. A-248 

Rocha, A. L. B-96 

Rocha, I. V. B-125 

Rocha, J. L. 

A-358, B-146, 

B-147 

Rockwood, A. L. A-201, A-292 

Rodrigues, C. B-41, B-142 

Rodrigues, J. N. M. A-126 

283



Rodrigues, R. R. A-328, A-363 

Rodríguez, C. A-66 

Rodriguez, M. L. A-532, B-109 

Rodriguez, M. T. A-416 

Rodriguez Capote, K. A-245 

Rodriguez Fraga, O. B-195 

Rodriguez-Capote, K. 

A-224, 

B-332 

Rodriguez-Fernandez, M. D. 

A-514 

Rodriguez-Mañas, L. A-94 

Rodríguez-Rodríguez, A. B-161 

Roen, D. B-94 

Roger-Dalbert, C. A-125, B-116, 

B-121, B-138, B-139 

Rogers, J. B-193 

Rogers, J. L. 

B-182, B-183, 

B-194 

Rohlfing, C. A-537 

Roizen, J. D. B-294 

Rolin, H. A-174 

Rolston, R. A-486 

Romanatto, T. A-427 

Romani, A. P. A-310 

Romano, S. J. C. A-520 

Romaschin, A. A-110 

Romeiro, J. R. A-524 

Romero Losquiño, I. A-247 

Romero-Aleta, J. A-313, 

A-514, B-43, B-57 

Romm, M. A-447 

Ropero-Gradilla, P. A-344 

Roquero, L. B-30 

Rosales, M. B-193 

Rosales, M. A. B-194 

Rosecrans, R. A-151, B-227 

Roseiro, F. C. S. A-86 

Rosenthal, A. A-258 

Rosiere, T. A-288 

Ross, L. B-05 

Rosseto, E. A. A-269 

Rossi, L. B-59 

Rottey, S. A-14 

Rousseau, M. B-177 

Rowe, C. N. A-250 

Roy, D. B-121 

Roy, S. A-125, A-165 

Roy Hughes, A. B-26 

Rozov, F. N. B-06 

Rubetti Junior, N. L. A-328 

Rubio, A. A-94 

Rubio-Calvo, A. B-307 

Rueda, B. R. A-41 

Ruivo, R. B. B-143 

Ruiz, P. A-435 

Ruíz de Azúa-López, Z. B-161 

Rule, A. D. B-322 

Rule, G. S. A-201 

Rumery, D. A-555 

Rutledge, A. A-48, A-475 

Ryan, A. A-10 

Ryan, W. L. B-51 

Ryang, D.-W. 

A-230, A-242, 

A-530, B-95 

Rymer, J. A. A-438 

Ryoo, N. A-108 

Ryoo, N.-H. A-109 

S 

Sabatine, M. S. B-175 

Sabino, P. A-296 

Sabio, E. B-61 

Sadilkova, K. A-448 

Sadjadi, S. A-141 

Sadri, M. A-285 

Saechao, F. B-108 

Saenger, A. K. 

B-222, B-316, 

B-322, B-331 

Sáez Benito-Godino, A. A-376 

Safar, F. H. A-312 

Saguinsin, R. A-459 

Saito, K. A-58 

Saito, M. B-184, B-206 

Saito, S. B-102 

Sakairi, Y. A-34, A-46 

Sakaki, T. A-58 

Sakamoto, F. T. C. B-37 

Sakamoto, H. A-41 

Sakane, N. B-327 

Sakhare, A. A-547 

Sakurabayashi, I. B-328 

Sakurai, T. A-186, B-318 

Sakyu, T. A-340 

Salamone, S. B-240, B-241 

Salamone, S. J. A-446 

Salas, G. B-40 

Salinas, M. A-289, B-12, B-29 

Salmazi, K. I. L. C. A-269 

Salmon, B. P. A-147, A-452 

Salvagno, G. 

A-520, 

A-536, A-554 

Samatar, A. B-259 

Sampaio, F. B. B-126 

Samper-Toscano, M. A-376 

Sampson, M. L. A-75 

Samuel, J. B-150 

Sanches, L. R. A-427 

Sanchez, B. B-193 

Sanchez, E. A-04 

Sanchez, F. A-521 

Sanchez Jacinto, B. J. A-560 

Sanchez-Margalet, V. B-296 

Sandanayake, N. A-10 

Sanders, C. A-378 

Sandoval, Y. B-208 

Sandrini, F. A-327, A-355, 

A-356, A-363, B-145 

Sandrini, F. D. A-327, A-552 

Sanmamed, M. F. A-66 

Sansão, R. C. A. A-328 

Santa Rita, T. 

A-101, A-122, 

A-123, B-111 

Santana, M. A. A-212 

Santo-Quiles, A. B-12, B-29 

Santora, D. A-240 

Santos, A. M. R. A-197 

Santos, D. L. O. A-196 

Santos, S. M. E. A-239 

Santotoribio, J. D. A-74, A-124 

Sargent, D. A-486 

Sartippour, M. R. A-100 

Sato, K. A-34, A-46 

Sato, Y. B-167, B-173 

Savaş, E. B-344 

Savage, S. A-441, B-159, B-191 

Savignano, C. B-66 

Saw, S. A-295, B-85 

Sawamura, T. B-326 

Saxena, A. A-71, A-508 

Scarpelli, L. A-129, B-127 

Schaeffer, A. B-263 

Schanbl, K. A-245 

Scharf Pinto, M. A-358 

Scheele, K. B-26 

Scheibe, B. B-02 

Schiavo, W. A-197 

Schiller, K. B-170 

Schilling, J. J. B-242 

Schimitt, V. B-118 

Schimkat, D. A-233 

Schlicht, K. A-447 

Schmid, M. B-339 

Schmidt, C. A. B-275 

Schmitz, J. A-93 

Schmotzer, C. A-364 

Schnabl, K. L. A-224 

Schneider, R. J. A-257 

Schønemann-Lund, M. B-186 

Schooley, R. B-69 

Schoos, M. M. B-186 

Schrank, Y. A-330 

Schranz, D. B. A-542 

Schroeder, J. F. B-05 

Schroeder, L. F. A-367 

Schroeder, T. A-178 

Schulman, H. A-165 

Schulz, K. M. B-208 

Schütz, E. A-93 

Schwab, M. A-69 

Schwab, M. C. A-118 

Schwanzar, D. B-71 

Schwartz, J. A-397, A-398 

Schwartz, S. A-234 

Schwebel, P. A-399 

Scialabba, V. A-69 

Scirica, B. M. B-175 

Scotland, S. B-47 

Scott-Harrell, P. A-476 

Searle, J. 

A-394, B-136, 

B-228, B-238 

Sears, C. A-535 

Seccombe, D. B-285 

Seegmiller, J. A-205 

Seemann, C. B-339 

Seetharam, A. A-19 

Seferian, K. R. B-06 

Seger, A. B-264 

Seguin, C. B-67 

Sekikawa, A. B-326 

Selby, R. A-487 

Senem, E. A-420 

Seo, Y. A-379 

Serebryanaya, D. V. B-192 

Sethi, A. A. A-542 

Sethi, S. A-295, B-85 

Sexton, R. A-258 

Seyrekel, T. A-187 

Sezer, S. A-290, A-372 

Sha, J. A-37 

Shaar, D. T. A-399 

Shafi, R. B-55 

Shah, D. S. B-237 

Shah, N. N. A-484 

Shah, S. A-349, A-350, B-09 

Shah, V. B-294 

Shahid, A. A-29, B-123 

Shakila, S. A-472 

Shalaurova, I. 

A-411, 

B-245, B-255 

Shang, S. B-110 

Shanks, A. A-532 

Sharma, H. A-343 

Sharretts, S. A-486 

Sharrod, H. 

A-03, A-19, A-22, 

A-44, A-231, A-232 

Sharrod-Cole, H. J. A-252 

Shashack, M. J. B-35 

Shaw, J. B-289 

Shaw, J. L. A-549, B-67 

Shaw, M. J. A-194 

Shea, J. L. B-289 

Shekar, S. A-53 

Shen, C. H. A-415 

Shen, D. B-44 

Shen, Y. B-52 

Shi, A. A-112 

Shi, R. Z. A-189 

Shi, Y. A-241, A-263 

Shih, H.-Y. A-61 

Shih, J. B-215, B-216 

Shimizuishi, Y. A-410 

Shin, E. B-84 

Shin, J. A-230, A-530 

Shin, J.-H. A-242, B-95 

Shin, M. A-230 

Shin, M.-G. A-242, A-530, B-95 

Shin, S.-I. B-120 

Shirakawa, T. A-340 

Shoenfeld, Y. A-260 

Showell, P. J. A-20, A-248, 

A-249, A-250, A-251, A-252, 

A-253, A-272, A-273, A-274, 

A-275, A-276, A-277, A-278 

Shrestha, R. A-186, B-318 

Shu, I. A-162, A-261 

Shugarts, S. A-462 

Shuin, T. A-58 

Shukla, K. A-371 

Shukla, R. A-371 

Shulta, T. A-257 

Sibio, A. A-470 

Sibley, P. A-136 

Sigdel, M. B-237 

Signorelli (Mack), H. A-146 

Silva, C. B-48 

Silva, C. C. T. A-86 

Silva, N. B-41 

Silvera, S. K. I. A-249 

Simard, S. A-125 

Simon, A. B-241 

Simon, G. A-234 

Simon, J. A-172 

Simpson, A. B-190 

Simpson, J. A. B-189 

Simpson, W. G. A-469 

Simsek, G. A-381, A-381 

Şimşek, N. A-372 

Singh, K. P. A-105 

Singh, R. A-335 

Singh, R. A-472 

Singhal, P. B-174 

Sirikci, O. A-187, A-314 

Sisco, K. A-26 

Siscovick, D. B-330 

Sista, R. B-72 

Sitnik, R. A-126 

Skoropadyk, W. B-210, B-239 

Slagman, A. 

