FEBS Letters 358 (1995) 62-66 FEBS 15009 Structure and differential response to abscisic acid of two promoters for the cytosolic copper/zinc-superoxide dismutase genes, zyxwvutsrqponmlkjihgfedcbaZYXW SodCcl and SodCc2, in rice protoplasts Atsushi Sakamoto*, Takekazu Okumura, Hironori Kaminaka, Kazuhiko Sumi, Kunisuke Tanaka Depurtment of‘ Biochemistry, College of Agriculture, Kyoto Prejkctural University. Shimogamo. Kyoto 606, Japan Received 14 November 1994; revised version received 5 December 1994 mizing oxidative damage to plant cells. Three types of SOD are Abstract We determined the 5’-flanking sequences of two nudistinguished by their associating metals: copper/zinc- (CulZn), clear genes (SodCcl and SodCc2) encoding cytosolic copper/ manganese(Mn-), and iron- (Fe-) isozymes [2]. CulZn- and zinc-superoxide dismutase zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA in rice (Oryza sativa L.). Utilizing Mn-metalloenzymes are ubiquitously distributed among plants. transient P-glucuronidase (GUS) reporter assays, functional proCulZn-SOD is the most abundant, occurring as two distinct moter-GUS analysis was performed in rice protoplasts exposed isoforms that are targeted to the cytosol and the chloroplast to the phytohormone abscisic acid (ABA) or the antioxidant stroma. Mn-SOD typically appears in the mitochondrial masulfhydryl reagent, dithiothreitol (DTT). Transcriptional activitrix, whereas Fe-SOD is found within the plastids of limited ties from both &Kc-GUS fusions were stimulated by DTT, plant species. SOD activities in plants are not only controlled which induces the promoter activity of the tobacco SodCc gene [Proc. Natl. Acad. Sci. USA 90 (1993) 310131121. ABA had no in a developmental manner, but they are also differentially effect on SodCcl-GUS expression but specifically induced the induced by a number of environmental cues which can cause gene expression of the SodCcZ-GUS fusion. The simultaneous oxidative stress in living cells (for a review, see [I]). Each cDNA application of ABA and gibberellin A,, however, abolished the for three plant SOD genes (Sod) has been cloned and sequenced enhancing effect of ABA. These results indicated that two rice from a variety of plant species. Because of its potential imporSodCc promoters differentially respond to externally supplied tance, cloned cDNAs have been used in transgenic studies to ABA and that one of the regulatory factors for plant SodCc achieve the enhancement of stress tolerance in plants (for a expression is ABA in addition to cellular redox-modulating antireview, see [3]). Gel blot analyses of RNA using isolated oxidants. cDNAs as probes have shown that the differential and developmental regulation of Sod expression primarily operates at the Key words: Abscisic acid; Differential gene regulation; Inducible promoter; Superoxide dismutase; Cellular redox; transcript level [4,5]. While studies have extensively focused Rice upon the isolation of cDNA clones, genetic engineering for antioxidative protection and analyses of the steady state-transcript levels, characterization of the Sod genes [6-91 and functional promoter studies [9-l l] have just begun. Recently, the 1. Introduction transcriptional regulation of two plant Sod promoters has been investigated in transgenic tobacco. HCrouart et al. [lo] have Plants are constantly challenged by various types of stress reported that reduced forms of sulfhydryl antioxidants, such as resulting from climatic and other environmental fluctuations, glutathione and dithiothreitol (DTT), can stimulate the tranand generate specific gene products that confer resistance and scriptional activity of the tobacco SodCc promoter, suggesting adaptation under severe conditions. One protein intimately asthe modulation of the SodCc expression by cellular redox levels. sociated with stress tolerance is superoxide dismutase (SOD; also directs developmentally regulated The SodCc promoter superoxide:superoxide oxidoreductase, EC 1.15.1.1) [ 11. SOD [l 11.Using a short promoter segment, Kardish gene expression zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPO is a metalloenzyme that promotes the disproportionation of the et al. [9] have shown