B-136, B-228, 

B-238 

Slagman, A. C. A-394 

Slhessarenko, N. B-310 

Slotta, J. A-93 

Smeal, K. A-486 

Smillie, M. B-105 

Smith, J. L. A-233 

Smith, L. J. A-253 

Smith, M. P. A-294, A-440 

Smith, S. W. B-207, B-208 

Smith, T. A-494 

Smith, Y. A-90 

Smolyanova, T. I. B-192 

Snozek, C. B-26 

Snyder, L. M. A-535 

Snyder, M. A-221 

Snyder, M. R. A-163 

284



Soares, H. B-240, B-241 

Sobhani, K. B-200 

Sofronescu, A. G. B-275 

Sohn, K.-Y. B-16 

Sokoro, A. A-82 

Sola, A. B-39 

Solanki, M. A-248 

Šolcová, M. A-543 

Soldin, S. J. A-173, A-307 

Song, L. B-83, B-219 

Song, X.-B. A-106 

Song, X. A-495 

Sorenson, L. B-77 

Souberbielle, J.-C. A-280 

Sousa, C. A-122 

Sousa, M. A. B. B-96, B-149 

Southan, L. D. A-277 

Southcott, E. B-190 

Souza, G. F. B-96, B-97, B-149 

Souza, P. C. A-214, A-220 

Souza, T. B-48 

Souza, T. P. A-91 

Souza, T. S. P. B-119 

Sovath, S. B-293 

Sözer, V. A-381 

Spanou, L. A-365 

Spears, R. A-136 

Spielmann, C. A-15, B-261 

Spingarn, S. B-52 

Spratt, H. A-12 

Squires, N. B-75 

Srinivasa Gowda, S. A-400 

St. John, S. B-193 

Stafford, L. J. B-243 

Star-Weinstock, M. A-324 

Starobin, J. A-323, B-214 

Starostina, V. A-287 

Staufer, L. E. A-38 

Stave, J. W. B-243 

Steele, A. N. B-270 

Stefan, C. A-475 

Stefan-Bodea, C. A-169, A-466 

Stefanelli, R. A-473 

Steffensen, R. B-186 

Steimer, W. A-98 

Stein, C. B-339 

Stein, J. A-137 

Steinle, R. B-304 

Steinmetz, H. B. A-131 

Steinmetz, J. A-184 

Stejskal, J. B-01 

Stemp, J. B-65 

Stephen, D. W. S. A-469 

Steuernagle, J. H. B-277 

Stevens, K. A-315 

Stewart, P. B-159 

Stezar, L. A-320, A-445 

Stickle, D. F. A-302, A-303, 

A-308, A-439, A-464, 

A-522, B-10 

Stockburger, M. A-394, B-136 

Stöckl, D. A-322 

Stojkovic, R. A-331 

Stolze, B. A-307 

Stone, C. A-16 

Stone, J. A. A-291 

Stout, A. K. A-38 

Straseski, J. B-288 

Straseski, J. A. 

A-139, A-244, 

A-271, A-292, 

A-316, B-171 

Strathmann, F. G. A-432 

Strauss, R. B-308 

Stribling, S. L. B-320 

Stride, A. A-51, A-270 

Struck, J. B-228, B-238 

Stuff, M. A-233 

Su, B. A-35, B-148 

Su, J. A-496, A-515 

Su, Z. B-135 

Sucu, M. B-344 

Suffin, S. A-558 

Sugiuchi, H. B-317 

Sugiura, T. A-58 

Suh, J.-T. A-510 

Suh, S.-P. A-530 

Suh, S.-P.P. A-230, A-242, B-95 

Suh-Lailam, B. B. 

A-244, 

A-431, B-171 

Suleymanlar, G. A-393 

Sullivan, S. B-219, B-288 

Sumino, H. B-340 

Summers, M. B-151 

Sun, R. A-238 

Sung, D. B-44 

Suong, N. T. B. B-129 

Suszko, M. I. A-288 

Sutton, D. A-19 

Suwal, R. A-337 

Svancara, D. B-248 

Svinarov, D. A-132 

Svoboda, M. A-83, B-256 

Swelem, M. S. A-117 

Swiderski, D. A-320 

Swinehart, W. A-502, A-503 

Sykes, E. A-294 

Synder, N. A-27 

Szczesniewski, A. 

T 

A-167, 

A-168, A-198 

Tabak, Ö. A-325, A-354 

Tabata, H. B-102 

Tabe, Y. A-77, A-374, B-246 

Tabor, J. A-504 

Tachibana, R. B-167 

Tachikawa, H. A-204 

Tafe, L. J. A-118, A-131 

Tagliaferro, D. B-86 

Taira, E. A-148 

Tajra, K. S. A. A-520 

Takahashi, H. A-237 

Takahashi, Y. A-186, B-318 

Takeda, J. B-184, B-206 

Takeda, S. A-186, B-246, B-318 

Takemura, F. A-340 

Takemura, H. A-77, A-374 

Takemura, K. A-410 

Takiwaki, M. B-205, B-337 

Takushi, A. P. da R. A-197 

Tam, E. B-312 

Tamama, K. A-438 

Tamang, H. K. A-105 

Tamm, N. N. B-06, B-192 

Tan, S.-P. B-211 

Tan, Y. B-217 

Tanaka, K. A-491 

Tanaka, S. K. A-352 

Tang, D. A-496, A-515 

Tang, H. A-391 

Tang, J. A-263, A-265, A-465 

Tang, P. H. B-295 

Tang, W. B-276 

Tang-Hall, L. B-217 

Tani, N. A-491 

Taniguchi, N. B-328 

Taslıpınar, M. Y. A-76, 

A-353, B-07 

Tavil, B. B-302 

Taylor, A. A-80 

Taylor, A. M. A-205 

Taylor, S. E. A-299 

Tchervenkov, T. A-132 

Tchiernianchouk, O. B-200 

Tebo, A. E. A-244, B-171 

Teggert, A. A-446 

Teixeira, C. F. A-196, A-197, 

A-211 

Tejidor, L. A-492 

Templin, L. A-288 

ten Berg, J. M. B-76 

Teodoro-Morrison, T. 

A-341, 

B-64 

Tepel, M. A-293 

Terao, Y. B-246 

Terra, C. A-404 

Theansun, W. B-81 

Thebo, J. A-389 

Thériault, S. A-138, A-297 

Thevis, M. A-335 

Thiel, F. A-233 

Thielmann, D. B-112 

Thienpont, L. M. A-322 

Thode, J. B-186 

Thomas, E. A-43 

Thomas, J. B-55 

Thomas, J. B-60 

Thomassian, K. 

A-202, A-203, 

A-284, A-285 

Thompson, K. A. A-386 

Thomson, Y. A-454 

Thoren, K. L. A-461 

Thornton, D. J. A-460 

Thys, F. B-203 

Tian, X. B-42 

Tim, R. C. B-293 

Timilsina, U. A-105 

Timms, J. A-10 

Tirado, L. K. A-268 

Todd, J. B-196, B-209, B-218 

Toher, J. L. B-333 

Tolan, N. V. 

A-507, B-49, 

B-222, B-277 

Tolliver, S. S. A-450 

Tomino, Y. A-374 

Tomita, M. A-340 

Tomoda, F. B-337 

Toner, V. B-158 

Tonetti, M. B-33 

Tongxing, L. A-392 

Toni, L. G. B. A-427 

Toral Peña, A. A-124 

Torbati, S. B-200 

Torguson, A. B-266 

Torres, V. B-196, B-209, B-218 

Tortorelli, S. A-482 

Tosiello, L. A-271 

Toygar, M. B-07 

Toyos-Sáenz de Miera, F. J. 

A-247 

Tran, D. B-17, B-239 

Tran, N. K. B-270 

Tranchesi, R. B-39 

Travieso, R. T. L. A-267 

Traylor, L. A-257, A-258 

Treebuphachatsakul, W. B-81 

Trefil, L. A-543 

Trivedi, R. B-92 

Trojano, P. A-553, B-141, B-144 

Trujillo-Arribas, E. A-344, 

A-348 

Truong, L. X. B-129 

Truscott, S. M. B-155 

Tsafaras, C. B-301 

Tsai, Y. M. A-415 

Tsilioni, I. A-164 

Tsongalis, G. A-69 

Tsongalis, G. J. A-118, 

A-130, A-131 

Tsurue, T. B-102 

Tsuzaki, K. B-327 

Tu, J. B-248 

Tubbs, K. A. A-178 

Tucker, W. W. A-436 

Tufik, S. 

A-190, A-192, 

B-56, B-180 

Tunc, B. B-302 

Tuon, F. F. B-146, B-147 

Turgay, F. A-395 

Turner, J. A-73 

Turner, L. J. B-250 

Tüten, A. A-381 

Tweedie, A. B-240 

Tynan, J. A. B-293 

Tyrrell, S. P. B-73 

Tzveova, R. A-499 

U 

Ucar, F. A-76, A-290, A-317, 

A-326, A-353, B-07 

Uchida, Y. A-340 

Uchiyama, S. B-254 

Uckan, D. B-302 

Uelker, B. A-85 

Ueno, T. B-102 

Ueshima, H. B-326 

Uettwiller-Geiger, D. L. A-403 

Uji, Y. B-205, B-337 

Ulloor, J. B-34 

Umeda, Y. B-104 

Unfricht, D. A-517, A-518, 

A-519 

Urenda, T. A-146 

Ushizawa, K. A-237 

Usmani, S. Z. A-258 

Uzdogan, A. A-286 

Uzun, H. A-325, A-354, A-381 

V 

Vaisman, M. A-333 

Valdes, R. A-06 

Valdez, J. A-449 

Valente, L. G. A. B-126 

Valentim, C. D. A-520 

Vallicelli, S. A-319 

Valmont, I. A-218, B-267 

Van Aelst, S. A-322 

Van Belle, S. A-14 

Van De Walle, T. L. B-113 

van Deventer, H. E. A-75 

Van Houcke, S. K. A-322 

Van Praet, C. A-14 

van Rhee, F. A-258 

Van Uytfanghe, K. A-322 

Vanavanan, S. B-15 

Vandenberghe, H. A-110, A-177 

Vander Kooi, J. A-257 

Vanderschaeghe, D. A-14 

Vant-Hull, B. B-73 

Vardanyan, S. A-04 

Varone, C. B-296 

285



Vasconcellos, L. de S. A-524, 

B-117 

Vaslin-Reimann, S. B-319 

Vasques, J. A-101, A-122 

Vaupel, H. A-85 

Veerasekaran, A. B-109 

Velasco, L. A-101, A-123, 

B-111, B-118 

Venkataramanan, R. A-438 

Venner, A. A. A-550 

Venrick, M. G. A-38 

Ventura, F. P. B-126 

Ventura, L. B-250 

Verdes, D. A-96 

Vergara-Chozas, J. A-376 

Vermassen, T. A-14 

Verrant, J. A-518 

Vesper, H. A-332 

Vesper, H. W. 

A-279, 

A-351, B-320 

Viana, J. S. B-96 

Viant, J. A-288 

Vicente, A. C. P. B-119 

Vicente, E. M. A-408 

Vieira, A. B-310 

Vieira, L. F. B-117 

Vieira, S. D. S. A-87 

Vijayalakshmi 

Padmanabhan, V. A-131 

Vilches-Arenas, Á. B-161 

Vintila, I. B-158 

Virji, M. A. A-299 

Vitoratos, N. B-305 

Vitry, L. B-82 

Vivas, W. A-123 

Vlad, D. A-96 

Vollert, J. B-228 

Vollert, J. O. A-394, B-136 

Vollmer, P. A. 

B-262, 

B-281, B-282 

Voma, C. B. A-310 

von Recum, J. 

A-394, 

B-136, B-238 

Vonesh, E. A-05 

Voronov, S. A-69 

Voskoboev, N. V. B-242 

Vytopil, M. A-538 

W 

Wakefield, M. A-180 

Walker, R. B-325 

Waller, E. A-484 

Wallis, G. A-227 

Walsh, W. A-474 

Walson, P. D. A-93 

Walter, D. A-257 

Walz, S. E. A-390 

Wan, P. A-223 

Wang, A. A-281 

Wang, C. S. A-04 

Wang, F. A-31, A-238 

Wang, H. A-31 

Wang, J. A-106, A-112, 

Wang, L. 

A-495 

A-13, A-106, 

A-241, A-263, A-265, 

A-391, A-465, B-99, 

B-100, B-110, B-135 

Wang, P. A-162, A-261 

Wang, S. A-156, A-157, A-158, 

A-159, A-171, A-172, A-174, 

A-175, A-179, A-181 

Wang, S. A-465, A-467, 

A-544, A-545, B-304 

Wang, T. B-72 

Wang, W. A-13 

Wang, Y. A-51, A-270, A-311, 

A-332, A-341, 

A-345, B-323 

Ward, R. P. B-188 

Wardlaw, S. A-517 

Wardlaw, S. C. B-103 

Warner, E. A-110 

Warner, M. S. A-84 

Washington, K. Q. B-275 

Watanabe, M. A-410 

Watroba, N. A-16 

Wawrzyniak, A. J. B-196 

Weaver, A. B-69 

Webb, S. B-73 

Weiner, R. B-259 

Weldon, L. A. A-38 

Wells, W. B-87 

Wen, L. Li. A-415 

Wen, Y. A-238 

Wentworth, J. C. A-450 

Werneck, J. S. A-190, A-192 

Wesenberg, J. C. A-550 

West, A. B-312 

West, M. B-297 

Westphal, S. B-339 

Weyand, T. K. A-38 

Wheeler, A. B-89 

Wheeler, A. P. A-400 

Wheeler, S. E. A-52 

Whipple, K. B-02 

Whittaker, K. B-196 

Wiegel, J. V. A-425, B-244 

Wiencek, J. A-506, B-154 

Wiesner, D. 

B-182, B-183, 

B-193, B-194 

Wigginton, S. M. B-51 

Wildeboer, S. E. B-03, B-04 

Wiley, C. A-215 

Wilkerson, M. A-486 

Williams, D. A-207 

Williamson, E. E. A-377 

Willrich, M. A. V. 

A-163, 

A-298, B-322 

Wilson, A. A-201 

Wilson, A. R. A-244 

Wilson, C. A-84 

Wilson, D. H. B-219 

Wilson, G. B-202 

Wilson, J. M. A-440 

Wilson, K. A-136 

Winkelman, J. W. A-501, 

A-502, A-503, A-504 

Wintgens, K. B-185 

Wirtzbiki, G. P. G. B-126 

Wirtzbiki, V. P. G. B-126 

Witte, M. E. A-435 

Wittliff, J. L. A-02 

Wo, I. B-101 

Wockenfus, A. M. A-507, B-49 

Wohleb, R. B-256 

Wohleb, R. H. A-83 

Wolak-Dinsmore, J. 

B-245, 

B-255 

Wong, B. Y. L. A-110 

Won, E. A-530 

Won, E.-J. A-242 

Wong, E. A-169, A-466, A-475 

Wong, M. S. B-90 

Wong, S. A-451 

Wong, S. H. B-262 

Won, Y. A-530 

Wongwaisayawan, S. B-15 

Woo, H. I. A-366 

Woo, H.-Y. A-107 

Woodworth, A. 

A-400, 

A-559, B-89 

Workman, R. B-193 

Workman, R. F. B-182, B-183 

Worobec, S. A-399 

Worster, A. A-402, B-179 

Wright, C. B-24 

Wright, J. A-218, B-267 

Wu, A. H. B-209 

Wu, A. H. B. A-461 

Wu, M.-T. A-61 

Wu, N. B-72 

Wu, T.-L. A-222 

Wycoff, S. A-173 

Wyer, L. B-52 

Wyness, S. P. A-271 

Wynn, A. B-193 

X 

Xiao, N. A-186, B-318 

Xie, E. A-30 

Xie, M. A-518 

Xie, S. B-166 

Xie, X. A-165 

Xin, N. A-392 

Xiong, Z. A-321 

Xu, J. A-30, A-238 

Xu, K. B-42 

Xu, T. A-31 

Y 

Yılmaz, N. B-344 

Yabe, K. A-58 

Yadak, N. A-540 

Yadav, P. A-71, A-508 

Yago, H. A-237 

Yamada, H. A-410, B-246 

Yamada, K. B-327 

Yamada, S. B-328 

Yamada, T. B-328 

Yamaguchi, H. B-104 

Yamaguchi, I. B-264 

Yamakawa, N. A-410 

Yamamoto, Y. A-58 

Yamamoto, Y. B-257 

Yamashita, M. B-205, B-337 

Yang, D. A-139 

Yang, H. A-510 

Yang, J. A-510 

Yang, J.-S.S. A-366 

Yang, L. A-429 

Yang, R. A-31 

Yang, S. A-28 

Yavuz Taslipinar, M. A-317 

Yayla, S. A-420 

Yazawa, I. A-204 

Ye, S. A-210 

Ye, Y. 

A-13, A-106, 

A-495, A-516 

Yee, M. A-271 

Yen, J. A-399, B-288 

Yen, J. L. B-182, B-183, B-194 

Yen-Lieberman, B. B-114 

Yeo, K. T. J. A-160 

Yeo, K.-T.T. J. 

A-183, A-184, 

A-434 

Yeo, K. T. J. B-188 

Yi, C. A-107 

Yi, X. 

A-160, A-183, 

A-434, B-188 

Yim, H. B-279 

Yim, J.-H. A-155 

Yim, Y.-H. A-155 

Ying, B. A-13, A-106, A-391, 

A-495, B-100 

Yip, P. A-345, B-65 

Yip, P. M. A-341 

Yo, S.-M. B-21 

Yong, H. A-392 

Yoon, I. A-155 

York, L. B-219 

Yoshida, T. A-237 

Yoshino, I. A-34, A-46 

You, E. A-510 

You, J. J. B-179 

Young, A. A-315 

Young, D. A-486 

Young, E. A-227 

Young, J. A-11 

Young, L. B-212 

Young, P. A-03, A-44 

Younis, A. B-123 

Youssef, M. A-447 

Yu, C. A-37 

Yu, E. A-486 

Yu, H. B-264 

Yu, S. A-107 

Yu, Y. B-69 

Yuan, C. 

A-157, A-159, 

A-171, A-181 

Yucel, G. A-362, A-393 

Yue, M. A-477 

Yundt-Pacheco, J. C. A-559 

Yundt-Pacheco, J. C. B-19 

Z 

Zahniser, D. A-479, A-501, 

A-502, A-503, A-504 

Zahniser, M. A-501 

Zajechowski, J. A-320, 

A-445, B-30 

Zaki, A. M. A-117 

Zaki, A. M. B-345 

Zanardi, V. A-319 

Zanella, L. B-119 

Zang, X. B-79 

Zaninotto, M. A-423, B-213 

Zeballos Conislla, H. M. A-560 

Zeidler, J. A-475 

Zeng, T. A-498, A-516 

Zhang, A. A-28 

Zhang, A. A-28, A-97 

Zhang, B. A-30 

Zhang, J. A-263 

Zhang, J. A-283 

Zhang, J. B-99 

Zhang, L. A-28 






Zhang, L. B-259 

Zhang, M. A-28 



Zhang, M. B-115 

Zhang, R. A-80 

Zhang, S. B. A-28 

Zhang, X. A-259 

Zhang, X. A-259 

286



Zhang, X. B-114 

Zhang, X. B-168 

Zhang, Y. A-30 

Zhang, Z. A-28 

Zhao, W. A-238 

Zheng, J. A-223 

Zheng, Q. A-206 

Zheng, Q. A-498, A-516 

Zheng, Z. B-42 

Zhou, A. A-188, A-453 

Zhou, J. A-13, A-106 

Zhou, J. A-321 

Zhou, J. A-495, B-100 

Zhou, L. A-288 

Zhou, M. B-05 

Zhou, S. A-223 

Zhou, X. A-188, A-453 

Zhou, Y. A-106 

Zhou, Y. 