the spatial and light-responsive regulation superoxide anion radical into molecular oxygen and hydrogen of the tomato chloroplastic CulZn-SOD gene. peroxide. Cooperating with other enzymes involved in hydroTo gain a better understanding of the regulation of plant Sod gen peroxide-detoxification systems, SOD contributes to miniexpression, we set out to characterize individual members of Sod families in rice (Oryza sativa L.) plants. We isolated cDNA *Corresponding author. Present address.. Department of Regulation clones coding for Cu/Zn- and Mn-isoproteins from developing Biology, National Institute for Basic Biology, Myodaiji, two rice genes (SodCcl and seeds [ 12,131. We also characterized Okazaki, 444 Japan. Fax: (81) (564) 54 4866. SodCc2)’ encoding cytosolic Cu/Zn-SOD, which brought the Internet: atsushi@nibb.ac.jp first information on the Sod exon/intron organization from plant sources [6,7]. As one approach to define the molecular The nucleotide sequence data reported in this paper have been deposited in the GenBank/EMBL/DDBJ Nucleotide Sequence Databases mechanisms responsible for plant Sod regulation and to idenunder the accession numbers L19434 (SodCc2) and i19435 (SodCcl). Abbreviations: ABA, abscisic acid: ABRE, abscisic acid-responsive element; Cu/Zn-SOD, copper/zinc-superoxide dismutase; GA,, gibberellin A,; GUS, /?-glucuronidase; SOD, superoxide dismutase; Sod, superoxide dismutase gene; SodCc2, cytosolic copper/zinc-superoxide dismutase gene. 0014-5793/95/$9.50 0 1995 Federation SSDl 0014-5793(94)01396-9 of European Biochemical Societies. ’ Two rice cytosolic Cu/Zn-SOD genes, SodCcI and SodCc2, were previously called sodA and sods, respectively, but have been renamed in accordance with the recommended nomenclature of plant genes (Zilinskas, B.A., Asada, K., Galun, E.. In& D. and Tanaka, K. (1994) Plant Mol. Biol. Rep. 12, S73-S74). All rights reserved 4. Sakamoto et cd. I FEBS Letters 63 358 11995) 62-66 tion (PCR). A 3 kb SacI-Ncol fragment which corresponds to the tify the actual inducers of the gene expression, we constructed 5’ region of the SodCcZ gene was recloned into Bluescript from the two chimeric /3-glucuronidase (GUS) reporter genes under the genomic /%clone gSOD27 (the Sac1 site is shown in Fig. I A and the Ncol SodCcl and SodCc2 transcriptional control of the 5’ regions of zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA site is located in the middle of the third exon of the gene). PCR was genes. Here, we investigated the structures of the S-flanking performed using the plasmid subclone as a template, the Ml3 primer sequences of rice SodCc genes and examined the effects of the M4 (Takara Shuzo, Otsu, Japan), and the mutated antisense oligonucleotide primer (5’~CTCACTGCTAGCAAGCACA-3’; the Nhrl site is phytohormone, abscisic acid (ABA), on the transcriptional acunderlined) to introduce an Noel the second exon of the SodCcI tivities of the SodC‘c promoters in rice protoplasts. The study gene. The NheI site was placed at the position identical to that found provided evidence that the two SodCc promoters differentially in the SodCc2 gene. An amplified 2.3 kb fragment was first cloned into respond to ABA, and that the 5’ region of the SodCc2 gene the pGEM-T vector (Promega, Madison, WI). Following PsrI (in the polylinker) and NheI digestion, the excised SodCcI 5’ fragment was conferred enhanced reporter gene expression in a transient inserted between the PslI and XhaI sites in pBI221 (NheI and XhrrI GUS assay. This is the first demonstration of the involvement produce compatible 5’ overhangs). Plasmid pSodCc2-GUS I was conof ABA in the regulation of plant Sod expression by a funcstructed as follows. A 7 kb-DNA fragment encompassing the entire tional promoter analysis. SodCc2 gene and its flanking regions was obtained by BamHl digestion 2. Materials and methods 2.1. Nucleotide sequence determination oj’rice SodCc S-flanking regions The rice SodO genes have been isolated and characterized [6,7]. Successively deleted plasmids were generated by means of exonuclease digestion after each 5’-flanking sequence was subcloned into the Bluescript vector (Stratagene, La Jolla, CA). Double-stranded DNA templates were sequenced in both directions using the ABI373A sequenator (Applied Biosystems, Foster City, CA). 