A-106, 

A-391, A-495 

Zhou, Y. A-495 

Zhu, J. A-37 

Zhu, Y. B-233, B-275 

Zhuang, J. B-168 

Zibrat, S. A-459 

Ziera, T. B-228, B-238 

Zimmer, C. B-239 

Zimmerman, M. K. B-63, 

B-262, B-281, B-282 

Zinaman, M. B-45 

Zmuda, K. B-262 

Zou, L. A-391 

Zou, M. A-265 

Zou, Y. A-241, A-465 

Zuberi, M. A-71, A-508 

Zuo, C. A-477 

Zürch, M. A-15, B-261 

A287

KEYWORD INDEX TO ABSTRACTS OF SCIENTIFIC POSTERS, AACC MEETING, 2013 


1-hydroxypyrene A-222 

1.25 dihydroxy-vitamin D A-318 

17-OH progesterone A-85 

24-hr Urinary Paraprotein A-484 

25-Hydroxy vitamin D A-161 

25-hydroxyvitamin D A-132, A-351 

25-OH Vitamin D B-263 

25-OH VITAMIN D3 A-173 

3-epi-25-hydroxyvitamin D A-294 

3-methoxytyramine A-200, A-299 

5-hiaa A-199 

5-Hydroxyindole-3-acetic A-545 

5-hydroxyindoleacetic acid A-313 

6-methylmercaptopurine A-164 

6500QTRAP A-194 

99th Percentile B-183 

A 

A1166C SNP of AT1R gene A-117 

A1c A-320, A-559 

A1c Linearity B-51 

Abbott ARCHITECT A-341 

Abbott Architect c8000 B-14 

Abbott ARCHITECT STAT TnI assay B-235 

ABL B-55 

absolute quantification A-155 

Accuracy B-112, B-242 

accuracy assessment B-319 

ACE Gene Insertion/Deletion 

Polymorphism A-338 

aCL A-247 

Acromegaly A-145, A-296 

active surveillance A-05 

Acute Coronary Syndrome B-178, B-84 

Acute dyspnea A-394 

acute kidney injury 

A-365, A-542, 

A-543, B-270 

acute liver failure A-378 

acute lymphoblastic leukemia A-495 

Acute Myeloid Leukemia A-129, A-13, 

A-29, A-516, A-99 

Acute Myocardial Infarction B-230 

acute pancreatitis A-424 

acute stroke A-365, B-152 

addiction and psychiatry A-169, A-466 

adiponectin A-326, B-173 

Adrenomedullin (ADM) A-394 

advanced glycation end products A-325 

advanced lipoprotein testing B-319 

Advia A-446, B-01 

ADVIA 2400 B-325 

AFABP, adipocyte fatty acids binding 

protein B-345 

Africa A-367 

aging A-333 

agomelatine A-64 

AIDS A-270 

Albumin A-252, A-88 

Albuminuria A-376 

Aldosterone A-319 

aliquoter A-90 

alkaline phosphatase B-155, B-166 

All Ambient Assays B-174 

all smalll particle B-106 

allele-specific sequencing A-103 

Allergens A-228 

allogeneic immunization A-553 

Allopregnanolone A-324 

allowable error B-17 

Alpha fetoprotien A-33 

Alpha-1-Antitrypsin B-156 

alpha-2-macroglobulin B-01 

Alpha-defensin B-170 

Alpha-Fetoprotein B-288 

alternative splicing A-09 

Alzheimer’s disease A-391, A-395, B-240 

Alzheimer’s Disease (AD) B-241 

AMH A-285, B-09 

Amikacin A-460 

amino acid A-204, A-366 

Amino-terminal pro-B type natriuretic 

peptide (NT- A-379 

Ammonia measurement A-541 

AmnioStat-FLM PG Test Kit B-304 

AmniSure B-61 

amplification B-250 

Ampliflex Diene reagent A-194 

amyloidosis A-181, A-60 

ANA A-246, A-266 

ANA ELISA sreening A-239 

ANA IFA HEp-2 A-233 

Anabasine A-431 

Anaerobic Microorganisms A-211 

analyser A-250 

analytic performance goals A-380 

analytical evaluation B-258, B-67 

analytical measuring range A-240 

Analytical method A-280 

Analytical performance 

A-318, A-559, 

B-215, B-216, B-262 

Analytical validation A-342, A-347 

Analyzer A-517, A-518, A-519 

Androstadienone A-160 

anemia B-73 

Angiographic Clinical Vessel Score B-198 

Angiopoietin_2 A-33 

Animal B-05 

ANP1-28 A-287 

anti fungal agents A-427 

Anti Xa Activity A-494 

Anti-β2-glycoprotein I Domain I A-247 

Anti-cancer A-35 

anti-DFS70 A-266 

anti-dsDNA A-223 

Anti-Müllerian Hormone A-285 

Anti-Mullerian Hormone A-349 

Anti-Müllerian Hormone B-09 

Anti-nuclear antibodies A-255, A-260 

antibiotic therapy B-10 

antibodies A-407 

antibody B-06, B-234 

Antiepileptic Drug A-156 

antiepileptics A-476 

antigen antibody combo B-108 

Antigen excess A-20, A-22 

Antimicrobial resistance B-123, B-96 

Antinuclear antibodies A-239 

Antiphospholipid Syndrome A-247 

Antiphospholipid syndromes A-397 

antiplatelet therapy B-43, B-76 

Antiretroviral therapy. B-125 

antithrombin III A-514 

Anyplex II HPV28 Detection A-107 

APCI A-184 

Apelin–13 A-395 

Apolipoprotein E B-329 

apoptosis A-30, A-96 

APP B-01 

Architect A-288, A-334, A-399, B-193 

area under the concentration-time 

curve B-204 

area under the curve B-270 

arginine catabolic mobile element 

ARK A-474 

ARK Diagnostics A-467 

array B-265 

arsenic A-432 

Arterial Blood Gas B-85 

Arterial PO2 B-275 

ascorbic acid A-143 

aspartate aminotransferase A-546 

Aspirin Response B-222 

assay A-500, B-217 

AT A-500 

Atherosclerosis A-343, B-326 

Attention-deficit/Hyperactivity 

Disorder A-360 

AU5822 B-262, B-281, B-282 

Aute B-157 

autoimmune A-223, A-407 

autoimmune diseases A-259 

Autoimmune rheumatic diseases A-239 

Automated A-260, A-534 

Automated Sample Preparation A-80 

automation A-233, A-479, A-83, A-87, 

B-04, B-242, B-256 

B 

B2M A-250 

Bacterial Identification A-196 

bacterial resist B-146 

Balanced Scorecard B-29 

Bath Salts A-203, A-436, A-438, A-470 

BCMA A-04 

BCR-ABL fusion gene A-495 

BD Rapid Serum Tube B-239 

BD tube A-530 

Beckman Unicel DxI 800 B-239 

Benzodiazepines and Buprenorphine A-447 

Beta 2 Glycoproteins A-397 

Beta 2-microglobulin A-416 

beta amyloid B-240 

Beta amyloid 42 B-241 

Beta-2-microglobulin A-250 

beta-hydroxybutyrate B-282 

Bile Acids A-170 

Bilirubin B-283, B-291 

bioavailable testosterone A-328 

Bioavailable Vitamin D A-342 

Biochip B-160 

Biochip array B-152 

Bioinformatics B-153 

biologic variation B-17 

biological variability A-543 

biological variation A-290, B-209, B-284 

Biomarker A-05, A-12, A-14, A-165, 

biomarkers 

A-61, A-94, B-170, B-218 

A-27, A-400, A-542, B-177, 

B-196, B-243, B-89 

biorhythm A-355 

birthweight B-306 

Bivariate reference ranges A-308 

Bland Altman A-78 

blood A-469, A-517, B-61, B-78 

blood gas B-75, B-82, B-86 

blood gas analysis B-260 

blood gas analyzers B-272 

Blood glucose B-52 

blood lead analysis B-297 

blood mercury A-214 

blood viscosity B-337 

Blood-to-Ct A-112 

bloodstream infections A-192 

body fluid A-77, B-251 

body fluids B-300 

Bone loss A-241 

Bone marker A-347 

bone specific alkaline phosphatase A-375 

Borrelia burgdorferi B-94 

BRAF A-62 

A288



brain injury B-161 

Branch DNA technology A-97 

Brazil B-145 

breast cancer A-02, A-15, A-16, B-261 

Bronchoscopic Ultra-Micro Sampling A-34 

buprenorphine A-171 

Burkholderia pseudomallei B-126 

C 

C-reactive protein B-157, B-169, B-71 

C.difficile A-403 

C1 Inactivator A-249 

C3-Epi-25-Hydroxy- Vitamin D A-166 

C3c A-276 

C4 A-274 

C6 A-234 

CA 125 A-74 

Ca 19-9 A-72 

CA 19.9 A-74 

CA 27.29 A-16 

CA19.9 A-10 

Cables 1 A-41 

Calcium B-278, B-294 

calibration A-201, A-351 

CALIPER B-285, B-289, B-290 

Calprotectin B-113, B-164 

calprotectin andghrelin A-424 

cancer A-10, A-17, A-53, A-69, A-70, B-288 

cancer screening A-09 

Canine B-03, B-06 

Capillary electrophoresis B-244 

capillary whole blood B-71 

Carbamazepine A-441 

carbapenemases B-96 

Carboxyhemoglobin B-279 

carcinoid tumor A-313 

Cardiac B-193, B-194 

cardiac biomarkers B-195 

cardiac markers 

B-176, B-214, 

B-302, B-47, B-84 

cardiac operation B-204 

cardiac troponin A-402, B-189, B-30 

cardiac troponin I B-178, B-207, B-208, 

B-213, B-233, B-235, B-56 

cardioembolic stroke A-491 

Cardiolipins A-397 

Cardiopulmonary bypass B-63 

cardiorenal syndrome B-234 

cardiotoxicity B-195 

cardiovascular death risk A-375 

cardiovascular disease 

A-232, A-300, 

B-209 

Cardiovascular disease risk B-237 

cardiovascular risk B-192 

cardiovascular risk factors A-295 

cardiovascular surgery A-514 

Case-control study A-138 

Cataract A-124 

Catecholamines A-177 

Categories of Glucose Intolerance A-309 

Cathinones A-425 

Cathinons A-470 

CBC A-501, A-502, A-503, A-504 

CBC imaging A-519 

CD4 count B-97 

CD4 T cell B-69 

Celecoxib A-469 

Celiac A-398 

celiac disease A-240, B-287 

cell classification A-15 

Cell free DNA A-93 

Cell-free DNA A-101, A-94 

Cella Vision DM96 A-77 

Centaur A-136, B-120 

cerebrospinal fluid A-221, A-267 

cervical cancer A-131, A-38 

cervical cnacer Pap smear A-97 

Chagas disease B-133 

Chemically stabilized PCR reagents B-174 

chemiluminescence A-284, A-285 

Chemiluminescence microparticle 

immunoassay A-256 

chemiluminescent microparticle 

immunoassay (CMIA) B-133 

Chemistry A-389 

chemotherapy B-195 

childhood respiratory diseases B-127 

CHILDREN B-143, B-147 

chip card B-70 

chloride B-277, B-312 

Chloride ion B-42 

Cholesterol B-05 

chromatofocusing B-163 

Chromium A-140 

Chromogranin A A-68 

Chromosomal Microarray A-130 

Chronic Heart Failure B-201 

Chronic hepatitis B B-135 

Chronic Kidney Disease A-172, A-232, 

A-373, B-151, B-237 

Chronic liver diseases A-422 

chronic myeloid leukemia A-495 

Chronic Myeloid Leukemia (CML) A-508 

Chronic pain A-457 

Circulating DNA B-307 

circulating tumor cells A-06 

cisplatin A-64 

CK-MB B-205, B-231 

ck-mb activity B-56 

CK-MB mass B-205 