2.2. of the SodCcpGUSjiision genes fusions between SodCc and GUS genes (pSodCclGUSI and pSodCc2-GUSI) were constructed in the transient GUS expression vector pBI221 [l4]. To construct pSodCcl-GUSI, site-directed mutagenesis was performed by means of polymerase chain reac- of gSOD7 1DNA and integrated into Bluescript at the appropriate restriction site. Following digestion at the Hind111 site in the polylinker and at the NhrI site located in the second exon, the released 2.2 kb fragment corresponding to the SodCc2 5’ region was fused translationally to the coding sequence of the GUS gene by ligation with the HindIIIlXhaI-cut pBI22 I. Both fusion constructs contain the 5’-flanking sequence, the 5’ non-coding exonhntron, and the coding sequence for up to 9 NH,-terminal amino acids of the corresponding SOD polypeptide instead of the cauliflower mosaic virus (CaMV) 35s RNA promoter in the original construct (Fig. 2). Translational fusion junctions in these chimeric constructa were verified by supercoil sequencing. Consrrucrion Two translational 2.3. Introduction oj ,/usion genes into rice pro~oplusrs Fusion plasmids were introduced into rice protoplasts according to Li et al. [I51 with slight modifications. Protoplasts were released from suspension cultured cells derived from embryogenic calli (Ori~rr .wtiw B A zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJ TICAGCAAGT T-XGT-TAGGA TTKTGATGA TGAAAACAGG ATTAATGATA zyxwvutsrqpo -2069 zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA TCTATCATAG ATGAGTTCIT -2196 ACTT&&mGTAITGTA TTGTCCTCCT TGAGCTTATT CATXGAGAT ACCGGTARAT -2009 ATITAGT'ITA ACTCGTGTCA -2136 GATGGATTGG TCTGGCGCAA -2076 PStI zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONM sac1 .@mCATCA GAGATG’lTTA TGTGTCGGTCCTTATATAAA ACATGTGGCT GAGACAAATT TGLLTTGTGT AGTCATTTCC ITTTKGTCC TGCITGATCT TTGAGCTTCA ATCGTAGATA GGATCTA?TG TTTAATTCZT CAGCAGCATI CGGGTG'IGGT CGGTGAGTAT AGTGTCAACA AAACGTGGTT ==zz=zz GZ,&W&CCG GTCCTTKAG AATCGGTGTA GTAATAACGT AAGAGGGTTA GATGGCAGTA -C GATQWSAXLATTATACGAG CTATCGBBAA mT-%CCGT GCTTCTAAAA TAAAACACIT TATKTACCA TAZTATTTAT TGTCCAAAAA CATCAAAAAA GTcTmCAT ATCGTI'AAGA ATACACAACA CCGTCGTTTC T'lTACAAACG AAhAATAATI TATAAATAAA A'FXAAAGAT GAAAAAAAAA CTTCGATGAA mm CAAAAT-ITGG TIGTGATAAA TTACAACGGG GACCGTCATA GTCAATP.AA ECORV GCCA@TATF GGAAATCCGT CACACAAGAC TTACGGCCAT TAGTA-LTTGA AT-m AGTACTACTC CAGAGGTTAT TCTTATTCGG ACmTATAT AAAAATCTTA CATGAGCGAA Bana ,~~~CTGAC ATGAAGTGCT CCCAGCTGAG -2016 CCTCATATTA CT-T~~~!YA CCTTKACAC CAAAAAAAAA ACACTGCRG AACGTGGTTG zY==zzz GCTCGGGAGA GCATARATTG TCAAGCTCAT AAAATATTCT AAACATTAGA TAACAT-ITAA AAACAACATA AGCGATCTAA TAAZTTAAGA CCCAAAI-RI -1956 -1896 ATXCAACAT TCT-KGTACG GGGACGTGTC TATCATCTGC ATTACAATGT GAAGAAT-ITC ATGATCCAGG TTCRAGTCAG GCAAATTAAT AAGCAAACTT RAT-AAA GGAAATAATT GACTGCAAAG TTGRAGTCTT TGTTGCCTTA GATGGTACTC ATKAGTAGA AGCCTAATCT TTCCCCGAAA TCCCTCCGAC TTI-KAGTAT GAAAAAAGCG ATGTGITm AAATAAACTA AAGATGAGAC -1836 -1776 -1716 -1656 -1596 -1536 -1476 -1416 -1356 -1296 npar TmAATE+A CAACTGCAAG -CAGAAG A'ITATTATTA CTGCCAGTTT CTCCAGATTC .QCIl TCGTCGTC?Z_c.E@SGGGTC HldlII cacccaagca.?~tqcttctagg gggtctccct ccctccctgc gctgcttcgc gwgatttgg gatgttgatt gatcgatcgg acggctcgtc tcqtgtgttt tgcgtggacc tgctgcttcc ggagggatac ggatttgtta ggctctggct gctcatgatg gttttttctg caagtgtqga gggtgqatgt agagaattgt TAATAAATAA GACTACAART CAAXCAGCA ACGAGGGcK ACCACCGCAC GGAGTCGCCT CCAATGTTGG ACCGCTGGAG CGCCTCCTCC CTGGTGGCTG GGAGGGGAAC T-KATCCTCC -1236 -1176 -1116 GCCTGAGqta gqaatcccaa gttttcgtga gtgtggatct gTctt'=TTTc tgttgttggt gaatccatat tttttttttt gttgccgatt cgatgggctt gttgattgca agatttggga cttgtttcct cagatggatc TggctgWW tcggggcgat gcaagttcaa ttccttttga actagtaata tgtgatatgt gagtgtcctt gttattggac caacccccc~ cccccccccc -1056 ccggtttcgt ggtgtttcct t'3WW'gggT tggttggttg gtgatgcgag gcgatgattc atcattggaa tcatgattag ccctgatatg tagccaacag gggaggcggt tgttggtctt TattTttTtg gtggggagga agtgttttga gtgctgctgc ttgtgtactg atttagacat tcgggggatt acagtttcct -996 -936 -676 -816 -756 -696 -636 -576 -516 -456 EC&I aggatgaaat atcccttcat gcagaaatga atggagggat T~?l9tT~g~~ atcccaaacc ctaagattga aacttaccct ttagatgggt gggaaatcat gaatggatag gattttctag ggataattcc tctatactag acgtgtgttt tgtttqtatc tagtatgttt gcagt9T3ca gtggcatttg ttctatgatg cctttggttt acatgctttq gaaaaaacaa tagatcattgggccatattgttatcttttt ctgactagta gtaaatgatg cgtctgtgtt gcttctgctt taacatcttt tcaatcttca ctaggataat ttcatagttc aatatgttct CgtS?Pt.%9 ttgggaactt tqttttgtgg GTAGCAGTGA ggttgggttt aatttgtfta CaZTGTTAAG xba1 tasgacctc~..?g~ggctact tctgccactt gctaagtaac cagATCACAT TAACAATGGT GAAGGCTGT-I GTTGKXTTG GGCACTATCC ACT-ITGTCCA AGAGGGAGAT Ggtatgccat T-IGTTGTACA CCTTCCAAAC AAACAACAAA TTGCCATGTC TGCTTACCAA C'ITAGGCAAG AmGGGAAA CGGAAATGAA ACAACTGlTT AACTTATGGT CTCCACITGT GCT'I-ITCCX GCAAAAGAAA CAATATGAAC AAGAGCAATT npar ACCTAGCCAA AgmJCGTC TAAATGAGTG CA'EACATAT TACGAAGTGT GGAAAGATTG GCTTCTGCGG AACTET GTAATCCTTI CCTGATTGAT GATGCCCTGT AGAAGTGTGG TTGTGTATAA ACTGATTAAC GTCATGCTCC TITGATGGGA ATITCG'I-IGG TATGGTAGGA 'ITCTGAAATT ATTGAGCTAT TITGATGGAG CCTGTGTTTT CAACTTTTCT ATGTCTTGTT TGTGTCTTGT TGTAGGGATG TCTCTGCTGA GCCCAAGATA CGTTGGCATT ATCCTCACTI TTAATATGAA AAGTACTAGA TGAGACCCCT TA?TAAAATT TGTAAAT-XA TTATGGTAAA AAAGGAACTT GATTGCTATC ATACAAAAGA CTAAGACATT 'ITGAATGGGC CTAGCCATCA GGAGTCTTAT CCTA- CGGAGAGGGA TKTXAAGA GTAGGTAACC AAAGAAAAGC CCTCCTCCCT CAGATCGCCT cccccaactt gctccgattc cgattcggcc atctcaggct catgtggtag TCTGGAGTCT TCTCGTCGCG tctagggttc cgccggagta gcgcttcggt cgacatqtgg ggqggctttt TCCTCATCAG CTCGCGCCGC taatcgcctc gctggstctg ttgttctcgc acggccacaa caggatcgga -AGGGATACAA TATATGTATA TCAACTTTTC CTGTAGGGAC GT-I-KCGTTG TATTATCTGT CGGACAAACC -1949 -1889 -1829 -1769 AGAATCACTA GGCmAAT-I TAATATAACA AGGTACAGTE TTCITATA~ CTACCAAACA -1709 -1649 -1589 TAATAAATTG GTRCCTAGG GCAAAGTGTG ATGGCCATAC ATTAAAAGAA AAACGCTCCT *par TTGGA@GCC -1529 -1469 -1409 TGCTATIGTC AGCATCAAAG GCA?Q+TTAAG TGTAAGAAGG GGCCACAGGT GGGATATTGA GTI-I-ITGTGCTAGGCTGGGA -1349 AGGAGACTCC GTATTTACCA AAGGGTATGT ATTTAGTTTC CTTCTATGTI CTICAAATTT AGAAACRACA CGCAAGTCAG GCGGGAAATC AAATAT-EAA GAACGAAAGA TAACAGACAG GA_@TQCTT GTGTCCACGT GATCATGGAC CTGCAAGCCA GCGTGTTGCA CATATI'AGTA CTGACWTC GATITTGATC EC&" CTGATGAGAA GGACTGGACT -1289 -1229 -1169 -1109 -1049 -989 -929 -869 -803 TAAGCAAATC CTQJ,A?TIT -749 -689 AAATCAGAAG AGGGGTCGCC tgctcgctcg tgtgccccgt gcgtgattgc acataaaaaa ggtttaggtg AGGAGAGGGT GGGCAACTCG TGAGqtatqc aqcttcacct gattatqcgt ggtgggtatq gcta?.tttalJgtttqgcttt ttcgttcggc catagggctc tccttgttaa atttacggtt atttggagta gcaaaacgat -629 -569 -509 -449 -389 -329 -269 -396 -336 -276 -216 -156 -96 -36 25 85 -209 -149 -89 -29 ttcqgcttct qtgcagAACA CATAGACAAT GGTGAAGGCT GTTGCTGTGC m_GCC&GCAG 32 Fig. I. Nucleotide sequences of the 5’ regions of rice SodCc genes. (A) The SodCcI gene. (B) The .SodCc,Z gene. Nucleotide residues are numbered relative to translation start site as +I. Bold-face indicates presumptive CAAT boxes, the 5’ end of the longest cDNA and the translation startmethionine codon. The 5’ non-coding intron is shown in lower letter case. Motifs similar to the heat shock elements (GAANNTTC) are underlined. Direct repeat sequences are shown in italic letters. A complementary sequence to the mutated oligonucleotide primer used for pSodCcl-GIJSI construction is also indicated in italics (Fig. IA). The double underline refers to the putative ABA-responsive element (ACGTG) or the as-l motil (TGACG). The dotted line indicates the restriction site with its name above the sequence. 64 A. Sakamoto et ul. IFEBS Letters 358 (1995) 6246 was found between repeated motifs. ABREs in the SodCcl 5’ region appeared within the direct repeats. Although the structural organization was quite similar between the two genes [6,7], the 5’ upstream regions had only limited sequence homology, except for a stretch of 38 bp between positions -1360 and - 1323 bp in the SodCcl gene and between -98 1 and -946 bp in the SodCc2 gene (Fig. 2A). L. cv. Nipponbare) during a 3-hour incubation at 28°C without shaking in enzyme solution containing 4% Cellulase RS, 1% Macerozyme R-10 (both from Yak&, Tokyo, Japan) and 0.4 M mannitol. The protoplast suspension was filtered through a 30pm sieve to remove undigested cell clumps and debris, then mixed with a two volumes of KMC solution [15]. The filtrates were centrifuged at 130 x g for 5 min and protoplast pellets were washed twice with KMC. Protoplasts were