CKMB B-227 

CLART Pneumovir B-127 

Classic Galactosemia A-100 

CLEIA B-258 

CLIA A-319 

Clinical Chemistry System B-323 

clinical decision A-73 

clinical evaluation B-67 

Clinical Flow Cytometry A-493 

Clinical Laboratory A-560 

Clinical Samples B-111 

clinichip B-246 

clopidogril A-102 

closed automated system A-85 

Clostridium difficile B-142 

CLSI A-319 

CO-Oximetry B-279 

COAGULACION A-505 

coagulation A-512 

Coagulation tests A-487 

Cobalamin A-139 

Cobalt A-140 

Cobas b 101 B-53 

cobas c501 B-171 

codon 61 A-67 

coherent diffraction imaging A-15, B-261 

Cohort study A-297 

Coinhibitory molecules B-135 

collagen Type I, alpha 1 chain A-372 

colonization B-149 

Colorectal Cancers A-118 

CombiPT B-90 

community B-190 

commutability B-319 

Comparação de técnicas moleculares A-123 

Comparative Study A-72 

comparison 

A-459, A-530, B-02, 

B-203, B-211 

Comparison of multiple POC devices B-52 

Complement B-168 

Complete Blood Count A-485 

complete mitochondial genome A-13 

complicated pregnancies B-305 

COMUNICATION B-41 

Congenital disorders of glycosylation A-207 

congestive heart failure B-26 

contemporary cardiac troponin I B-220 

contrast-induced nephropathy A-377 

control B-263 

Controls B-214 

copeptin B-228 

coronary artery disease A-420, B-198, 

B-206, B-344 

coronary heart disease A-498 

coronary intervention B-43 

Corticosteroids A-435 

Cortisol A-292, A-316 

costimulatory molecules B-135 

cotinine A-157 

Coxiella B-150 

CRC A-62 

Creatine kinase B-231 

creatine kinase mb B-176 

creatinine A-377, B-269, B-77 

critica; value notification B-21 

Critical B-33 

critical values A-364 

critically ill B-99 

Critically-ill A-316 

cross-reactivity A-335, A-470 

CRP B-105 

CRRT B-278 

CSF Indices B-162 

CTC A-16 

cTnI B-191, B-264 

Cushing’s syndrome A-187 

CUSUM A-75 

Cutoff B-74 

CYP1A2*1D A-98 

CYP2C19 A-102 

CYP2D6 genotyping A-110 

CYP450 A-111 

Cystatin B-299 

Cystatin C A-416, B-03 

cystic fibrosis B-309, B-312, B-42 

cystine B-313 

cytogenetic A-408, A-419 

cytokine A-265 

cytokine profile A-242 

Cytokines B-209 

D 

D-Dimer A-477, A-491, B-152, B-206 

DART A-462 

Dead volume A-84 

Decentralised screening B-59 

Deficiency A-144, A-145 

definition of myocardial infarction B-228 

deiodinase A-307 

Delta B-194, B-208 

Delta Check A-81 

Delta-like-1 A-259 

Derivation A-179 

Derivatized A-198 

Design of Experiment A-83, B-138 

detection B-265 

Deuterium Labeled Internal Standards A-158 

development B-263 

A289



Diabetes 

A-288, A-310, A-320, 

A-323, A-341, A-387, 

A-411, B-51 

Diabetes and Hypertension A-339 

Diabetes Mellitus A-311, A-325 

Diabetic nephropathy A-371, A-96 

Diabetics A-295 

Diagnosis A-421, B-103 

diagnostic B-121 

Diagnostic Accuracy B-207, B-208 

diagnostic error B-11 

diagnostic markers A-53 

diagnostic performance A-240 

Dialysate Fluid B-66 

dialysis A-293 

diazo B-283 

Differential A-493 

differentiated thyroid cancer A-73 

differentiated thyroid carcinoma A-52 

Digital microfluidics B-72 

Digoxin A-433, A-540 

Dihydrotestosterone A-198 

Dihydroxyvitamin D3 A-194 

Direct Sampling A-84 

Disease activity A-231 

Disk diffusion B-112 

disposable B-73 

Distribuição genotípica A-123 

Distribution of patient calcium values B-276 

DNMT3B A-516 

DOAU A-439 

dried blood spot A-218, B-156, B-325 

dried blood spot (DBS) B-267 

Dried Blood Spots 

A-100, A-189, 

A-215, A-448 

Driving Transformation Change B-15 

Drug addiction A-165 

Drug development B-148 

Drug discovery A-35 

Drug of abuse A-425 

drug screen A-440 

Drug Screening A-180 

Drug-drug interactions A-456 

drugs of abuse A-466 

Drugs of abuse screening A-429 

duloxetine A-533 

DxC B-341 

DxH A-492 

E 

Early-morning urine A-376 

EDTA A-101 

eGFR B-77 

EGFR mutation A-34 

elderly A-353, A-94 

elderly women A-144 

Electrochemical B-88 

electrodeposition A-116 

electrophoresis B-327 

Elevated blood lead (EBL) A-464 

ELISA 

A-234, A-243, A-539, 

B-113, B-171, B-185 

ELISPOT B-94 

emergency department A-402 

empirical treat B-147 

End Point B-280 

Endocrine B-289, B-290 

endoscopic retrograde 

cholangiopancreatography A-424 

endothelial dysfunction A-154, B-223 

endothelial microparticles B-223 

Endothelin B-218 

endothelin -1 A-388 

endotoxin A-388 

Enhanced Liver Fibrosis A-404 

Enhanced Liver Fibrosis (ELF) A-422 

Enterobacteriaceae B-96 

Entherpex B-141 

Environmental effects A-547 

Enzymatic assay A-468 

enzymatic combination assay B-317 

enzymatic ethylene glycol assay A-437 

enzyme immunoassays (ELISA) B-133 

Enzyme levels A-535 

Enzyme method B-44 

Enzyme-Linked Immunosorbent Assay) A-68 

Epidemiologic study B-145 

EPOC B-55 

EQA B-18 

Equipment B-37 

erectile dysfunction A-154 

Error A-558, A-560 

Error detection B-68 

errors B-85 

Errors in Laboratory Medicine B-12 

erythrocyte 6-thioguanine A-164 

erythropoietic protoporphyria A-482 

Esophageal cancer A-61 

estimated average glucose A-302, A-348 

estradiol A-281, A-332, A-360 

Estrogens A-168 

etanercept A-246 

Ethanol A-550 

ethylene glycol A-437 

eukaryote-made Taq polymerase B-102 

Evaluation A-315, A-89 

Evaluation of differences between lots of 

reagent B-276 

Everolimus A-159, A-451 

exogenous insulin A-335 

exosomes A-66 

Experimental Design A-208 

External Quality Assessment B-65 

Extractable A-556 

Extraction A-125 

extraction devices B-260 

F 

FABP1 B-159 

Factor V A-506 

false positive B-108, B-210 

FBP-interacting repressor A-09 

Fecal Bile Acids B-331 

fecal calprotectin B-64 

Federal District (Brazil) B-118 

Felbamate A-202 

ferritin B-167 

Fetal Aneuploidies B-293 

Fetal Lung Maturity B-304, B-308 

FFPE A-181 

Fibrin B-200 

Fibrin monomer complex A-491 

Fibrosis B-201 

figurative erythema A-313 

Filamin A A-453 

filter paper B-267 

First Degree Relatives A-338 

FK506 A-445 

FLC A-20 

flow cytometry A-386 

FLT3 mutation A-29 

fluorouracil A-446 

fMRI A-391 

FOB A-47 

folate A-135, B-16 

folate fortification B-16 

Folic acid A-138 

forensic analysis A-475 

Format B-58 

fractionation A-432 

Framingham B-332 

Free A-168 

Free and Total A-167 

Free light A-258 

free light chain A-19, A-22, A-261 

Free Light Chains 

A-229, A-231, A-232, 

A-60, A-63 

free testosterone A-328 

free thyroid hormones A-307 

Free thyroxine A-529 

Free-glycerol B-320 

Freelite A-20, A-253, A-273 

Freidewald Equation B-336 

FREND B-172 

frequency B-144 

fungi Identification A-212 

G 

Galectin-3 B-177, B-201, B-322 

GC-MS A-438 

gc/ms A-440 

GEM B-280 

Gene expression A-112 

genelyzer B-246 

genes NPM1 and FLT3 A-129 

genome A-135 

genotyping A-131 

Gestational Diabetes A-297 

GGT A-477, A-510 

Ginseng A-433 

Gliadin A-398 

Global Health A-367 

glomerular filtration rate A-174 

Glucagon stimulating test A-330 

glucometer B-60 

glucose A-303, A-311, B-245, B-272 

glucose meter B-67, B-81 

glucose monitoring B-60 

Glycan Profiling A-207 

glycated hemoglobin A-290, A-320 

Glycosylation B-255 

Gold nanoparticles A-17 

gonadotrophic A-358 

Gram Stain A-386 

Graves’ ophthalmopathy A-321 

Growth hormone A-327 

growth hormone deficiency A-330 

GWAS A-410 

H 

H-FABP B-191 

haematological disorders A-19 

haematology B-48 

Hand-held B-88 

haplotyping A-103 

haptoglobin B-172 

harmonization A-322 

HAVAB-G A-399 

Hb A1c A-314, A-387 

HbA A-21 

HbA1c A-288, A-323, A-341, A-344, A-348, 

A-352, A-527, A-537, A-92, B-44, B-53 

HBsAg A-415, B-120 

HBV B-100, B-110 

HBV DNA A-415 

hCG B-50 

HCII A-500 

HCV A-123 

A290



HCV infection A-132 

HCV, hepatitis C infection B-345 

HDL B-321 

HDL-C B-341 

HDL-cholesterol B-252 

HE4 A-11 

Health Risk Assessment A-151 

healthy A-266 

Healthy children B-310 

heart failure B-177, B-196, B-218, B-238 

heart type fatty acid binding protein B-302 

Heart-type fatty acid binding protein 

(H-FABP) A-379 

Heart-type fatty acid-binding protein B-204 

heavy/light chain A-03, A-44 

hematocrit A-218, B-73 

Hematology A-479, A-493, A-501, A-502, 

A-503, A-504, A-518, A-519, B-04 

Hematopoietic Stem Cell 

Transplantation B-302 

Hemodialysis A-304 

hemodialyzed patients A-375 

Hemoglobin A-323 

hemoglobin A1c 

A-302, A-303, A-311, 

A-315, B-51 

Hemoglobin D A-527 

Hemoglobin J A-344 

Hemoglobin variant A-344 

Hemoglobin Variants A-315 

Hemolysis A-528, A-534 

hemostatic alterations B-57 

HEp-2 A-255 

Heparin A-494 

Hepatic fibrosis A-422 

Hepatitis A-415 

Hepatitis A A-399 

Hepatitis C A-404, B-140 

hepatitis C virus A-256 

hepatocellular carcinoma A-12, A-27, A-33 

hepatorenal syndrome A-392 

heroin A-171 

herpes virus B-141 

Hevylite A-258 

Hevylite Chain Assay A-257 

HFRS A-287 

High Resolution A-180 

high resolution Orbitrap A-169 

high risk HPV E6/E7 mRNA A-97 

high sensitive B-182 

high sensitive C-reactive protein (hsCRP) 