resuspended (4x 10” protoplasts/ml) in MaMg solution [15]. Aliquots (1 ml) of protoplast suspension were mixed with plasmid DNA and carrier DNA (each 40 pug/ml). After incubating protoplast/DNA mixtures for 15 min at room temperature, 1.85 ml of 40% polyethyleneglycol (PEG) 6,000 in MaMg was gently applied. After an incubation for 30 min at room temperature, protoplasts were suspended in 40 ml KMC and centrifuged at 130 x g for 5 min. Protoplast pellets were resuspended in General medium [15] supplement with sucrose (106.9 g per liter) and cultured at 28°C for 48 h in the dark. 3.2. Transcriptional activities of rice the SodCc promoters in protoplasts To analyze SodCc promoter functions, the expression of chimeric genes containing 5’-flanking regions of rice SodCcl and SodCc2 genes linked to the coding sequence of GUS was examined in protoplasts prepared from suspension cultured 2.4. zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA Assay for transient GUS uctivity cells after PEG-mediated DNA uptake. Fusion constructs beTo suppress endogenous GUS activity, a modified protocol [16] was tween rice SodCc 5’ regions and the GUS gene are shown in Fig. employed for the fluorimetric determination of 4-methylumbelliferone 3. Translational fusion allowed the inclusion of the first intron, (4-MU) produced from the cognate glucuronide (4-methylumbelliferylwhich occurred in the 5’ untranslated region of each SodCc B-D-glucuronide) in protoplast extracts. The protein concentration was measured by the method of Bradford [17]. GUS activity was normalized according to the expression derived from pB1221 in control experiments (average 204 pmol of 4-MU produced per minute per pg of protein obtained from four independent experiments = 1). gene, in the chimeric constructs. Fig. 4 shows the results of transient GUS assays for rice protoplasts transformed with pB1221 and two SodCc-GUS fusions. Since the CaMV 35s promoter confers constitutive expression to a downstream reporter gene [22], pB1221 was used as the positive control plas3. Results mid of PEG-mediated transformation and also for the negative standard of inducible or responsive gene expression. As shown 3.1. Characterization of S- flanking regions of rice SodCcgenes in Fig. 4A, the application of ABA and DTT to transformed We determined the nucleotide sequences of more than lprotoplasts did not substantially alter the pattern of GUS activSodCc genes from rice kilobase at the S-flanking ends of two zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA ities from this constitutive expression cassette. Basal levels of (Fig. 1). The 5’ upstream regions of these genes contained GUS expression from pSodCcl-GUS1 and pSodCc2-GUS1 sequences with homology to known regulatory elements identiwere 1.6- and 0.6-fold, respectively, compared to that of fied in other plant genes. Neither upstream region displayed pB1221. Expression of both SodCc-GUS constructs was stimuconsensus TATA signals, but both had a CAAT box. Two and lated by DTT (1 mM), a known inducer of tobacco SodCc three putative ABA-responsive elements (ABREs) [ 18,191were transcription [lo]. Since both rice SodCc-promoter sequences found in the SodCcl and SodCc2 5’ regions, respectively. Ancontained ABRE motifs, we added ABA (100 PM) for the other plant c&acting factor, as-l [20], was found in the SodCc2 transient assay. The GUS activity derived from pSodCclpromoter, but not in the SodCcl region. Several putative heatGUS1 remained at the same level as those of controls, and shock elements [21] were found in each promoter region therefore the SodCcl promoter did not respond to ABA. How(SodCcl, 7; SodCc2, 4). Complete direct repeats, consisting of ever, exogenous ABA enhanced the reporter gene expression 11 and 24 bp-units, were identified in SodCcl and SodCR from pSodCQ-GUS1 with the average increase in enzyme ac5’ upstream sequences, respectively. No nucleotide similarity tivity being about 7-fold. This was in marked contrast to the A ??? ? ? ? ? ? ? ? ? ? ??? ? ? SodCc Z (rice) SodCcl (rice) SodCc (tobacco) ? ? ? ? ?? ?? ??? ??? zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLK -946 -981 TAATATT-AAAATTTGTAAATT-GATTATGGTAAACAT IIIII I II II IIIIIII IIIIIII III III zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA - 1360 TAAGATTGAAAATTTCAAAATTTGGTTGTGATAAACAT - 1323 II I I I I IIlIIlIIII I I I I II -386 -423 CAAWATAATATTTTCAAAATTAAGGTAAGGTGCACGC B SodCcl Trxh - 1491 - 455 AAGCGAAACAACATATTTACAAACG~T~TTTATAIlATAAAACTTTTATATA-TGTGTTTTTAGCGATCT~T -1414 III I I I I I I I I I IIIIIlIlIIIIl zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJ III III III1 ll/IIlIIlI IIIIlIIII IIIIIIIIII III -383 AAGCGAAACGACATATTTACGAACACAAAATAATTTGTAACTTTTATATACTGTG-----AGCGATCTAAAT Fig. 2. Homologous sequences in the S-flanking regions between rice SodCc and other genes, The vertical bars represent nucleotide identity and the minus signs show gaps. Numbers refer to nucleotide positions relative to start of translation (SodCcl and SodCc2) or transcription (tobacco SodCc and rice thioredoxin h) as +l. (A) Homology among rice SodCcl, SodCc2 and tobacco SodCc genes. Conserved residues are marked with asterisks above the alignment. (B) Homology in the 5’ upstream regions between SodCcl and thioredoxin h (Trxh) genes from rice plants. The genomic sequence for rice thioredoxin h was cited from the GenBank database (D26547 deposited by Y. Ishiwatari and M. Chino). A. Sakamolo CI al. I FEBS Lrttrrs v s E A CM 65 358 (1995) 62456 X sion of the SodCc2-GUS chimeric gene is specific to the 5’ region of the SodCc2 gene. We therefore concluded that the 2.2 kb fragment from the SodCc2 5’ region at least partly comprised the &-acting element(s) necessary for ABA-mediated hormonal regulation. BM pSodCcl-GUSl BP A A V E 0M 4. Discussion pSodCcZGUS1 To identify the regulatory factors of plant Sod families, we determined the nucleotide sequences of the 5’-flanking regions YVKAVAVLNRGSPGGQSLM zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA of two Sod0 genes from rice and investigated the transient OSkbp transcriptional activities of the promoters in a homologous gene expression system. Both SodCc promoters were activated Fig. 3. Two SodC’c~GUS chimeric constructs (pSodCcl-GUS1 and by exogenous DTT, but the responsiveness of the promoters to pSodCcZ-GUSl) used for transient transformation of rice protoplasts. Hatched and open boxes refer to exons and introns, respectively, while ABA was markedly different. The SodCc2 promoter was stimshaded boxes indicate the 5’-flanking regions. The GUS coding sepromoter was not. ulated in response to ABA, but the Sod01 quence shown by a closed box is not represented in scale. The amino This differential expression of two similar genes indicates that acid sequence of a translational fusion between SodCc and GUS genes they play somewhat different roles in the stress response and is indicated in one letter code below each construct. Boldface residues denote SodQ and GUS translation initiation methionines and fusion that different mechanisms occur in the control of the SodC’c, junctions are indicated by slashes. Restriction sites are: A, A@; expression in rice under some environmental conditions. Also, B, BumHI; C, SacII; E, EcoRI; H, HindIII; M, SmaI; P, &I; S, SacI; our results confirmed the activation of plant SodCc promoters V, EcoRV; X, Xhal. by antioxidant sulfhydryl molecules, suggesting that the cellular redox-mediated regulation is a common regulatory aspect of in which there was results from pBI221 and pSodCcIGUS1, the SodCc expression in plants. no apparent increase in GUS activity in the presence of ABA. Phytohormones act positively upon plant Sod expression at Since ABA and gibberellin A,(GA,) often function as antagosteady state mRNA levels. Ethylene and salicylic acid stimulate nistic regulators, we examined whether the effect of ABA in the Mn-SOD gene expression in tobacco and rubber trees [8,23]. SodCcZLGUS expression is hampered by GA,. incubation in Ethylene also induces the accumulation of tomato SodCc tranthe presence of both phytohormones, indeed, resulted in no scripts [4]. Our results showed that ABA promotes the reporter enhancement of the activity, thereby suggesting that the trangene expression driven by the 5’ region of an rice SodCc gene, scriptional activity is regulated by both phytohormones. The providing direct evidence that this phytohormone is involved ABA concentrations (0. 