A-379 

High Sensitive Troponin I B-193 

High Sensitive Troponin-I B-194 

High sensitivity B-215, B-216 

high sensitivity Cardiac Troponin T B-188 

High Throughput A-161, A-193 

High-density Lipoprotein B-323, B-327 

High-performance liquid 

chromatography A-473 

high-resolution computed tomography B-95 

High-sensitivity B-175, B-219 

high-sensitivity cardiac troponin I 

B-179, 

B-220 

high-sensitivity cardiac troponin T B-179 

high-sensitivity cTnT B-176 

High-Sensitivity Troponin T B-184 

High-Throughput A-191, A-216, A-88 

Highly sensitive assay A-34 

histoplasma antigen B-114 

histoplasmosis B-114 

Hitachi LABOSPECT 008 B-254 

HIV 

A-270, B-115, B-125, 

B-145, B-69, B-90, B-97 

HIV-1 B-108 

HLA-DP/DQ B-110 

homocysteine B-217, B-281 

hormonal tests A-358 

Hospital Acquired Infections A-403 

hospital admission A-402 

hospital discharge A-390 

HPLC 

A-137, A-162, A-299, A-305, A-314, 

A-482, A-527, B-163, B-295 

HPLC column A-204 

HPLC-MS/MS B-79 

HPLC-UV A-427 

HPV A-38, B-101, B-111, B-118, B-246 

HPV genotyping B-118 

HRM A-111, B-100 

hs CRP A-343 

hs-TnI B-211 

hs-TnT B-211 

HTLV B-119 

HTLV infection B-119 

HTLV-1/2 B-119 

human antisera B-155 

human error A-540 

Human Papillomavirus A-107, A-131, A-28 

hva A-199 

Hybrid XL A-85 

hydrocodone A-439 

hydroxychloroquine A-444 

Hyperferritinemia A-124 

Hypergammaglobulinemia A-271 

Hypertension B-337 

Hyperthyroidism A-317 

hypertrophy B-185 

Hypokalemia A-528 

Hyponatremia B-273 

Hypothyroidism A-308, A-317, B-34 

I 

I A-220 

i-STAT B-55, B-63 

I/D polymorphism of ACE gene A-117 

ICP A-214, A-220 

ICP-MS A-140, A-432 

ICU B-82 

Identification A-190, B-144 

idic(Xq) A-108 

iFOB A-21 

IgA A-248 

IgA subclasses A-275 

IgE A-224 

IgE level A-228 

IGFBP-4 fragments B-192 

IgG A-272 

IgG4 A-227, A-277 

IGRA A-230 

IL-21-JAK/STAT signaling pathway B-100 

IL6 A-26 

Imaging A-479, A-501, A-502, A-503, A-518 

IMMULITE 2000 XPi B-258 

Immune Cell A-188 

Immunoassay 

A-11, A-153, A-175, 

A-21, A-248, A-249, A-252, 

A-253, A-272, A-273, A-274, A-275, 

A-276, A-277, A-284, A-291, A-314, 

A-329, A-340, A-345, A-467, A-474, A-538, 

A-72, B-158, B-192, B-248, B-88 

Immunoassays A-316, A-380, B-159, B-160 

immunoblot A-256 

ImmunoCAP® A-228 

immunochromatography B-104 

immunocomplex A-340 

Immunofluorescence A-255, A-260 

Immunofluorescence test A-233 

Immunoglobulin A-227, A-362, B-168 

immunoglobulin free light 

chains A-270, A-51 

immunoglobulin gene rearrangement A-225 

immunohistochemistry A-31 

Immunoprecipitation B-321 

immunosuppresant A-434 

Immunosuppressant A-184, A-191, A-448 

Immunosuppressants A-430, A-80 

immunosupressant B-24 

Immunoturbidimetric assay B-164 

Implants A-483 

imprecision B-220 

Improve Laboratory efficiency B-15 

in-house method B-141 

Inborn Error of Metabolism A-207 

Inclusion/Exclusion A-122 

indeterminate A-230 

Indices A-534 

indirect immunofluorescent A-407 

Infection A-388, B-300 

infection control B-39 

infectious disease B-129 

Infectious diseases B-109 

infertilty A-337 

Inflammation A-238, B-255 

Inflammatory Biomarkers B-151 

inflammatory bowel disease B-64 

Inflammatory process A-373 

infliximab A-163, A-461 

influenza B-104 

Informatics A-81 

inguinal hernia A-372 

Inhibin A ELISA A-350 

Inhibin b A-284 

Inhibition A-551 

iNOSoxy A-483 

Insulin B-296 

Insulin analogues A-178 

Insulin resistance A-300, A-312, B-345 

Insulin-Induced Hypoglycemia 

Provocative Test A-327 

Insulin-like growth factor-1 A-312 

Integration A-352 

interference A-537, B-200 

INTERFERENCES A-47 

interferon gamma release assay A-242 

Interferon-γ release assay B-95 

Interferon-gamma B-94 

interleucine B28 B-140 

intermediate-risk cytogenetics A-99 

internal quality control frequency A-561 

Interpretation A-558 

Interstitial pneumonia A-237 

intervention A-364 

Intestinal parasites B-117 

Intrinsic factor antibodies A-538 

Intrinsic Factor Blocking Antibody A-139 

Iohexol A-465 

Ion Suppression A-158 

Ionization A-179 

Ionized B-278 

iothalamate A-174 

IQC B-18 

Iron A-124 

Iron Deficiency A-485, A-525 

Iron deficiency anemia B-167 

Irritable bowel B-331 

Ischaemic stroke B-160 

Ischemia-modified albumin A-317 

ischemic heart disease B-223 

ISE B-277 

Isoforms B-329 

isotope dilution mas spectrometry A-155 

IVS2-2 Mutation A-100 

A291



K 

k light chain A-267 

karyotipe A-419 

karyotype A-129, A-408 

Keppra A-452 

ketoacidosis B-83 

Ketostix B-83 

Key Performance Indicators B-29 

kidney A-393 

Kidney transplant patients A-376 

kinase-fusion transcript A-46 

KL-6 A-237 

KPC B-124 

KRAS A-67 

Kryptor A-346, A-43 

L 

Lab Automation A-82 

lab errors B-40 

laboratory B-39 

laboratory automation A-76 

Laboratory blood gases analysis B-275 

Laboratory Capacity A-367 

laboratory error A-520 

Laboratory Information System B-38 

Lacosamide A-156 

lactate B-17, B-247, B-49 

lactate:pyruvate (L:P) ratio B-247 

Lamellar body counts B-308 

large buoyant LDL B-343 

Latex particle-enhanced turbidimetric 

immunoassay B-167, B-173 

latex-enhanced immunoturbidimetric 

assay A-237 

LC-MS A-204 

LC-MS/MS 

A-110, 

A-156, A-159, A-163, A-171, A-175, A-202, 

A-203, A-210, A-215, A-218, A-292, A-294, 

A-329, A-332, A-37, A-435, A-469, A-476, 

A-80, B-222, B-256, B-267 

LC-MS/MS method development A-160 

LC-TOF-MS/MS A-205 

LC/MS/MS A-164, A-176, A-471 

LC/MSMS A-450 

LC/TOF A-180 

LDH A-535 

LDL B-333 

LDL-cholesterol B-332, B-336 

LDL-Particle B-333 

Leachable A-556 

lead B-297 

LEAN A-82 

Lean methods B-30 

LEAN principle B-15 

lectin-like oxidized LDL receptor-1 gene 

polymorph A-381 

Leptin A-300, B-296 

leucovorin A-459 

Levels A-148 

Levetiracetam A-452 

LH500 B-63 

Light chain A-227 

light protection A-533 

Lin28 A-283 

Lipemia A-550 

Lipid A-472, B-02 

Lipid hydroperoxide A-186 

lipid lcmsms B-330 

Lipid profile B-212, B-325 

Lipid quantitation B-330 

lipids B-332, B-53 

lipoprotein A-186 

Lipoprotein (a) B-339 

Lipoprotein Associated 

Phospholipase A2 B-198 

lipoprotein subfractions B-343 

Lipoprotein(a) B-328 

Lipoprotein-Associated Phospholipase A2 

Activity B-316 

Lipoproteins A-547 

Liquid assay B-212 

liquid chromatography A-216 

Liquid chromatography tandem mass 

spectrometry A-429 

liquid chromatography-tandem mass 

spectrometry A-174 

Liquid control A-532 

Liquid-based cytology A-38 

Liver Fibrosis A-404 

liver transplantation A-521 

LMWH A-494 

LOCI A-551 

logistic regression A-75 

Lovastatin A-453 

low sigma B-19 

lower respiratory tract infection A-423 

LOX-1 B-326 

Lp-PLA2 Activity B-316 

lung adenocarcinoma A-31 

Luteinizing hormone B-50 

Lyme A-234 

lymphocyte B-97 

Lysosomal storage diseases B-72 

M 

macroenzyme B-155 

Macroenzymes A-271 

Macrophage A-453 

macroprolactin A-298 

Magnesium A-310, A-368 

magnetic biosensor B-264 

Major depressive disorder A-187, A-366 

Malaria 

MALDI-TOF 

B-103, 

A-190, A-192, 

A-196, A-211, A-212 

Management B-20, B-37 

Management system B-29 

MAPK B-259 

mass A-186 

mass accuracy mass spectrometry A-475 

Mass spectometry A-197 

mass spectrometry A-146, A-152, A-157, 

A-161, A-166, A-167, A-168, A-170, A-173, 

A-181, A-183, A-184, A-193, A-195, A-196, 

A-198, A-208, A-211, A-212, A-217, A-219, 

A-281, A-305, A-307, A-324, A-425, A-444, 

A-448, A-454, A-457, A-458, A-462, B-153, 

B-169, B-244, B-331 

Mathematical Modeling A-485 

Matrix Effects A-158 

Matrix Gla Protein A-304 

Matrix metalloproteinase 9, MMP-9 B-305 

Matrix Metalloproteinases A-354 

MB fraction of creatine kinase B-233 

mean platelet volume A-510 

Measure A-558 

melanoma A-66 

MEN2A B-307 

Mephedrone A-203 

mercury A-214 

mesothelial cell A-374 

metabolic B-78 

Metabolic syndrome 

A-301, A-339, 

B-125 

Metabolism A-359 

metabolomics A-12 

metalloproteinases A-325 

metals urine A-220 

metanephrine A-200, A-299 

Methadone half life A-456 

Methamphetamine B-244 

Methanol A-468 

Method A-465 

Method Comparison 

A-172, A-257, A-345, 

B-297, B-49, B-76 

Method Development A-208, A-221 

Method Evaluation A-512, B-227 

method validation A-434 

Methods comparation B-111 

Methotrexate 

A-454, 

A-455, A-459, A-474 

methylone A-438 

mi-RNA A-66 

Mice A-472 

micro-fluidic B-248 

Microarray A-61 

Microarray reproducibility A-130 

microbiological assay A-137 

Microbiology A-190, A-197 

microbiology diagnostic A-192 