1, 5, 10 and 100 PM) were titrated to in the transcriptional activation of the plant Sod promoter. induce the full activity of the SodCc2 promoter. Fig. 4B shows Kanematsu and Asada commented [24] that rice cytosolic Cu/ that 10pM ABA is sufficient to maximally induce the SodCc2Zn-SODS III and IV, either of which is the putative SodCc2 GUS expression. The expression of GUS activities was proporgene product [12], are dominant in the seed embryos but their tional to ABA concentration from 1 to 10 PM. These results activities decrease following seed germination. The pattern clearly demonstrated that hormonal regulation of the expresof transient SodCc.2-GUS expression correlated well with this B zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFED A T pBl221 pSodCcl-GUS1 1 T pSodCcP-GUS1 0 1 10 5 ABA 100 WI Fig. 4. Transient GUS expression in rice protoplasts transformed with chimeric constructs. (A) The effects of ABA and DTT on transient GUS expression from pB1221. pSodCcl-GUSI and PSodCcZ-GUSI. Transformed rice orotoolasts were incubated at 28°C for 48 h without or with rhr foilowing at the indicated’concentrations: ABA, IOOflM; GA,, 100pM: DTT, I m&M.Thereafter, GUS activities (pmol 4-MU produced per minute per microgram protein) were fluorimetrically determined and normalized by comparison with control experiments of pB122 I. Mean values from four Independent experiments are shown. Vertical lines refer to standard errors. (B) The effect of various concentrations of ABA on GUS activity from pSodCQ-GUS 1. Protoplasts were incubated with the indicated concentrations of ABA for 48 h immediately after transformation with pSodCc2-GUS. The relative GUS activity is shown from two independent experiments. The results are independent from those shown zyxwvutsrqponmlkjihgfedc in Fig. 4A, so the degree of induction by DTT at 100 PM is somewhat altered. A. Sakamoto et ul. IFEBS zyxwvutsrqponmlkjihgfedcbaZ Letters 358 (1995) 62-66 66 activity profile since the transcriptional activity of the SodCc2 regulatory sequences involved in sulfhydryl reagent- and ABA5’ region was elevated by ABA , but the effect was abolished responses and characterization of trans-acting factors associby the germination-promotive GA,. ABA differentially actiated with each promoter region should provide more insight into the mechanisms of plant Sod expression. vates the expression of other antioxidant defense multigenes encoding catalase in maize endosperms [25]. These observaAcknowledgements: This work was supported in part by a Grant-in-Aid tions imply that specific member(s) of antioxidant defense mulfor Scientific Research on Priority Areas (No. 04273102) from the tigene families such as those of Sod and Cat are organized in Ministry of Education, Science and Culture, Japan. AS. is grateful to an ABA-regulated manner in the plant genome and that their the Japan Society for the Promotion of Science for Japanese Junior expression is coordinately conducted in response to increased Scientists for a postdoctoral fellowship. ABA levels within plant cells during seed maturation or under environmental stresses such as desiccation, high osmotic presReferences sure and low temperature. We found several putative cis-acting elements which are sup[l] Bowler, C., Van Montagu, M. and Inz&, D. (1992) Annu. Rev. posed to be involved in the regulation of rice SodCc genes. Each Plant Physiol. Plant Mol. Biol. 43, 83-I 16. [2] Asada, K., Kanematsu, S., Okada, S. and Hayakawa, T. (1980) in: promoter contained several heat shock-resemble elements. ToChemical and Biochemical Aspects of Superoxide and Superoxide bacco SodCc expression is induced by heat shock and there are Dismutase (Bannister, J. V. and Hill, H.A.O. Eds.) pp. 136153, several heat shock elements in its promoter region [5,1 I]. Motifs Elsevier, Amsterdam. like ABREs have been identified in both rice SodCc promoters, [3] Htrouart, D., Bowler, C., Willekens, H., Van Camp, W., Slooten, L., Van Montagu M. and Inze, D. (1993) Phil. Trans. R. Sot. but the elements in the SodCcl sequence seemed not to function Lond. B 342, 235-240. since this promoter was not responsive to ABA. One of the [4] Perl-Treves, R. and Galun, E. (1991) Plant Mol. Biol. 17,745%760. ABRE (positions -716 to -705) in the SodCc2 promoter is of [5] Tsang, E.W.T., Bowler, C., Herouart, D., Van Camp, W., particular interest. The motif and surrounding nucleotides form Villarroel, R., Genetello, C., Van Montagu, M. and Inz&, D. (1991) a perfect 12-bp palindromic structure (5’-GTCCACGTGGACPlant Cell 3, 783-792. [6] Sakamoto, A., Okumura, T., Ohsuga, H. and Tanaka, K. (1992) 3’) with the G-box core, CACGTG, in its center. The hexameric FEBS Lett. 301, 185-189. sequence is classified into the A type G-box according to the [7] Sakamoto, A., Okumura, K., Kaminaka, H. and Tanaka, K. sequence analogy of the flanking regions [26]. HCrouart et al. (1995) Plant Physiol., in press. [1 1] zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA pointed out the presence of two homologous boxes between [S] Miao, Z. and Gaynor, J.J. (1993) Plant Mol. Biol. 23, 267-277. [9] Kardish, N., Magal, N., Aviv, D. and Gahm, E. (1994) Plant Mol. the promoters for the tobacco SodCc and the bean chalcone Biol. 25, 887-897. synthase genes. Apparent homology to these sequences, how[IO] Htrouart, D., Van Montagu, M. and Inzk, D. (1993) Proc. Nat]. ever, was not detected in the rice promoters. Instead, the toAcad. Sci. USA 90, 3108-3112. bacco SodCc sequence showed moderate homology to the con[l l] Htrouart, D., Van Montagu, M. and Inzk, D. (1994) Plant Physiol. served region between two rice promoters (Fig. 2A). Whether 104, 873-880. [12] Sakamoto, A., Ohsuga, H. and Tanaka, K. (1992) Plant Mol. Biol. or not the region plays a role in plant SodCc regulation remains 19, 323-327. to be proven, but it might be responsible for coordinated induc[13] Sakamoto, A., Nosaka, Y. and Tanaka, K. (1993) Plant Physiol. tion by thiol molecules. A search for sequence similarities of 103, 1147-l 148. rice SodCc S-flanking sequences in the GenBank database re[14] Jefferson, R.A., Kavanagh, T.A. and Bevan, M.W. (1987) EMBO J. 6, 3901-3907. vealed the striking homology of over 70-nucleotide residues in [15] Li, Z., Burow, M.D. and Murai, N. (1991) Plant Mol. Biol. Rep. h the promoter sequences of the SodCcl and rice thioredoxin 8, 276-291. genes (GenBank Accession Number D26547) (Fig. 2B). This [16] Kosugi, S., Ohashi, Y., Nakajima, K. and Arai, Y. (1990) Plant long stretch of nucleotide similarity was not found in the Sci. 70, 133-140. SodCc2 promoter. Thioredoxin h is a cytosolic form of the [17] Bradford, M.M. (1976) Anal. Biochem. 72, 248-254. [I81 Marcotte Jr., Russell, W.R. and Quatrano, R.S. (1989) Plant Cell protein in higher plant cells and it participates in a number of I, 969-976. cellular redox reactions where disulfide linkages formed as a [19] Yamaguchi-Shinozaki, K., Mundy, J. and Chua, N.-H. (1990) consequence of oxidative damage may be reversibly reduced to Plant Mol. Biol. 14, 29-39. a dithiol. Although the significance of the conserved sequence [20] Lam, E.. Benfey, P.N., Gilmartin, P.M., Fang, R.X. and Chua, N.-H. (19891 Proc. Natl. Acad. Sci. USA 86. 7890-7894. in the regulation of the SodCcl gene is yet to be tested, the [21] Gurley, W.B. and Key, J.L. (1991) Biochemistry 30, l-12. expression patterns of the SodCcl and the thioredoxin h genes [22] Skriver, K., Olsen, F.L., Rogers, J.C. and Mundy, J. (1991) Proc. in plants should be examined since the state of cellular redox Natl. Acad. Sci. USA 88, 7266-7270. appears to involve the regulation of plant SodCc genes. [23] Bowler. C.. Alliotte. T.. De Loose, M., Van Montagu, M. and zyxwvutsr In conclusion, we examined the structure and function of two InzC, d. (1489) EMBO j. 8, 31-38. S. and Asada, K. (1989) Plant Cell Physiol. 30, 381~241Kanematsu, promoters of the rice SodCc genes in rice protoplasts by tran391. sient assays for GUS activity after transformation with proJ.G. (1992) Proc. Natl. Acad. ~251Williamson, J.D. and Scandalios, moter-reporter gene fusions. Both promoter activities were coSci. USA 89, 8842-8846. ordinately induced by an antioxidant sulfhydryl reagent but WI Williams, M.E., Foster, R. and Chua, N.-H. (1992) Plant Cell 4, 485496. their responses to ABA markedly differed. Dissecting cis-acting View publication stats