microelectrodes A-116 

Microfluidics B-42 

microRNA A-106 

Microsatellite Instability A-118 

Microtiter Plate A-539 

Microvascular Complications A-354 

mid-regional pro-adrenomedullin A-423 

Midstream B-58 

minimum sweat weight B-309 

miR-638 A-30 

MiRuDa B-257 

miscarriages A-419 

Mitsubishi Pathfast B-207 

MMT programs A-456 

modified LDL B-326 

Molecular detection A-225 

Molecular Diagnostic 

A-125, A-126, 

B-116, B-138, B-139 

Molecular Diagnostics B-174, B-266 

molecular markers A-99 

monitoring A-03, A-44 

monoclonal A-229, B-113 

monoclonal antibodies 

A-163, B-159, 

B-191, B-243 

monoclonal gammopathy A-254 

mosaicism A-109 

Mountain plot A-78 

MRSA A-403, B-121 

MSI Analysis System, version 1.2 A-118 

MSIA A-178 

Müllerian Inhibiting Substance A-360 

multi-analyte B-248 

Multi-analyte control A-532 

Multi-center A-229 

Multi-center comparison B-262 

Multi-Ethnic Study of Atherosclerosis 

(MESA) A-411 

multifocal hemorrhage B-57 

multiparameter analyzer A-89 

Multipass membrane proteins B-243 

multiple myeloma A-03, A-04, A-22, A-225, 

A-258, A-44, A-496, A-515, A-60, A-63 

multiple sclerosis A-267 

Multiple Weigted Least Squares 

Regression B-52 

multiplex A-53, B-54 

multiplex PCR A-46, A-69, A-70 

Multiplex real-time PCR A-107 

A292



Multispecies B-04 

mutation B-259 

Mutation BRAFV600E A-296 

mycobacterial B-144 

Mycophenolic Acid A-458 

Mycoplasma B-137 

myeloma A-257, A-484, A-51 

myeloproliferative disorders A-508 

myocardial damage cut-off B-213 

myocardial infarction B-179, B-202, B-233 

Myocardial Ischemia B-188 

myostatin B-185 

N 

N-acetylcysteine B-07 

N-linked glycosylation A-14 

N-Terminal Pro-B-Type Natriuretic 

Peptide B-184 

NADPH A-310 

nasopharyngeal carcinoma A-28 

NAT2 A-103 

Neat samples B-158 

negative predictive value B-182 

Neonatal screening A-552 

neonate B-75 

nephrotic proteinuria A-254 

nephrotoxicity B-07 

Network A-389 

neuroblastoma A-64 

Neurologist A-391 

neutrophil gelatinase lipocalin B-270 

neutrophil gelatinase-associated 

lipocalin A-365 

Newborn screening B-72 

next generation A-251, A-278 

Next-generation sequencing B-293 

NGAL A-244, A-543, B-171 

nicotine A-157, A-431 

Niemann-Pick C1-Like 1 A-105 

NJ001 specific antigen A-31 

NMR B-245, B-255 

NO A-116 

Non invasive prenatal diagnosis B-307 

non mosaic A-108 

non-glucose carbohydrates B-272 

Non-Human Primate, Rodent, Equine, 

Bovine, Canine B-09 

Non-linear Equation B-336 

Non-targeted acquisition A-205 

Noninvasive prenatal test B-293 

Notch signaling A-259 

notification process B-21 

NSCLC A-46 

NT-proBNP B-06, B-221, B-26 

Nuclear magnetic resonance (NMR) A-411, 

A-547 

Nucleases A-101 

O 

Obesity A-531 

Olanzapine Pharmacogenetics A-98 

Oligoclonal Bands B-162 

Oligomenorrhea A-337 

open neural tube defect B-288 

Operator A-555 

Opiates A-471 

Opportunistic screening A-289 

optical B-78 

Orbitrap mass spectrometer B-318 

Osmolality A-544 

osmotic demyelination syndrome B-273 

Osteocalcin A-347 

Outcome B-175, B-230 

OVA1 A-26 

Ovarian A-26 

Ovarian cancer A-238 

Ovarian cancer biomarker A-11 

Ovarian carcinoma A-41 

Ovarian Mucinous Cancer A-74 

ovarian reserve A-350 

Ovarian reserve assessment A-349 

overutilization A-92 

ovulation B-45, B-50 

Oxcarbazepine A-441 

oxidation A-293 

oxidative stress A-395, B-344 

Oxidative stress parameters A-420 

Oxidized lipoprotein B-328 

ozone therapy B-07 

P 

P2Y12 receptor A-522 

Pain management A-162 

pain medication A-439 

Paired t-Test, ANOVA,Tests for 

Normality B-276 

PANACLEAR MMP-3 “Latex” B-254 

pancreatic A-10 

pancreatic elastase in feces A-331 

Pancytopenia A-524 

panic B-33, B-41 

Paper Spray Ionization A-189 

Papillary thyroid carcinoma A-296 

Paraoxonase 1, Arylesterase B-344 

paraoxonase family A-420 

Parathyroid hormone A-183 

Paricalcitol A-373 

Paternity test A-122 

Patient identification B-12 

patient safety A-364, B-12, B-21 

patients with daiabetes mellitus A-331 

Pb A-464 

PCR 

A-125, B-121, B-124, 

B-142, B-143, B-250, B-95 

PCT B-105 

pediatric B-284 

pediatric population B-287 

Pediatrics B-189 

Peditubes A-84 

Pemphigus A-265 

pending tests A-390 

Performance Evaluation A-88 

Peri- analytics A-90 

peri-menopausal transition A-349 

perinatal B-300 

Periprosthetic Joint Infection B-170 

peritoneal dialysis A-374, B-146 

peritonitis A-374, B-146 

pH A-545 

pharmacogenetics A-102 

Pharmocogenetics A-111 

Phenotype B-156 

Phenotypic and genotypic character B-126 

phenylalanine B-295 

Pheochromocytoma A-177 

phlebotomy A-520, A-536, A-554 

phospholipase D B-317 

Phosphoproteome A-188 

Photothermal therapy A-17 

phylloquinone A-152 

Pimozide A-473 

Piperine A-472 

Pipette A-555 

Placenta B-296 

plasma A-200, B-210 

plasma cell dyscrasias A-51 

Plasma lipids B-59 

plasmatic catecholamines B-180 

Platelet A-504, A-510 

platelet catecholamines B-180 

Platelet Function A-480 

Platelet Function Testing B-74, B-76, B-80 

Platelet Inhibition B-80 

platelet reactivity A-499 

Platelet resuspension A-546 

platelets A-522 

Pleural Fluid B-86 

PlGF A-346 

PNA B-101 

PNA array B-101 

Pneumatic tube A-535 

pneumococcal capsular 

polysaccharide A-243 

Pneumonia B-137 

POCT B-44 

podocytes A-96 

point B-69 

Point of care 

B-203, B-205, B-266, 

B-47, B-48, B-54, B-82, B-86 

Point of care glucose B-65 

point of care test B-64 

Point of care testing 

B-275, B-43, 

Point-of-Care 

B-84, B-87 

B-103, B-221, B-60, 

B-71, B-75, B-77 

POLIMYXIN B-124 

Polyclonal antibody A-441 

Polycyclic aromatic hydrocarbons A-222 

Polycystic Ovaries Syndrome A-312 

polycystic ovary syndrome A-286 

Polyethylene glycol A-362 

Polyethyleneglycol precipitation A-298 

Polymer A-556 

Polymerase Chain Reaction – Restriction 

Fragment L A-105 

polymorphism A-283, A-372, B-110 

Polymorphisms A-516 

Posaconazole A-449 

post PCI myocardial infarction B-228 

post transplant lymphoproliferative 

disease A-261 

Potassium A-528 

Pre-Amplification A-112 

pre-analytical A-91, B-35 

Pre-analytical conditions A-541 

Pre-analytical errors B-279 

Pre-eclampsia A-346 

pre-eclampsia, small for gestational age 

infants B-305 

Prealbumin A-251 

preanalytic automatic sample preparation 

B-164 

Preanalytical influence of sample 

temperature B-301 

preanalytical variability A-520, A-536, A-554 

Preanalytical variables A-560 

Precision goals A-487 

Preclinical species A-176 

Predicting B-280 

Preeclampsia A-138, A-381 

Pregnancy A-170, A-476, B-306, B-45, B-58 

Pregnancy Associated Plasma 

Protein A, Free b-hCG B-301 

pregnant B-149 

pregnant women A-348 

Prenatal screening for chromosomal 

abnormalities B-301 

preterm infants B-299 

Prevalence B-117 

A293



primary care setting B-81 

Primary hyperparathyroidism A-289 

Principal component analysis A-322 

procalcitonin A-378, A-423, B-10, B-129 

process improvment B-24 

Product of calcium and phosphorus B-237 

productivity B-38 

Proficiency testing B-65 

prognosis A-410, B-182, B-196 

prograf A-445 

progranulin A-286 

Prolactin A-334, A-337 

prolactinoma A-326 

Promoter A-41 

Pronostic value A-63 

Prosomatostatin B-238 

Prostaglandins F2 Alpha A-219 

prostate cancer A-14, A-37, A-58 

Prostate Cancer Aggressiveness A-05 

prostate- specific antigen B-70 

prostate-specific antigen A-48 

prostatic hyperplasia A-58 

protein electrophoretic profile A-58 

protein precipitation plate A-143 

proteins B-163 

Proteomic A-183 

proteomics A-221, A-27 

Prothrombin A-512, B-154 

Prothrombin Time A-486 

Prothrombinase A-506, B-154 

Proton Pump Inhibitor(PPI) A-368 

Protoporphyrin A-482 

PRU B-80 

PTH A-293 

Puberty A-358 

pulmonary embolism A-477 

Pyridoxal 5-phosphate A-141 

Pyridoxic acid A-141 

Pyrosequencing A-67 

pyruvate B-247 

Q 

Q Fever B-150 

QC rules B-19 

QMS everolimus assay A-451 

Qnr B-123 

Quality B-20, B-251, B-85 

Quality assessment B-81 

quality assurance A-380, B-18, B-40 

Quality Control 

A-486, A-487, A-532, A-75, 

B-109, B-19, B-59, B-68 

Quality Control Design A-559 

quality improvement B-40 

Quality Performance B-14 

Quality Specifications B-284 

quantification A-178, A-442 

Quantitative B-120 

quantitative assay B-70 

quantitative determination A-449 

quantitative immunoassay B-172 

R 

RAAS A-287 

radiosensitivity A-28 

Ranges A-389 

RANTES B-158 

Rapamune A-159 

RapidFire A-447 

RAPIDPoint 500 B-66 

Rat plasma A-165 

RBC A-517 

re-hospitalization A-390 

Reaction Curve Fitting method B-257 

real time B-140 

Real time PCR A-62 

Recalibration B-291 

Red Cell Indices A-525 

red cell lifetime A-302 

reference change value A-290, A-387 

reference interval A-224, A-298, A-431, 

A-531, A-68, B-289, B-290, B-294 

REFERENCE INTERVALS A-173, A-292, 

B-189, B-285, B-310 

reference material B-169, B-269 

reference method B-166 

reference population B-213 

Reference range A-318, A-480, B-183 

Reference value A-334, A-363 

reliability evaluation B-257 

Remnant lipoproteins B-340 

Renal A-416 

Renal Fibrosis B-322 

renal function B-299 

Renal transplant A-451 

renal transplantation A-241, A-263 

renal vasoconstriction A-392 

Repiratory Distress Syndrom B-304 

resource-limited B-20 

respiratory distress syndrome B-308 

respiratory virus A-126, B-127 

Response pattern B-68 

retinol-binding protein B-234 

Retrospective data analysis A-205 

Rheumatoid arthritis B-254 

Rifampin A-442 

RiLiBAEK A-561 

Risk factors A-241 

risk index A-521 

risk management A-533 

Risk prediction A-297, B-178 

risk stratification B-206, B-74 

risk-analysis B-99 

risk-stratification A-394 

RLP B-340 

RLP-C B-340 

RNA B-250 

RNA isolation B-139 

RNase L A-188 

Robust Method B-183 

Roche A-147, A-460 

Roche Modular P A-452 

ROMPlus B-61 

routine A-197 

routine screening B-217 

RPR B-98 

RT-PCR A-29, B-123 

Rthnic groups B-115 

RX monaco B-212, B-231 

S 

S100B B-161 

salicylate B-277 

Salting-out Liquid/Liquid Extraction A-450 

Sample Flow A-91 

Sample preparation A-195, A-471, A-83 

sample stability B-260 

sample type A-540 

Sarcosine A-37 

Schistosomiasis A-524 

Screening A-19, A-421, A-47 

Seasonal variation A-355, A-356 

sediment B-313 

Selected reaction monitoring B-329 

send-out testing B-11 

sensitive A-43, B-202, B-265 

sepsis 

A-400, B-10, B-102, 

B-129, B-49, B-89, B-99 

septic shock B-89 

sequencing A-13 

serial B-56 

Serology B-137, B-150, B-287 

Serology Controls B-109 

serum A-461 

Serum biomarker A-04 

Serum Calcium A-289 

serum concentration A-98 

Serum free light chain ratio A-484 

Serum gel barrier formation A-548 

serum ketones B-83 

Serum Protein Electrophoresis B-115 

Serum soluble transferrin receptor A-295 

Sex B-186 

sex determination A-553 

Sex Hormone Binding Globulin A-309 

SHBG A-328 

SIEMENS B-66 

sIgE A-245 

Sigma Metric B-14 

Sigma Statistics A-486 

silver amplification B-104 

Simoa B-219 

simulation A-303 

single nucleotide polymorphism A-105, 

A-106, A-498 

sirolimus stat proteins A-263 

SIRS A-400 

SLE A-231, A-244 

small dense LDL B-337, B-343 

smoking A-02 

SNP A-410 

SNP genotype A-130 

Software A-81, B-37, B-39 

Solid Phase Extraction A-435 

Soluble CD 163 A-301 

Soluble cytokine receptors B-151 

soluble lectin-like oxidized LDL 

receptor-1 A-381 

sorting A-91 

SPE B-79 

SPE/MS/MS A-447 

Species differences B-05 

Specific Protein B-168 

specificity B-90 

Specimen Collection A-430 

specimen processing A-76 

Specimen processing control B-116 

SPEP A-92 

spermatogenesis A-350 

sphingomyelin B-317 

Spice Synthetic Cannabinoids A-466 

Splenomegaly A-524 

Spreadsheet program A-78 

SR-BⅠ gene A-498 

Srum protein electrophoresis A-254 

SSRI A-366 

stability A-245, A-544, A-545, B-235, B-252 

Standardization A-136, A-280, A-351, B-320 

Statistical analysis B-310 

Statistical Analysis Precision A-492 

statistics A-464, B-252 

Steroids A-179, A-281, A-324, B-79 

stone B-313 

Stool sample B-117 

STR A-122 

Streptococcus agalactiae B-149 

Stroke B-153 

Sub-pg/mL Quantitation A-210 

A294



Subclinical hypothyroidism A-308, A-353 

Succinylacetoacetate B-292 

Succinylacetone B-292 

Surface Chemistry B-266 

surface plasmon resonance A-461 

sweat B-312 

sweat chloride B-309 

Synchron B-341 

synthetic cannabinoids A-440, A-450 

Syphilis A-421, B-98 

Sysmex UF-1000i A-386 

Sysmex XE5000 A-77 

systemic inflammatory response 

syndrome A-392 

systemic lupus erythematosus A-223, A-244 

T 

T lymphocytes A-265 

T regulatory cells A-515 

T-helper 1 cells A-496 

T-helper 17 cells A-496, A-515 

Tacrolimus A-189, A-434, A-445 

Tamoxifen A-110 

tandem mass spectrometry A-162, A-177 

target DSY14 A-553 

Targeted lipid analysis B-330 

tau B-240, B-241 

TDM A-446 

Technique A-555 

temperature A-245, A-544 

temperature stability B-35 

test utilization A-146, B-16 

test validation B-114 

test-utilization B-26 

testing A-153 

Testosterone 

A-167, A-193, A-215, A-329, 

A-332, A-339, A-345 

Th17 cells A-263 

Thalassemia A-525 

The JAK2 V617 mutation A-508 

Therapeutic Drug Monitoring A-430 

Three dimensional spheroids A-35 

Thrombin A-506, B-154 

thrombin receptor A-522 

thromboelastometry B-57 

thrombophilia A-514 

Thrombosis A-483 

throughput A-90 

thyroglobulin A-43, A-52, A-73 

thyroglobulin antibody A-52 

Thyroid A-195, A-210, A-291, A-333 

Thyroid hormones A-176, A-359, A-363 

thyroid stimulating hormone A-322 

thyroxine A-279 

Thyroxine binding proteins A-529 

Tissue Inhibitors of Metalloproteinases A-354 

Tm mapping method B-102 

TNF A-393 

TNF-alpha A-286 

TNF-inhibitors A-246 

TNFa A-371 

TNFA polymorphism A-371 

TNI B-186 

TNT B-186 

Toll-like receptor A-238 

Topiramate A-467 

Total Cholesterol B-323 

Total Error A-552 

Total iron binding capacity A-481 

Total Nucleic Acids B-116, B-138, B-139 

Total protein A-548 

total vitamin D status A-331 

Tourette Syndrome A-473 

Toxic alcohol A-468 

toxicology A-475 

toxin A and B B-142 

TPLA B-98 

traceability A-155, B-38 

transference B-285 

Transferrin A-278, A-481 

transfusion A-521 

Transglutaminase A-398 

transplant A-261 

transplantation A-393, A-93 

transportation B-35 

Transthyretin A-359 

Trauma B-157 

Treatment A-436 

Triacylglycerol hydroperoxide B-318 

triazole antifungal A-449 

Triglycerides B-320 

triiodothyronine A-279 

trisomy 8 A-109 

trisomy X A-109 

troponin B-190, B-202, B-203, B-210, B-214, 

B-215, B-216, B-219, B-221, B-230 

Troponin I 

A-551, B-175, B-200, B-227, 

B-239, B-87 

Troponin T B-87 

Trypanosomiasis B-148 

TSH A-291, A-333, A-355, A-362, A-363 

TSH follow up B-34 

tuberculosis A-106, A-230, A-242 

Tubulin inhibitors B-148 

tumor marker A-69, A-70 

tumor markers A-48 

tumor suppressor miRNA A-30 

turbidimetric A-248, A-249, A-252, A-253, 

A-272, A-273, A-274, A-275, A-276, A-277 

turbulent flow liquid chromatography A-444 

Turn Around Time A-82, B-30 

turn-around-time B-24 

turnaround time A-76 

Turner Syndrome A-408 

Type 1 Diabetes Mellitus A-343 

type 2 diabetes A-283 

Type 2 diabetes mellitus A-301, A-338 

tyrosine B-295 

Tyrosinemia type I B-292 

U 

UA/NSTEMI B-184 

ultra-high Performance Liquid 

Chromatography A-465 

Ultrafast Laser B-261 

Undiagnosed Diabetes A-309 

UPLC A-442, A-454, A-458 

Urinalisys A-87 

urinalysis B-106 

urinary catecholamines B-180 

Urinary free cortisol A-187 

Urinary Magnesium A-368 

Urinary Thromboxane B-222 

Urinary tract infection B-147 

urine A-429, B-161, B-269, B-322 

urine bacterial culture B-106 

urine drugs testing A-169 

Urine Preservation A-542 

Urine toxicology A-457 

Uterine leiomyomas A-117 

utilization management B-11 

V 

V tube A-530 

Vaccine responce A-243 

vacuum tubes A-536, A-554 

validation 

A-126, A-427, A-455, 

A-480, A-492, 

A-87, B-242, B-251, B-259 

VALUACION ACTIN FSL A-505 

Values B-33, B-41 

vanadate B-283 

variability A-377 

Variant A-352 

Vascular calcification A-304 

Vascular diseases B-328 

vaspin A-326 

vernix A-462 

Veterinary B-02 

viral hemorrhagic fever B-54 

VIRAL INFECTION B-143 

Vitamin B12 A-139, A-538 

vitamin B6 A-137, A-141 

Vitamin B6 and B12 A-135 

vitamin C A-143 

vitamin D 

A-136, A-144, 

A-146, A-147, A-148, A-151, A-153, A-154, 

A-172, A-175, A-216, A-280, A-294, A-305, 

A-321, A-340, A-353, A-539, B-256, B-294, 

B-306 

Vitamin D 25 Hydroxy A-342 

vitamin K1 A-152 

Vitamina D A-356 

Vitamine D A-145 

Vitamins A-217 

Vitek 2 B-112 

VITEK2 System B-126 

Vitros A-460 

VLDL B-318 

vma A-199 

W 

Waist Circumference A-531 

Water and Fat Soluble A-217 

WCC B-105 

weeks estimation B-45 

WHO/IFCC reference material 

SRM2B B-339 

whole blood B-264 

Women A-148 

A295

Abstracts of the Scientific Posters, 2013 AACC Annual Meeting ...

Create successful ePaper yourself

Delete template?

Save as template?